ObjectiveBased on the clinical characteristics of chronic gouty arthritis （CGA） in both traditional Chinese and western medicine， this study aims to systematically evaluate the clinical concordance of existing CGA animal models， providing recommendations for establishing animal models that align with the pathological characteristics of CGA and the manifestations of traditional Chinese medicine syndromes. MethodsBy comprehensively retrieving Chinese and international databases such as China National Knowledge Infrastructure， Wanfang， VIP Chinese Science and Technology Periodical Database （VIP）， and PubMed， all relevant literature on CGA animal models was collected. Based on the guidelines， the diagnostic criteria of both traditional Chinese and western medicine were summarized and organized. The evaluation indicators for the CGA model were constructed with reference to existing evaluation modes， and the CGA animal models were analyzed to systematically evaluate the clinical concordance of existing models. ResultsThe current methods used to construct CGA animal models mainly include monosodium urate crystal induction， high-protein diet induction （poultry lack urate oxidase）， and high-fat diet combined with urate oxidase inhibitors and joint injection. Based on 11 pieces of included literature， the traditional Chinese and western medicine scoring data of each model were extracted， and the average scoring values of all models were ultimately calculated. The results show that the average clinical concordances of existing CGA animal models in both traditional Chinese and western medicine are 43.33% and 64.44%， respectively. Among them， the model with the highest clinical concordance rate is the one with a high-fat diet combined with potassium oxonate to induce hyperuricemia plus joint injection， achieving 83.33% clinical concordance in western medicine and 60% in traditional Chinese medicine. This model aligns well with the pathogenic characteristics and pathological changes of clinical CGA. ConclusionAlthough current CGA animal models can simulate some pathological characteristics of CGA， they struggle to comprehensively reflect the complex pathological processes of CGA and the characteristics of traditional Chinese medicine syndromes. Therefore， in the future， it is necessary to establish the CGA animal models that incorporate the clinical disease and syndrome characteristics of traditional Chinese and western medicine and formulate the uniform model evaluation criteria， providing more precise tools for CGA mechanism research and the development of traditional Chinese medicine.

The chemical constituents of the petroleum ether extract derived from the 90% ethanol extract of Elephantopus scaber were investigated. By silica gel column chromatography, C_(18), MCI column chromatography and semi-preparative high performance liquid chromatography, ten compounds were isolated. Their structures were identified as 3β-hydroxy-6β,7β-epoxytaraxeran-14-ene(1), 3β-hydroxyolean-12-en-28-oic acid(2), D-friedoolean-14-ene-3β,7α-diol(3), 3β-hydroxy-11α-methoxyolean-12-ene(4), 3β-hydroxyolean-11,13(18)-diene(5), 11α-hydroxy-β-amyrin(6), betulinic acid(7), 3β-hydroxy-30-norlupan-20-one(8), 6-acetonylchelerythrine(9), and 4',5'-dehydrodiodictyonema A(10) by analysis of the 1D NMR, 2D NMR, MS, and IR spectral data. Among them, compound 1 was a new triterpene and other compounds except compounds 2 and 7 were isolated from this plant for the first time.
Triterpenes/isolation & purification* ; Drugs, Chinese Herbal/isolation & purification* ; Molecular Structure ; Asteraceae/chemistry* ; Chromatography, High Pressure Liquid ; Magnetic Resonance Spectroscopy

Biomedical data is surging due to technological innovations and integration of multidisciplinary data, posing challenges to data management. This article summarizes the policies, data collection efforts, platform construction, and applications of biomedical data in China, aiming to identify key issues and needs, enhance the capacity-building of platform construction, unleash the value of data, and leverage the advantages of China's vast amount of data.
China ; Humans ; Biomedical Research ; Data Management ; Data Collection

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe₃O₄ loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4⁺/CD8⁺ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.

Periodontal bone defects, primarily caused by periodontitis, are highly prevalent in clinical settings and manifest as bone fenestration, dehiscence, or attachment loss, presenting a significant challenge to oral health. In regenerative medicine, harnessing developmental principles for tissue repair offers promising therapeutic potential. Of particular interest is the condensation of progenitor cells, an essential event in organogenesis that has inspired clinically effective cell aggregation approaches in dental regeneration. However, the precise cellular coordination mechanisms during condensation and regeneration remain elusive. Here, taking the tooth as a model organ, we employed single-cell RNA sequencing to dissect the cellular composition and heterogeneity of human dental follicle and dental papilla, revealing a distinct Platelet-derived growth factor receptor alpha (PDGFRA) mesenchymal stem/stromal cell (MSC) population with remarkable odontogenic potential. Interestingly, a reciprocal paracrine interaction between PDGFRA⁺ dental follicle stem cells (DFSCs) and CD31⁺ Endomucin⁺ endothelial cells (ECs) was mediated by Vascular endothelial growth factor A (VEGFA) and Platelet-derived growth factor subunit BB (PDGFBB). This crosstalk not only maintains the functionality of PDGFRA⁺ DFSCs but also drives specialized angiogenesis. In vivo periodontal bone regeneration experiments further reveal that communication between PDGFRA⁺ DFSC aggregates and recipient ECs is essential for effective angiogenic-osteogenic coupling and rapid tissue repair. Collectively, our results unravel the importance of MSC-EC crosstalk mediated by the VEGFA and PDGFBB-PDGFRA reciprocal signaling in orchestrating angiogenesis and osteogenesis. These findings not only establish a framework for deciphering and promoting periodontal bone regeneration in potential clinical applications but also offer insights for future therapeutic strategies in dental or broader regenerative medicine.
Receptor, Platelet-Derived Growth Factor alpha/metabolism* ; Humans ; Neovascularization, Physiologic/physiology* ; Dental Sac/cytology* ; Single-Cell Analysis ; Transcriptome ; Mesenchymal Stem Cells/metabolism* ; Bone Regeneration ; Animals ; Dental Papilla/cytology* ; Periodontium/physiology* ; Stem Cells/metabolism* ; Regeneration ; Angiogenesis

Ursodeoxycholic acid (UDCA) is a naturally occurring, low-toxicity, and hydrophilic bile acid (BA) in the human body that is converted by intestinal flora using primary BA. Solute carrier family 7 member 11 (SLC7A11) functions to uptake extracellular cystine in exchange for glutamate, and is highly expressed in a variety of human cancers. Retroperitoneal liposarcoma (RLPS) refers to liposarcoma originating from the retroperitoneal area. Lipidomics analysis revealed that UDCA was one of the most significantly downregulated metabolites in sera of RLPS patients compared with healthy subjects. The augmentation of UDCA concentration (≥25 μg/mL) demonstrated a suppressive effect on the proliferation of liposarcoma cells. [¹⁵N₂]-cystine and [¹³C₅]-glutamine isotope tracing revealed that UDCA impairs cystine uptake and glutathione (GSH) synthesis. Mechanistically, UDCA binds to the cystine transporter SLC7A11 to inhibit cystine uptake and impair GSH de novo synthesis, leading to reactive oxygen species (ROS) accumulation and mitochondrial oxidative damage. Furthermore, UDCA can promote the anti-cancer effects of ferroptosis inducers (Erastin, RSL3), the murine double minute 2 (MDM2) inhibitors (Nutlin 3a, RG7112), cyclin dependent kinase 4 (CDK4) inhibitor (Abemaciclib), and glutaminase inhibitor (CB839). Together, UDCA functions as a cystine exchange factor that binds to SLC7A11 for antitumor activity, and SLC7A11 is not only a new transporter for BA but also a clinically applicable target for UDCA. More importantly, in combination with other antitumor chemotherapy or physiotherapy treatments, UDCA may provide effective and promising treatment strategies for RLPS or other types of tumors in a ROS-dependent manner.