1.Differences in chemical components and quality analysis of Gardenia jasminoides before and after processing with ginger
Lihua TANG ; Yu WU ; Xuedi HUANG ; Xiaolian HU ; Yi TANG ; Zilong CHEN ; Xiaofan XIAO ; Xide YE
China Pharmacy 2026;37(2):168-173
OBJECTIVE To analyze the differences in chemical components of Gardenia jasminoides before and after processing with ginger, and to evaluate the quality differences among different producing areas. METHODS Ultra-high performance liquid chromatography-tandem time-of-flight mass spectrometry was used to analyze the compositional differences of G. jasminoides before and after processing with ginger. The water content, total ash, and ethanol-soluble extract content of ginger- processed G. jasminoides were determined according to the 2020 edition of Chinese Pharmacopoeia. High performance liquid chromatography was adopted to determine the contents of genipin gentiobioside, geniposide, crocin Ⅰ and crocin Ⅱ in ginger- processed G. jasminoides. RESULTS A total of 49 chemical components were identified from raw G. jasminoides and ginger- processed G. jasminoides, including 14 flavonoids, 15 iridoids, 10 organic acids, 2 alkaloids and 8 other compounds. Among them, 42 components were detected in raw G. jasminoides, 28 in ginger-processed G. jasminoides, and 21 components were common to both. After processing with ginger, raw G. jasminoides lost 21 components (including iridoids, flavonoids, alkaloids, and others), while 7 chemical components were added (including coumarins, organic acids, organic acid esters, and flavonoids). For the 15 batches of ginger-processed G. jasminoides, the water content ranged from 5.64% to 7.11%, total ash from 2.92% to 4.87%, and ethanol-soluble extract from 40.61% to 58.02%. The average contents of genipin gentiobioside, geniposide, crocin Ⅰ and crocin Ⅱ were 0.108 7, 0.542 2, 0.565 0, and 0.012 5 mg/g, respectively. CONCLUSIONS After processing with ginger, G. jasminoides loses 21 components, while 7 new components are added. Differences are observed in the water content, total ash, ethanol-soluble extract, and the contents of genipin gentiobioside, geniposide, crocin Ⅰ, and crocin Ⅱ of ginger-processed G. jasminoides from different producing areas. Notably, samples from Fujian exhibit high contents of genipin gentiobioside and ethanol-soluble extract, while samples from Jiangxi have a high content of crocin Ⅰ.
2.Impact of birth weight on the trajectory of blood pressure among primary school students
CUI Chengpeng, YE Siyan, FANG Yanfei, LI Yan, PENG Zeqin, XIAO Yuqing, WU Meng, LIU Qin
Chinese Journal of School Health 2026;47(3):309-313
Objective:
To explore the early effects of birth weight at different gestational ages on blood pressure trajectory among primary school students, so as to provide evidence for incorporating gestational age birth weight into individualized early warning and intervention strategies for childhood hypertension.
Methods:
From May to November 2023, a purposeful sampling method was used to recruit 1 676 students in grade 1-3 from three primary schools in a certain urban district of Chongqing. Follow up assessments were conducted in May 2024(T1), November 2024(T2), and May 2025(T3). General demographic and birth related information were collected via self administered questionnaires, while height, weight and blood pressure were obtained through physical examinations. Linear mixed effects model was used to analyze the associations between birth weight at different gestational ages and blood pressure trajectories.
Results:
During the T1-T3 period, the systolic blood pressure of boys were 98.5 (93.0, 104.5 ),98.5 (93.5, 105.0), and 97.5 (92.5, 103.5)mmHg, respectively, while the diastolic blood pressure were 60.5 (56.5, 65.0), 61.5 ( 57.0 , 65.5), and 60.0 (56.0, 64.0)mmHg, respectively. For girls, the systolic blood pressure were 95.5 (90.0, 102.0),95.5 (90.5, 101.5), and 96.0 (90.5, 101.5)mmHg, respectively, and the diastolic blood pressure were 60.5 (56.0, 64.5 ),61.5 (57.5, 65.5), and 59.5 (56.0, 63.0)mmHg, respectively. Through Friedman test within both boys and girls, diostolic blood pressure were statistically significant across three measurements( χ 2=48.85,81.54,both P <0.01). The proportion of normal blood pressure increased , and the proportion of prehypertension and hypertension decreased with time( χ 2=39.72,25.62,both P < 0.01 ). Linear mixed effects model analysis revealed that after adjusting for age, sex, household income monthly, parental education, family history of hypertension and maternal pregnancy complications, large for gestational age had significantly higher trajectories of systolic ( β = 1.50) and diastolic( β =0.94) blood pressure compared to appropriate for gestational age(both P <0.01).
Conclusion
Large for gestational age is associated with elevated blood pressure trajectories during school age, and it may be considered as an early indicator for individualized screening and intervention for childhood hypertension.
3.Construction and Application of a Real-World Cohort of Community-Acquired Pneumonia Based on a Multimodal Large-Scale Traditional Chinese Medicine Big Data Platform
Zhichao WANG ; Xianmei ZHOU ; Fanchao FENG ; Mengqi WANG ; Xin WANG ; Bin KANG ; Xiaofan YU ; Xiaoxiao WANG ; Lei XIAO ; Juan LI ; Zhichao ZHANG ; Ye MA ; Yeqing JI ; Xin TONG ; Zhuoyue WU ; Jia LIU
Journal of Traditional Chinese Medicine 2026;67(9):961-965
This paper introduces a real-world cohort research model for community-acquired pneumonia (CAP) based on the Jiangsu Traditional Chinese Medicine (TCM) Dominant Diseases Diagnosis and Treatment Data Platform. Firstly, data cleaning is performed by standardizing diagnosis, symptoms, treatment and imaging, intelligently extracting unstructured information, and cleaning and constructing a standardized database. Secondly, for cohort establishment, CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly, in terms of protocol design, the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria, estimate sample size, define interventions, outcomes and economic evaluations, providing a reference for real-world TCM research on CAP.
4.Construction and Application of a Real-World Cohort of Community-Acquired Pneumonia Based on a Multimodal Large-Scale Traditional Chinese Medicine Big Data Platform
Zhichao WANG ; Xianmei ZHOU ; Fanchao FENG ; Mengqi WANG ; Xin WANG ; Bin KANG ; Xiaofan YU ; Xiaoxiao WANG ; Lei XIAO ; Juan LI ; Zhichao ZHANG ; Ye MA ; Yeqing JI ; Xin TONG ; Zhuoyue WU ; Jia LIU
Journal of Traditional Chinese Medicine 2026;67(9):961-965
This paper introduces a real-world cohort research model for community-acquired pneumonia (CAP) based on the Jiangsu Traditional Chinese Medicine (TCM) Dominant Diseases Diagnosis and Treatment Data Platform. Firstly, data cleaning is performed by standardizing diagnosis, symptoms, treatment and imaging, intelligently extracting unstructured information, and cleaning and constructing a standardized database. Secondly, for cohort establishment, CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly, in terms of protocol design, the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria, estimate sample size, define interventions, outcomes and economic evaluations, providing a reference for real-world TCM research on CAP.
5.Pharmacokinetics of 7 characteristic components from active fraction of Alpiniae Officinarum Rhizoma in rats with Helicobacter pylori gastritis based on HPLC-MS/MS.
Hao-Ran MA ; Jian-Ting ZHAN ; Xin LUO ; Wu-Yin-Xiao ZHENG ; Xiao-Chuan YE ; Dan LIU
China Journal of Chinese Materia Medica 2025;50(7):1949-1958
A high performance liquid chromatography-tandem mass spectrometry(HPLC-MS/MS) method was established for simultaneous determination of seven characteristic components from the active fraction of Alpiniae Officinarum Rhizoma in rat plasma, including galangin, kaempferol, kaempferide, pinocembrin, 1,7-diphenyl-4-en-3-heptanone, 5-hydroxy-7-(4-hydroxy-3-methoxyphenyl)-1-phenyl-3-heptanone(DHPA), and 7-(4-hydroxy-3-methoxyphenyl)-1-phenyl-4-en-3-heptanone(DPHB). The new developed HPLC-MS/MS method was applied to study the pharmacokinetics of the 7 characteristic components in rats with Helicobacter pylori gastritis. A Waters Sunfire C_(18) column(2.1 mm×150 mm, 3.5 μm) was used. The acetonitrile-aqueous solution(containing 0.1% formic acid) was adopted as the mobile phase for gradient elution. Seven components and internal standard(chlorogenic acid) were separated within 12 min. Mass spectrometric detection was performed in multiple reaction monitoring(MRM) mode using electrospray ionization(ESI) source with fast switching between positive and negative ions. The method was verified by specificity, linearity, precision, accuracy, recovery, matrix effect, and stability and met the requirements of pharmacokinetic study on the 7 components in rat plasma. Pharmacokinetic results showed that the average peak time(T_(max)) of the 7 components was 0.31-2.19 h, their elimination half-life(t_(1/2)) was 5.26-16.65 h, and the average residence time(MRT) was 6.29-31.03 h after the oral administration of the active fraction of Alpiniae Officinarum Rhizoma to rats with H. pylori gastritis. The plasma exposure levels of galangin and DHPA were higher than those of the other components. The concentration-time curves of four detected flavonoids showed obvious double peaks. This study elucidated the pharmacokinetic characteristics of 7 characteristic components from the active fraction of Alpiniae Officinarum Rhizoma in rats with H. pylori gastritis, providing a scientific basis for the identification of the pharmacodynamic substances of Alpiniae Officinarum Rhizoma for treatment of H. pylori gastritis and the clinical application of Alpiniae Officinarum Rhizoma in the prevention and treatment of H. pylori gastritis.
Animals
;
Rats
;
Chromatography, High Pressure Liquid/methods*
;
Tandem Mass Spectrometry/methods*
;
Drugs, Chinese Herbal/administration & dosage*
;
Male
;
Helicobacter pylori/drug effects*
;
Alpinia/chemistry*
;
Rats, Sprague-Dawley
;
Gastritis/metabolism*
;
Helicobacter Infections/metabolism*
;
Flavonoids/blood*
;
Rhizome/chemistry*
;
Liquid Chromatography-Mass Spectrometry
6.Interpretation of Annual Report on Cardiovascular Health and Diseases in China 2024.
Ming Bo LIU ; Xin Ye HE ; Xiao Hong YANG ; Zeng Wu WANG
Biomedical and Environmental Sciences 2025;38(8):893-917
Cardiovascular diseases (CVD) and their risk factors are exerting an increasingly significant impact on public health, and the incidence rate of CVD continues to rise. This article provides an interpretation of essentials from the newly published Annual Report on Cardiovascular Health and Diseases in China (2024), aiming to offer scientific evidence for CVD prevention, treatment, and the formulation of relevant policies.
China/epidemiology*
;
Cardiovascular Diseases/prevention & control*
;
Humans
;
Risk Factors
;
Incidence
7.Pathogenicity and Transcriptomic Profiling Revealed Activation of Apoptosis and Pyroptosis in Brain of Mice Infected with the Beta Variant of SARS-CoV-2.
Han LI ; Bao Ying HUANG ; Gao Qian ZHANG ; Fei YE ; Li ZHAO ; Wei Bang HUO ; Zhong Xian ZHANG ; Wen WANG ; Wen Ling WANG ; Xiao Ling SHEN ; Chang Cheng WU ; Wen Jie TAN
Biomedical and Environmental Sciences 2025;38(9):1082-1094
OBJECTIVE:
Patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection frequently develop central nervous system damage, yet the mechanisms driving this pathology remain unclear. This study investigated the primary pathways and key factors underlying brain tissue damage induced by the SARS-CoV-2 beta variant (lineage B.1.351).
METHODS:
K18-hACE2 and C57BL/6 mice were intranasally infected with the SARS-CoV-2 beta variant. Viral replication, pathological phenotypes, and brain transcriptomes were analyzed. Gene Ontology (GO) analysis was performed to identify altered pathways. Expression changes of host genes were verified using reverse transcription-quantitative polymerase chain reaction and Western blot.
RESULTS:
Pathological alterations were observed in the lungs of both mouse strains. However, only K18-hACE2 mice exhibited elevated viral RNA loads and infectious titers in the brain at 3 days post-infection, accompanied by neuropathological injury and weight loss. GO analysis of infected K18-hACE2 brain tissue revealed significant dysregulation of genes associated with innate immunity and antiviral defense responses, including type I interferons, pro-inflammatory cytokines, Toll-like receptor signaling components, and interferon-stimulated genes. Neuroinflammation was evident, alongside activation of apoptotic and pyroptotic pathways. Furthermore, altered neural cell marker expression suggested viral-induced neuroglial activation, resulting in caspase 4 and lipocalin 2 release and disruption of neuronal molecular networks.
CONCLUSION
These findings elucidate mechanisms of neuropathogenicity associated with the SARS-CoV-2 beta variant and highlight therapeutic targets to mitigate COVID-19-related neurological dysfunction.
Animals
;
COVID-19/genetics*
;
Mice
;
Brain/metabolism*
;
Apoptosis
;
Mice, Inbred C57BL
;
SARS-CoV-2/physiology*
;
Pyroptosis
;
Gene Expression Profiling
;
Transcriptome
;
Male
;
Female
8.Association of higher serum follicle-stimulating hormone levels with successful microdissection testicular sperm extraction outcomes in nonobstructive azoospermic men with reduced testicular volumes.
Ming-Zhe SONG ; Li-Jun YE ; Wei-Qiang XIAO ; Wen-Si HUANG ; Wu-Biao WEN ; Shun DAI ; Li-Yun LAI ; Yue-Qin PENG ; Tong-Hua WU ; Qing SUN ; Yong ZENG ; Jing CAI
Asian Journal of Andrology 2025;27(3):440-446
To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans
;
Male
;
Azoospermia/surgery*
;
Sperm Retrieval/statistics & numerical data*
;
Adult
;
Follicle Stimulating Hormone/blood*
;
Retrospective Studies
;
Testis/pathology*
;
Microdissection
;
Organ Size
9.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
10.Diagnosis of coronary artery lesions in children based on Z-score regression model.
Yong WANG ; Jia-Ying JIANG ; Yan DENG ; Bo LI ; Ping SHUAI ; Xiao-Ping HU ; Yin-Yan ZHANG ; Han WU ; Lu-Wei YE ; Qian PENG
Chinese Journal of Contemporary Pediatrics 2025;27(2):176-183
OBJECTIVES:
To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula.
METHODS:
A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated.
RESULTS:
The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas.
CONCLUSIONS
The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans
;
Male
;
Female
;
Child, Preschool
;
Child
;
Coronary Artery Disease/diagnostic imaging*
;
Infant
;
Mucocutaneous Lymph Node Syndrome
;
Regression Analysis
;
Coronary Vessels/diagnostic imaging*
;
Echocardiography
;
Adolescent


Result Analysis
Print
Save
E-mail