1.Correlation between differences in starch gelatinization, water distribution, and terpenoid content during steaming process of Curcuma kwangsiensis root tubers by multivariate statistical analysis.
Yan LIANG ; Meng-Na YANG ; Xiao-Li QIN ; Zhi-Yong ZHANG ; Zhong-Nan SU ; Hou-Kang CAO ; Ke-Feng ZHANG ; Ming-Wei WANG ; Bo LI ; Shuo LI
China Journal of Chinese Materia Medica 2025;50(10):2684-2694
To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry*
;
Starch/chemistry*
;
Multivariate Analysis
;
Water/chemistry*
;
Terpenes/analysis*
;
Plant Roots/chemistry*
;
Plant Tubers/chemistry*
;
Drugs, Chinese Herbal/chemistry*
2.Analysis of risk factors, pathogenic bacteria characteristics, and drug resistance of postoperative surgical site infection in adults with limb fractures.
Yan-Jun WANG ; Zi-Hou ZHAO ; Shuai-Kun LU ; Guo-Liang WANG ; Shan-Jin MA ; Lin-Hu WANG ; Hao GAO ; Jun REN ; Zhong-Wei AN ; Cong-Xiao FU ; Yong ZHANG ; Wen LUO ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(4):241-251
PURPOSE:
We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery.
METHODS:
A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics.
RESULTS:
Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%.
CONCLUSION
Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans
;
Surgical Wound Infection/epidemiology*
;
Male
;
Female
;
Risk Factors
;
Retrospective Studies
;
Middle Aged
;
Adult
;
Case-Control Studies
;
Fractures, Bone/surgery*
;
Aged
;
Drug Resistance, Bacterial
;
Logistic Models
;
Anti-Bacterial Agents/therapeutic use*
;
Incidence
;
Bacteria/drug effects*
3.Association of redundant foreskin with sexual dysfunction: a cross-sectional study from 5700 participants.
Yuan-Qi ZHAO ; Nian LI ; Xiao-Hua JIANG ; Yang-Yang WAN ; Bo XU ; Xue-Chun HU ; Yi-Fu HOU ; Ji-Yan LI ; Shun BAI
Asian Journal of Andrology 2025;27(1):90-95
A previous study showed that the length of the foreskin plays a role in the risk of sexually transmitted infections and chronic prostatitis, which can lead to poor quality of sexual life. Here, the association between foreskin length and sexual dysfunction was evaluated. A total of 5700 participants were recruited from the andrology clinic at The First Affiliated Hospital of University of Science and Technology of China (Hefei, China). Clinical characteristics, including foreskin length, were collected, and sexual function was assessed by the International Index of Erectile Function-5 (IIEF-5) and Premature Ejaculation Diagnostic Tool (PEDT) questionnaires. Men with sexual dysfunction were more likely to have redundant foreskin than men without sexual dysfunction. Among the 2721 erectile dysfunction (ED) patients and 1064 premature ejaculation (PE) patients, 301 (11.1%) ED patients and 135 (12.7%) PE patients had redundant foreskin, respectively. Men in the PE group were more likely to have redundant foreskin than men in the non-PE group ( P = 0.004). Logistic regression analyses revealed that the presence of redundant foreskin was associated with increased odds of moderate/severe ED (adjusted odds ratio [aOR] = 1.31, adjusted P = 0.04), moderate PE (aOR = 1.38, adjusted P = 0.02), and probable PE (aOR = 1.37, adjusted P = 0.03) after adjusting for confounding variables. Our study revealed a positive correlation between the presence of redundant foreskin and the risk of sexual dysfunction, especially in PE patients. Assessment of the length of the foreskin during routine clinical diagnosis may provide information for patients with sexual dysfunction.
Humans
;
Male
;
Foreskin
;
Cross-Sectional Studies
;
Adult
;
Erectile Dysfunction/epidemiology*
;
Premature Ejaculation/epidemiology*
;
Middle Aged
;
China/epidemiology*
;
Surveys and Questionnaires
;
Sexual Dysfunction, Physiological/epidemiology*
;
Young Adult
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Traditional Chinese Exercise Improves Lung Function and Exercise Capacity in Patients with Preserved Ratio Impaired Spirometry.
Yan-Yi LIU ; Gai-Hua HOU ; Kun XIA ; Xiao-Yan YAO ; Yi WANG ; Guang-Xi LI
Chinese journal of integrative medicine 2025;31(12):1113-1118
OBJECTIVE:
To investigate the effect of traditional Chinese Five-body balance exercise on patients with preserved ratio impaired spirometry (PRISm).
METHODS:
Fifteen patients with PRISm and 15 patients diagnosed with chronic obstructive pulmonary disease (COPD) were recruited from the Outpatient Department of Guang'anmen Hospital and Beijing Niujie Health Service Center from April to December, 2023. Participants in both groups attended supervised Five-body balance exercise training twice a week for 12 weeks. Patients with COPD continued their regular medication regimen during the intervention period. The endpoints were mean changes in the 6-min walk test (6MWT), St. George's Respiratory Questionnaire (SGRQ) score, cardiopulmonary exercise testing (CPET), pulmonary function, and scores of COPD assessment test (CAT), modified British Medical Research Council, Self-Rating Anxiety Scale, and Self-Rating Depression Scale from baseline to 12 weeks. Adverse events were monitored throughout the study.
RESULTS:
The PRISm group showed a significant improvement from baseline to week 12 in 6MWT, SGRQ symptom score, and forced vital capacity (FVC) compared to the COPD group (P<0.05). No significant between-group changes were observed in other outcome measurements (P>0.05). In addition, compared with baseline, both groups exhibited improvements in 6MWT, SGRQ score, and CPET at week 12 (P<0.05). The PRISm group also showed a significant increase in forced expiratory volume in 1 s and FVC, as well as a significant decrease in CAT score at week 12 (P<0.05). No adverse events were reported.
CONCLUSION
Patients with PRISm may benefit from Five-body balance exercise training, which can improve the exercise capacity, health-related quality of life, and lung function. (Registration No. ChiCTR2200059290).
Humans
;
Spirometry
;
Male
;
Female
;
Pulmonary Disease, Chronic Obstructive/therapy*
;
Lung/physiopathology*
;
Middle Aged
;
Exercise Tolerance/physiology*
;
Exercise Therapy
;
Aged
;
Medicine, Chinese Traditional
;
Respiratory Function Tests
;
East Asian People
6.International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025).
Sheng-Sheng ZHANG ; Lu-Qing ZHAO ; Xiao-Hua HOU ; Zhao-Xiang BIAN ; Jian-Hua ZHENG ; Hai-He TIAN ; Guan-Hu YANG ; Won-Sook HONG ; Yu-Ying HE ; Li LIU ; Hong SHEN ; Yan-Ping LI ; Sheng XIE ; Jin SHU ; Bin-Fang ZENG ; Jun-Xiang LI ; Zhen LIU ; Zheng-Hua XIAO ; Jing-Dong XIAO ; Pei-Yong ZHENG ; Shao-Gang HUANG ; Sheng-Liang CHEN ; Gui-Jun FEI
Journal of Integrative Medicine 2025;23(5):502-518
Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy*
;
Humans
;
Medicine, Chinese Traditional/methods*
;
Practice Guidelines as Topic
;
Drugs, Chinese Herbal/therapeutic use*
8.(Meta)transcriptomic Insights into the Role of Ticks in Poxvirus Evolution and Transmission: A Multicontinental Analysis.
Yu Xi WANG ; Jing Jing HU ; Jing Jing HOU ; Xiao Jie YUAN ; Wei Jie CHEN ; Yan Jiao LI ; Qi le GAO ; Yue PAN ; Shui Ping LU ; Qi CHEN ; Si Ru HU ; Zhong Jun SHAO ; Cheng Long XIONG
Biomedical and Environmental Sciences 2025;38(9):1058-1070
OBJECTIVE:
Poxviruses are zoonotic pathogens that infect humans, mammals, vertebrates, and arthropods. However, the specific role of ticks in transmission and evolution of these viruses remains unclear.
METHODS:
Transcriptomic and metatranscriptomic raw data from 329 sampling pools of seven tick species across five continents were mined to assess the diversity and abundance of poxviruses. Chordopoxviral sequences were assembled and subjected to phylogenetic analysis to trace the origins of the unblasted fragments within these sequences.
RESULTS:
Fifty-eight poxvirus species, representing two subfamilies and 20 genera, were identified, with 212 poxviral sequences assembled. A substantial proportion of AT-rich fragments were detected in the assembled poxviral genomes. These genomic sequences contained fragments originating from rodents, archaea, and arthropods.
CONCLUSION
Our findings indicate that ticks play a significant role in the transmission and evolution of poxviruses. These viruses demonstrate the capacity to modulate virulence and adaptability through horizontal gene transfer, gene recombination, and gene mutations, thereby promoting co-existence and co-evolution with their hosts. This study advances understanding of the ecological dynamics of poxvirus transmission and evolution and highlights the potential role of ticks as vectors and vessels in these processes.
Animals
;
Poxviridae/physiology*
;
Ticks/virology*
;
Phylogeny
;
Transcriptome
;
Evolution, Molecular
;
Poxviridae Infections/virology*
;
Genome, Viral
9.NFKBIE: Novel Biomarkers for Diagnosis, Prognosis, and Immunity in Colorectal Cancer: Insights from Pan-cancer Analysis.
Chen Yang HOU ; Peng WANG ; Feng Xu YAN ; Yan Yan BO ; Zhen Peng ZHU ; Xi Ran WANG ; Shan LIU ; Dan Dan XU ; Jia Jia XIAO ; Jun XUE ; Fei GUO ; Qing Xue MENG ; Ren Sen RAN ; Wei Zheng LIANG
Biomedical and Environmental Sciences 2025;38(10):1320-1325
10.Influence of Modified Shashen Maidong Decoction Combined with Camrelizumab Immunotherapy Plus Chemotherapy on the Efficacy,Survival Status,and Serum CYFRA21-1 and NSE Levels in Patients with Advanced Non-Small Cell Lung Cancer
Hai-Feng WANG ; Yi-Qun ZHAO ; Xiao-Li DU ; Lu LIU ; Bao-Song HOU ; Wen-Yan ZHAN
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(3):606-611
Objective To investigate the influence of modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy on the efficacy,survival status and serum cytokeratin 19 fragment(CYFRA21-1)and neuron-specific enolase(NSE)levels in patients with advanced non-small cell lung cancer(NSCLC).Methods Forty patients with advanced NSCLC of lung-stomach yin deficiency with intense heat-toxin type were randomly divided into a control group and a study group,with 20 patients in each group.The patients in the control group were given Camrelizumab immunotherapy plus chemotherapy,and the patients in the study group were given modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy,with 21 days as a course of treatment and for a total of 4 courses of treatment.The changes of serum NSE and CYFRA21-1 levels in the two groups before and after treatment were observed,and the clinical efficacy,survival status and the incidence of toxic and side effects were compared between the two groups.Results(1)After 4 courses of treatment,the total effective rate of the study group was 70.00%(14/20),which was significantly higher than that of the control group(9/20,45.00%),but the intergroup comparison(tested by chi-square test)showed that the difference was not statistically significant(P>0.05).(2)After 2 years of follow-up,the overall survival(OS),time to progression(TTP),and progression-free survival(PFS)of the patients in the study group were significantly prolonged compared with those in the control group(P<0.01).(3)After treatment,the serum NSE and CYFRA21-1 levels of the patients in the two groups were decreased compared with those before treatment(P<0.05),and the decrease of serum NSE and CYFRA21-1 levels in the study group was significantly superior to that in the control group(P<0.01).(4)The incidence of toxic and side effects in the study group was 25.00%(5/20),which was significantly lower than that of 65.00%(13/20)in the control group,and the intergroup comparison showed that the difference was statistically significant(P<0.05).Conclusion Modified Shashen Maidong Decoction combined with Camrelizumab immunotherapy plus chemotherapy has satisfactory therapeutic effect on patients with advanced NSCLC,which can reduce the toxic and side effects of chemotherapy,lower the level of serum tumor markers,and prolong the survival period and time to progression(TTP)of the patients.

Result Analysis
Print
Save
E-mail