To investigate whether Tasquinimod can influence cisplatin resistance in drug-resistant ovarian cancer (OC) cell lines by regulating histone deacetylase 4 (HDAC4) or p21, we explored its effects on the cell cycle, and associated mechanisms.RT-PCR and Western blot analyses, flow cytometry, CCK8 assay, and immunofluorescence were utilized to investigate the effects of Tasquinimod on gene expression, cell cycle, apoptosis, viability, and protein levels in OC cells. The results showed that Tasquinimod inhibited cell viability and promoted apoptosis in SKOV3/DDP (cisplatin) and A2780/DDP cells more effectively than DDP alone. In combination with cisplatin, Tasquinimod further enhanced cell apoptosis and reduced cell viability in these cell lines, an effect that could be reversed following HDAC4 overexpression. Tasquinimod treatment down-regulated HDAC4, Bcl-2, and cyclin D1, and CDK4 expression and up-regulated the cleaved-Caspase-3, and p21 expression in SKOV3/DDP and A2780/ DDP cells. Additionally, Tasquinimod inhibited DDP resistance in OC/DDP cells. These effects were similarly observed in OC mouse models treated with Tasquinimod. In conclusion, Tasquinimod can improve OC cells' sensitivity to DDP by down-regulating the HDAC4/p21 axis, offering insights into potential strategies for overcoming cisplatin resistance in OC.

To investigate whether Tasquinimod can influence cisplatin resistance in drug-resistant ovarian cancer (OC) cell lines by regulating histone deacetylase 4 (HDAC4) or p21, we explored its effects on the cell cycle, and associated mechanisms.RT-PCR and Western blot analyses, flow cytometry, CCK8 assay, and immunofluorescence were utilized to investigate the effects of Tasquinimod on gene expression, cell cycle, apoptosis, viability, and protein levels in OC cells. The results showed that Tasquinimod inhibited cell viability and promoted apoptosis in SKOV3/DDP (cisplatin) and A2780/DDP cells more effectively than DDP alone. In combination with cisplatin, Tasquinimod further enhanced cell apoptosis and reduced cell viability in these cell lines, an effect that could be reversed following HDAC4 overexpression. Tasquinimod treatment down-regulated HDAC4, Bcl-2, and cyclin D1, and CDK4 expression and up-regulated the cleaved-Caspase-3, and p21 expression in SKOV3/DDP and A2780/ DDP cells. Additionally, Tasquinimod inhibited DDP resistance in OC/DDP cells. These effects were similarly observed in OC mouse models treated with Tasquinimod. In conclusion, Tasquinimod can improve OC cells' sensitivity to DDP by down-regulating the HDAC4/p21 axis, offering insights into potential strategies for overcoming cisplatin resistance in OC.

To investigate whether Tasquinimod can influence cisplatin resistance in drug-resistant ovarian cancer (OC) cell lines by regulating histone deacetylase 4 (HDAC4) or p21, we explored its effects on the cell cycle, and associated mechanisms.RT-PCR and Western blot analyses, flow cytometry, CCK8 assay, and immunofluorescence were utilized to investigate the effects of Tasquinimod on gene expression, cell cycle, apoptosis, viability, and protein levels in OC cells. The results showed that Tasquinimod inhibited cell viability and promoted apoptosis in SKOV3/DDP (cisplatin) and A2780/DDP cells more effectively than DDP alone. In combination with cisplatin, Tasquinimod further enhanced cell apoptosis and reduced cell viability in these cell lines, an effect that could be reversed following HDAC4 overexpression. Tasquinimod treatment down-regulated HDAC4, Bcl-2, and cyclin D1, and CDK4 expression and up-regulated the cleaved-Caspase-3, and p21 expression in SKOV3/DDP and A2780/ DDP cells. Additionally, Tasquinimod inhibited DDP resistance in OC/DDP cells. These effects were similarly observed in OC mouse models treated with Tasquinimod. In conclusion, Tasquinimod can improve OC cells' sensitivity to DDP by down-regulating the HDAC4/p21 axis, offering insights into potential strategies for overcoming cisplatin resistance in OC.

To investigate whether Tasquinimod can influence cisplatin resistance in drug-resistant ovarian cancer (OC) cell lines by regulating histone deacetylase 4 (HDAC4) or p21, we explored its effects on the cell cycle, and associated mechanisms.RT-PCR and Western blot analyses, flow cytometry, CCK8 assay, and immunofluorescence were utilized to investigate the effects of Tasquinimod on gene expression, cell cycle, apoptosis, viability, and protein levels in OC cells. The results showed that Tasquinimod inhibited cell viability and promoted apoptosis in SKOV3/DDP (cisplatin) and A2780/DDP cells more effectively than DDP alone. In combination with cisplatin, Tasquinimod further enhanced cell apoptosis and reduced cell viability in these cell lines, an effect that could be reversed following HDAC4 overexpression. Tasquinimod treatment down-regulated HDAC4, Bcl-2, and cyclin D1, and CDK4 expression and up-regulated the cleaved-Caspase-3, and p21 expression in SKOV3/DDP and A2780/ DDP cells. Additionally, Tasquinimod inhibited DDP resistance in OC/DDP cells. These effects were similarly observed in OC mouse models treated with Tasquinimod. In conclusion, Tasquinimod can improve OC cells' sensitivity to DDP by down-regulating the HDAC4/p21 axis, offering insights into potential strategies for overcoming cisplatin resistance in OC.

To investigate whether Tasquinimod can influence cisplatin resistance in drug-resistant ovarian cancer (OC) cell lines by regulating histone deacetylase 4 (HDAC4) or p21, we explored its effects on the cell cycle, and associated mechanisms.RT-PCR and Western blot analyses, flow cytometry, CCK8 assay, and immunofluorescence were utilized to investigate the effects of Tasquinimod on gene expression, cell cycle, apoptosis, viability, and protein levels in OC cells. The results showed that Tasquinimod inhibited cell viability and promoted apoptosis in SKOV3/DDP (cisplatin) and A2780/DDP cells more effectively than DDP alone. In combination with cisplatin, Tasquinimod further enhanced cell apoptosis and reduced cell viability in these cell lines, an effect that could be reversed following HDAC4 overexpression. Tasquinimod treatment down-regulated HDAC4, Bcl-2, and cyclin D1, and CDK4 expression and up-regulated the cleaved-Caspase-3, and p21 expression in SKOV3/DDP and A2780/ DDP cells. Additionally, Tasquinimod inhibited DDP resistance in OC/DDP cells. These effects were similarly observed in OC mouse models treated with Tasquinimod. In conclusion, Tasquinimod can improve OC cells' sensitivity to DDP by down-regulating the HDAC4/p21 axis, offering insights into potential strategies for overcoming cisplatin resistance in OC.

A high performance liquid chromatography-tandem mass spectrometry(HPLC-MS/MS) method was established for simultaneous determination of seven characteristic components from the active fraction of Alpiniae Officinarum Rhizoma in rat plasma, including galangin, kaempferol, kaempferide, pinocembrin, 1,7-diphenyl-4-en-3-heptanone, 5-hydroxy-7-(4-hydroxy-3-methoxyphenyl)-1-phenyl-3-heptanone(DHPA), and 7-(4-hydroxy-3-methoxyphenyl)-1-phenyl-4-en-3-heptanone(DPHB). The new developed HPLC-MS/MS method was applied to study the pharmacokinetics of the 7 characteristic components in rats with Helicobacter pylori gastritis. A Waters Sunfire C_(18) column(2.1 mm×150 mm, 3.5 μm) was used. The acetonitrile-aqueous solution(containing 0.1% formic acid) was adopted as the mobile phase for gradient elution. Seven components and internal standard(chlorogenic acid) were separated within 12 min. Mass spectrometric detection was performed in multiple reaction monitoring(MRM) mode using electrospray ionization(ESI) source with fast switching between positive and negative ions. The method was verified by specificity, linearity, precision, accuracy, recovery, matrix effect, and stability and met the requirements of pharmacokinetic study on the 7 components in rat plasma. Pharmacokinetic results showed that the average peak time(T_(max)) of the 7 components was 0.31-2.19 h, their elimination half-life(t_(1/2)) was 5.26-16.65 h, and the average residence time(MRT) was 6.29-31.03 h after the oral administration of the active fraction of Alpiniae Officinarum Rhizoma to rats with H. pylori gastritis. The plasma exposure levels of galangin and DHPA were higher than those of the other components. The concentration-time curves of four detected flavonoids showed obvious double peaks. This study elucidated the pharmacokinetic characteristics of 7 characteristic components from the active fraction of Alpiniae Officinarum Rhizoma in rats with H. pylori gastritis, providing a scientific basis for the identification of the pharmacodynamic substances of Alpiniae Officinarum Rhizoma for treatment of H. pylori gastritis and the clinical application of Alpiniae Officinarum Rhizoma in the prevention and treatment of H. pylori gastritis.
Animals ; Rats ; Chromatography, High Pressure Liquid/methods* ; Tandem Mass Spectrometry/methods* ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Helicobacter pylori/drug effects* ; Alpinia/chemistry* ; Rats, Sprague-Dawley ; Gastritis/metabolism* ; Helicobacter Infections/metabolism* ; Flavonoids/blood* ; Rhizome/chemistry* ; Liquid Chromatography-Mass Spectrometry

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

Dry eye disease (DED) is a prevalent and intractable ocular disease induced by a variety of causes. Elevated sphingomyelin (SM) levels and pro-inflammatory cytokines were detected on the ocular surface of DED patients, particularly in the meibomian glands. Sphingomyelin synthase 2 (SMS2), one of the proteins involved in SM synthesis, would light a novel way of developing a DED therapy strategy. Herein, we report the design and optimization of a series of novel thiophene carboxamide derivatives to afford 14l with an improved highly potent inhibitory activity on SM synthesis (IC_{50, SMS2} = 28 nmol/L). Moreover, 14l exhibited a notable protective effect of anti-inflammation and anti-apoptosis on human corneal epithelial cells (HCEC) under TNF-α-hyperosmotic stress conditions in vitro, with an acceptable ocular specific distribution (corneas and meibomian glands) and pharmacokinetics (PK) profiles (t _{1/2, cornea} = 1.11 h; t _{1/2, meibomian glands} = 4.32 h) in rats. Furthermore, 14l alleviated the dry eye symptoms including corneal fluorescein staining scores and tear secretion in a dose-dependent manner in mice. Mechanically, 14l reduced the mRNA expression of Tnf-α, Il-1β and Mmp-9 in corneas, as well as the proportion of very long chain SM in meibomian glands. Our findings provide a new strategy for DED therapy based on selective SMS2 inhibitors.