Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

To investigate the effects of phosphorus fertilizer on the morphological traits, active ingredients and rhizosphere soil microbial community of Polygala tenuifolia. The phosphorus fertilizer was calculated in terms of P_2O_5. Five treatments were set up: 0(CK), 17(P1), 34(P2), 51(P3), and 68(P4) kg per Mu(1 Mu≈667 m~2). A randomized block design was adopted. Samples of P. tenuifolia and its rhizosphere soil were collected under different superphosphate fertilizer treatments. Illumina high-throughput sequencing was used to analyze the rhizosphere soil microbial community, 9 morphological traits were measured and the content of 11 active ingredients were determined. The results showed that the whole plant weight, shoot fresh weight, root weight, and root peel thickness were the highest under P1 treatment, increasing by 34.41%, 38.80%, 39.21%, and 3.17% respectively compared to CK. Under P2 treatment, the plant height, stem diameter, root thickness, and core thickness were significantly higher than CK. Phosphorus fertilizer had a significant impact on the content of tenuifolin, sibiricose A5, sibiricose A6, arillanin A, 3,6'-disinapoyl sucrose, and polygalaxanthone Ⅲ. Correlation analysis results showed that the relative abundance of Arthrobacter, Bacillus, norank＿f＿Vicinamibacteraceae, norank＿o＿Vicinamibacterales, MND1 and other bacteria, as well as the relative abundance of Neocosmospora, Paraphoma and other fungi were positively correlated with root diameter, wood core diameter, the whole plant weight, root weight, shoot fresh weight of P. tenuifolia. Bacillus, Neocosmospora, Subulicystidium were significantly positively correlated with oligosaccharides such as 3,6'-disinapoyl sucrose, sibiricose A5、sibiricose A6、glomeratose A、arillanin A and tenuifoliside C. Arthrobacter, Humicola, Aspergillus, Paraphoma were positively correlated with tenuifolin and norank＿f＿Vicinamibacteraceae, norank＿o＿Vicinamibacterales, Fusarium were positively correlated with polygalaxanthone Ⅲ. Evidently, appropriate phosphorus application is conducive to the growth and quality improvement of P. tenuifolia, and can increase the abundance of beneficial microorganisms in the soil.
Rhizosphere ; Phosphorus/pharmacology* ; Soil Microbiology ; Polygala/anatomy & histology* ; Fertilizers/analysis* ; Bacteria/metabolism* ; Soil/chemistry* ; Microbiota/drug effects* ; Plant Roots/metabolism*

Quality control is a key link in the modernization process of traditional Chinese medicine(TCM). Studies have shown that the effects of active components in TCM depend on not only their chemical composition but also their suitable physical forms and states. The physical phase structures, such as micelles, vesicles, gels, and nanoparticles, can improve the solubility, delivery efficiency, and targeting precision of active components. These structures significantly enhance the pharmacological activity while reducing the toxicity and side effects, demonstrating functional activity surpassing that of active components and highlighting the key effects of "structures" on "functions" of active components. Taking the physical phase structure as a breakthrough point, this paper outlines the common types of TCM physical phase structures. Furthermore, this paper explores how to realize the quality upgrading of TCM through the precise regulation of physical phase structures based on the current applications and potential of TCM physical phase structures in processing to increase the efficacy and reduce the toxicity, compounding and decocting processes, drug delivery systems, and quality control, aiming to provide novel insights for the future quality control of TCM.
Quality Control ; Drugs, Chinese Herbal/standards* ; Medicine, Chinese Traditional/standards* ; Humans ; Drug Delivery Systems

Background With the progression of industrialization, an increasing number of emerging contaminants are entering aquatic environments, posing significant threats to the safety of drinking water. Therefore, establishing a system for identifying unknown hazardous factors and implementing safety warning mechanisms for drinking water is of paramount importance. Among these efforts, non-target screening plays a critical role, but its effectiveness is largely constrained by the scope of coverage of sample pre-treatment methods. Objective To integrate modern chromatography/mass spectrometry techniques with advanced data mining methods to develop a non-discriminatory sample pre-treatment method for comprehensive enrichment of unknown contaminants in drinking water, laying a technical foundation for the discovery and identification of unknown organic hazardous factors in drinking water. Methods A non-discriminatory pre-treatment method based on supramolecular and solid-phase extraction was developed. The final target compounds including 333 pesticides, 194 pharmaceuticals and personal care products (PPCPs), and 59 per- and polyfluoroalkyl substances (PFASs) were used for optimizing the pre-treatment method, confirming its coverage. The impacts of different eluents on the absolute recovery rates of target compounds were compared to select the conditions with the highest recovery for sample pre-treatment. The effects of different supramolecular solvents and salt concentrations on target compound recovery were also evaluated to determine the most suitable solvent and salt concentration. Results The solid-phase extraction elution solvents, supramolecular extraction solvents, and salt concentrations were optimized based on the target compound recovery rates. The optimal recovery conditions were achieved using 2 mL methanol, 2 mL methanol (containing 1% formic acid), 2 mL ethyl acetate, 2 mL dichloromethane, hexanediol supramolecular solvent, and 426 mg salt. The detection method developed based on these conditions showed a good linear relationship for all target compounds in the range of 0.1-100.0 ng·mL⁻¹, with R² > 0.99. The method’s limit of detection ranged from 0.01 ng⁻¹ to 0.95 ng⁻¹, and 95% of target compounds were recovered in the range of 20%-120%, with relative standard deviation (RSD) less than 30%, indicating good precision. Conclusion The combined pre-treatment method of solid-phase extraction and supramolecular solvent extraction can effectively enrich contaminants in drinking water across low, medium, and high polarities, enabling broad-spectrum enrichment of diverse trace contaminants in drinking water. It provides technical support for broad-spectrum, high-throughput screening and identification of organic pollutants in drinking water, and also serves as a reference for establishing urban drinking water public safety warning systems.

OBJECTIVE: To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain. METHODS: A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC. RESULTS: The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml^-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r²=0.045, P<0.01). CONCLUSION Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans ; Female ; Male ; Middle Aged ; Osteoarthritis, Knee/metabolism* ; Aged ; Adult ; Bone and Bones/metabolism* ; Pain/etiology* ; Biomarkers/metabolism*

OBJECTIVE: To preliminarily investigate the effects and mechanism of action of Yishen Yangsui Formula (, YSYSF)on the recovery of neurological function in rats with degenerative cervical myelopathy. METHODS: Fifty adult SD female rats were randomly divided into control group, sham group, model group, YSYSF group and positive drug group by using randomized numerical table method. In the model group, YSYSF group and positive drug group, polyvinyl alcohol acrylamide interpenetrating network hydrogel(water-absorbent swelling material) was used to construct a rat spinal cord chronic compression model. The sham group was implanted with the water-absorbent swelling material and then removed without causing spinal cord compression. The control group, the sham group and the model group were given equal amounts of saline by gavage, the group of YSYSF was given Chinese herbal medicine soup by gavage 9.1 g·kg^-1 once a day, and the positive drug group was given tetrahexylsalicylglucoside sodium monosialate ganglioside by intraperitoneal injection 4.2 mg·kg^-1 once a day. The motor function of the rats was assessed by the BBB method after 1, 3, 7, and 14 d of drug administration. The spinal cord tissues were taken from rats executed 14 d after drug administration, and the morphological changes of the spinal cord compression site were observed by HE staining, and the expression levels of Caspase-1, GSDMD, NLRP3, PYCARD, IL-1β, and IL-18 were detected in the area of spinal cord injury by Western blot method. RESULTS: The BBB scores of the control group and the sham group were normal at all time points after modeling, which were higher than the BBB scores of the model group, the YSYSF, and the positive drug group (P<0.05). From the 3rd day after gavage, at all time points, the BBB scores of rats in the YSYSF group and the positive drug group were higher than those of rats in the model group (P<0.05). The staining pattern of HE spinal cord tissue was normal in the control group and the sham group, and the HE spinal cord in the model group was severely damaged with a large number of neuron deaths, whereas the damage to the spinal cord and neuron cells was reduced in the YSYSF group and the positive drug group. The expression levels of caspase-1, GSDMD, NLRP3, PYCARD, IL-1β and IL-18 in the spinal cord of the model group were significantly higher than those of the sham group (P<0.0001), and the expression levels of caspase-1, GSDMD, NLRP3, PYCARD, IL-1β, and IL-18 in the YSYSF group and the drug group were significantly lower than those in the model group (P<0.05). CONCLUSION YSYSF can improve the motor function of rats with degenerative cervical spinal cord disease, alleviate the pathological changes, and promote the recovery of spinal cord neurological function. The specific mechanism may be related to the inhibition of the activation of inflammatory vesicles NLRP3 and PYCARD, the reduction of the release of inflammatory factors IL-1β and IL-18, the reduction of the expression of caspase-1 and GSDMD, the reduction of cellular death, and the inhibition of inflammatory response.
Animals ; Female ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Rats, Sprague-Dawley ; Pyroptosis/drug effects* ; Spinal Cord/pathology* ; NLR Family, Pyrin Domain-Containing 3 Protein ; Spinal Cord Diseases/drug therapy* ; Interleukin-1beta/metabolism*

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test