1.Thyroid Hormone Network Regulation in MASLD: Mechanisms and Targeted Therapies
Wen-Ping XIAO ; Yang MA ; Heng GUAN ; Sha WAN ; Wen HAN ; Bing-Bing LUO ; Wu-Feng WANG ; Fang LIU
Progress in Biochemistry and Biophysics 2026;53(3):643-661
Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.
2.Correlation of corneal α angle and κ angle with lens tilt angle using swept-source optical biometry
Zi-Suo LI ; Zi-Han HE ; Jie ZHOU ; Jian-Feng ZHAO ; Xiao-Ling LUO ; Ya-Li FENG ; Chen YANG ; Yu GENG
Medical Journal of Chinese People's Liberation Army 2025;50(9):1083-1088
Objective To investigate the correlation of corneal α angle and κ angle with lens tilt in normal human eyes using a new swept-source optical biometer.Methods A cross-sectional study was conducted,involving 303 healthy eyes(148 right eyes and 155 left eyes)of patients who visited the First Affiliated Hospital of Kunming Medical University from June to August 2024.ZW-30 swept-source optical biometer was used to collect the lens tilt angle,κ angle(distance from the corneal light reflex to the pupil center),and α angle(distance from corneal light reflex to the corneal geometric center,which is the midpoint of the horizontal white to white(WTW)diameter).The degrees(°)and directions of κ angle and α angle were calculated by the ratio of the above measurements to the anterior chamber depth(ACD)respectively.Spearman correlation analysis and linear regression analysis were employed to evaluate the correlations between the magnitude and direction of corneal α angle,κ angle and lens tilt angle.Results The magnitude and direction of corneal α angle,κ angle,and lens tilt angle in the right eye were as follows respectively:(0.54±0.19)mm(7.81°±3.88°),194.43°±39.75°;(0.27±0.23)mm(4.72°±3.90°),181.07°±79.59°;5.52°±1.67°,188.21°±25.73°.For the left eye,the corresponding values were:(0.47±0.27)mm(8.12°±5.26°),336.04°±46.64°;(0.26±0.27)mm(4.45°±4.80°),322.86°±107.79°;5.50°±1.61°,340.65°±32.84°.Spearman's correlation analysis showed that the correlation coefficients between corneal α angle and lens tilt angle in the right eye were 0.609(distance correlation)and 0.625(angle correlation),while those for κ angle were 0.559(distance correlation)and 0.578(angle correlation).In the left eye,the correlation coefficients between corneal α angle and lens tilt angle were 0.545(distance correlation)and 0.552(angle correlation),and those for κ angle were 0.377(distance correlation)and 0.395(angle correlation).In addition,the correlation coefficient between the direction of corneal α angle and the direction of lens tilt angle in the right eye was 0.343,and that for κ angle direction was 0.284;in the left eye,the correlation coefficients were 0.216(α angle direction)and 0.198(κ angle direction),all with statistical significance(P<0.05).Univariate linear regression analysis showed that lens tilt was positively correlated with both corneal α angle and Kappa angle(P<0.05).Conclusions Corneal α angle and κ angle are highly correlated with lens tilt angle in both eyes,and the correlation of corneal α angle is stronger than that of κ angle in both left and right eyes.The correlation expressed by degree(°)is better than that by distance(mm).It is recommended to refer to the corneal α angle and κ angle expressed in degrees during preoperative evaluation.
3.Research progress on the role of macrophage polarization in drug-induced liver injury
Guo-Jing XING ; Li-Fei WANG ; Long-Long LUO ; Yuan DENG ; Zhen WANG ; Xiao-Feng ZHENG ; Xiao-Hui YU ; Jiu-Cong ZHANG
Medical Journal of Chinese People's Liberation Army 2025;50(11):1478-1484
Drug-induced liver injury(DILI)is a common adverse drug reaction in clinical practice,which can lead to acute liver failure and even death in severe cases.In recent years,with the continuous introduction of new drugs and the expansion of their usage,the incidence and mortality rates of DILI have shown an upward trend,posing significant challenges to public health and clinical treatment.Macrophages,as a crucial component of the innate immune system,exhibit high plasticity and heterogeneity.They can polarize into pro-inflammatory M1 type or anti-inflammatory M2 type in response to microenvironmental signals.Research has demonstrated that macrophage polarization plays a central regulatory role in the occurrence and progression of DILI by influencing various processes such as inflammatory responses,cell apoptosis,and tissue repair.This review focuses on elucidating the regulatory mechanisms and roles of macrophage polarization in DILI,providing a theoretical framework for developing precise immunotherapeutic strategies.
4.Inhibitory effects of Shuyu Pills combined with everolimus on TGF-β1-induced epithelial-mesenchymal transition in triple-negative breast cancer cells
Xiao-shan LUO ; Su XIE ; Dou-dou FENG ; Yan-yun MENG ; Jing-zhe ZHAO ; Qing XIE ; Xiang-li LING
Chinese Traditional Patent Medicine 2025;47(7):2190-2197
AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P<0.01);and increased protein expressions of N-cadherin and Vimentin(P<0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P<0.01);increased protein expressions of PTEN and E-cadherin(P<0.05,P<0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P<0.05,P<0.01);and more significantly in the Shuyu Pills combined with evolimus group(P<0.05,P<0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.
5.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.
6.Studies on pharmacological effects and chemical components of different extracts from Bawei Chenxiang Pills.
Jia-Tong WANG ; Lu-Lu KANG ; Feng ZHOU ; Luo-Bu GESANG ; Ya-Na LIANG ; Guo-Dong YANG ; Xiao-Li GAO ; Hui-Chao WU ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(11):3035-3042
The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals
;
Drugs, Chinese Herbal/isolation & purification*
;
Mice
;
Male
;
Sleep Initiation and Maintenance Disorders/physiopathology*
;
Humans
;
Myocardial Infarction/drug therapy*
;
Myocardial Ischemia/drug therapy*
7.Clinical correlation study between bone metabolism level and knee osteoarthritis pain.
Yong-Qi SUN ; Ke-Chun GUO ; Ze-Zhong LIU ; Jin-Shuai DUAN ; Bing XU ; Guo-Gang LUO ; Xian-Liang LAI ; Xiao-Feng WANG
China Journal of Orthopaedics and Traumatology 2025;38(5):482-486
OBJECTIVE:
To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain.
METHODS:
A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC.
RESULTS:
The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r2=0.045, P<0.01).
CONCLUSION
Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans
;
Female
;
Male
;
Middle Aged
;
Osteoarthritis, Knee/metabolism*
;
Aged
;
Adult
;
Bone and Bones/metabolism*
;
Pain/etiology*
;
Biomarkers/metabolism*
8.Effectiveness and safety of augmentative plating technique in managing nonunion following intramedullary nailing of long bones in the lower extremity: A systematic review and meta-analysis.
Cong-Xiao FU ; Hao GAO ; Jun REN ; Hu WANG ; Shuai-Kun LU ; Guo-Liang WANG ; Zhen-Feng ZHU ; Yun-Yan LIU ; Wen LUO ; Yong ZHANG ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(3):164-174
PURPOSE:
To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity.
METHODS:
PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3.
RESULTS:
This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002).
CONCLUSION
In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans
;
Bone Nails/adverse effects*
;
Bone Plates/adverse effects*
;
Femoral Fractures/surgery*
;
Fracture Fixation, Intramedullary/methods*
;
Fractures, Ununited/surgery*
;
Lower Extremity/injuries*
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Laboratory Diagnosis and Molecular Epidemiological Characterization of the First Imported Case of Lassa Fever in China.
Yu Liang FENG ; Wei LI ; Ming Feng JIANG ; Hong Rong ZHONG ; Wei WU ; Lyu Bo TIAN ; Guo CHEN ; Zhen Hua CHEN ; Can LUO ; Rong Mei YUAN ; Xing Yu ZHOU ; Jian Dong LI ; Xiao Rong YANG ; Ming PAN
Biomedical and Environmental Sciences 2025;38(3):279-289
OBJECTIVE:
This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF.
METHODS:
Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus.
RESULTS:
LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response.
CONCLUSION
The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans
;
China/epidemiology*
;
Genome, Viral
;
Lassa Fever/virology*
;
Lassa virus/classification*
;
Molecular Epidemiology
;
Phylogeny

Result Analysis
Print
Save
E-mail