ObjectiveHepatocellular carcinoma (HCC) represents 90% of all primary liver cancers. The main risk factors associated with HCC include viral hepatitis (B and/or C), alcohol abuse, and metabolic dysfunction-associated steatotic liver disease (MASLD), which progressively advance to liver fibrosis, cirrhosis, and ultimately evolve into HCC. Surgical resection represents the most effective treatment for HCC, while recent advances in immunotherapy, including immune checkpoint inhibitors and adoptive cell therapies, have provided improved treatment prospects for patients with unresectable HCC. However, the complex metabolic heterogeneity of HCC limits the therapeutic efficacy. Metabolic intermediates acyl-CoA not only provide energy and substrates for numerous biochemical reactions but also serve as donors for protein lysine acylation, a major class of post-translational modification (PTM). Therefore, a deeper understanding of the molecular mechanisms underlying protein lysine acylation and hepatocarcinogenesis is urgently needed. MethodsThe levels of protein lysine acylation and silence information regulator 5 (SIRT5) expression levels in clinical HCC samples were analyzed by Western blot. Quantitative malonylome and succinylome of HCC samples were analyzed by antibody-based affinity enrichment coupled with tandem mass spectrometry. The proliferation of HCC cells was analyzed with Cell Counting Kit-8 (CCK-8) assays, the apoptosis was quantified by Annexin V-FITC/propidium iodide (PI) staining coupled with flow cytometry, and the ability of cells to migrate was assayed by Transwell assays. The enzymatic activity of glutathione S-transferase Mu 1 (GSTM1) was quantified. Transgenic mice with hepatic overexpression of SIRT5 were constructed using CRISPR-Cas9, and primary hepatocarcinogenesis was induced by administration of diethylnitrosamine. ResultsWestern blot analysis indicated that the expression level of SIRT5 was elevated in clinical samples from HCC patients, and the levels of lysine malonylation, glutarylation, and succinylation were significantly reduced in HCC tissues. Knockout of SIRT5 in MHCC-97H and MHCC-97L hepatoma cells suppressed cell proliferation, and increased the percentage of apoptotic cells significantly. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the differentially malonylome and succinylome of HCC samples revealed significant enrichment in two major classes of biological processes: core energy metabolism (e.g., glycolysis/gluconeogenesis, tricarboxylic acid metabolic process, fatty acid beta oxidation) and detoxification and oxidative stress response (e.g., response to toxic substance, chemical carcinogenesis, reactive oxygen species (ROS)). SIRT5 removes malonylation from lysine residues in GSTM1 and restores its detoxification activity, which is crucial for the survival of hepatocytes under stressed conditions. More importantly, in vivo experiment indicated that hepatic-specific overexpression of SIRT5 in mice accelerated diethylnitrosamine-induced liver fibrosis and hepatocarcinogenesis, indicating the critical role of SIRT5 in HCC progression. ConclusionThis study highlights the previously unrecognized SIRT5-GSTM1 axis as a key regulator in hepatocarcinogenesis, and suggests a potential target for the treatment of patients with HCC.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

ObjectiveThe frequency difference limen (FDL) serves as a fundamental metric utilized for effectively quantifying the precise perceptual capabilities of the central auditory system. However, traditional measurement methods rely heavily on the active behavioral responses of subjects and are consequently highly susceptible to the negative influence of confounding subjective factors. Furthermore, existing research paradigms frequently employ uniform stimulus configurations that overlook critical individual perceptual differences. Based on brain-computer interface (BCI) technology, this comprehensive study aims to establish an objective and quantitative evaluation method for auditory frequency discrimination by systematically analyzing and decoding the specific neural responses elicited at the exact threshold state. MethodsWe designed a personalized rapid serial auditory presentation (RSAP) paradigm customized based on each individual’s precise FDL. A cohort of eleven healthy participants was recruited to evaluate the paradigm using pure-tone sequences at a baseline frequency of 4 000 Hz. This experimental paradigm simulates a realistic auditory perception environment through the continuous presentation of acoustic stimuli, thereby allowing for an in-depth investigation into the specific neural representations evoked by weak frequency deviations at the threshold state. Given that auditory stimulus-evoked response features exhibit complex and differentiated spatiotemporal distribution patterns across multiple frequency domains, this study further deeply integrates the cross-scale feature interaction module with the dynamic spatiotemporal attention allocation strategy, innovatively proposing the Multi-Scale Spatial-Temporal Dual Attention Network (MS-STAMNet). Specifically, the network constructs parallel processing branches with multiple receptive fields and introduces a dynamic adaptive weighting strategy to precisely localize core neural activity signals, further deeply integrating multi-scale information through cross-branch feature information interaction to achieve robust single-trial decoding of weak auditory evoked responses. ResultsThe comprehensive electrophysiological data analysis demonstrated that subtle auditory frequency deviation stimuli presented at the threshold level successfully elicited pronounced N2 and P3 event-related potential features, reflecting pre-attentive mismatch detection and subsequent cognitive evaluation, which were prominently distributed over the frontal, central, and temporal regions of the scalp. In the complex time-frequency domain, the extracted neural response characteristics exhibited distinct, statistically significant event-related synchronization within both the low-frequency δ and θ frequency bands, which was simultaneously accompanied by a widespread, prominent event-related desynchronization within the higher α band. A comparative analysis of model performance demonstrated that MS-STAMNet achieved an average unweighted average recall (UAR) of (69.67±6.12)% and area under the curve (AUC) of 0.761 8±0.07, significantly outperforming the established baseline models such as EEGNet and PLNet. Furthermore, a distinct dissociation phenomenon was verified between neural decoding and behavioral performance through regression analysis (R²=0.016, P=0.709), indicating that this model can effectively capture the implicit features of subtle frequency deviations, even when they fail to trigger explicit conscious responses. Additionally, attention weight visualization analysis further reveals the highly accurate focus of the network on key features concentrated over the bilateral temporal and fronto-parietal regions. ConclusionThis study systematically and comprehensively uncovers the multi-dimensional spatiotemporal evolutionary patterns of complex neural responses processing subtle acoustic variations under long-sequence threshold auditory stimulation. Concurrently, it verifies the efficacy and robustness of the proposed MS-STAMNet architecture in accurately deciphering weak, single-trial electroencephalogram signals amidst complex background noise. Ultimately, these neurophysiological and algorithmic findings lay a solid theoretical and methodological foundation for the objective and quantitative evaluation of individual auditory cognitive capabilities in clinical applications, transcending the fundamental limitations of traditional behavioral paradigms and providing robust technical support for future auditory research and related clinical assessments.

BACKGROUND:In recent years,numerous studies have shown that autophagy and mitophagy play an important role in the regulation of bone metabolism.Under non-physiological conditions,mitophagy breaks the balance of bone metabolism and triggers metabolism disorders,which affect osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells,etc. OBJECTIVE:To summarize the mechanism of mitophagy in regulating bone metabolic diseases and its application in clinical treatment. METHODS:PubMed,Web of Science,CNKI,WanFang and VIP databases were searched by computer using the keywords of"mitophagy,bone metabolism,osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells"in English and Chinese.The search time was from 2008 to 2023.According to the inclusion criteria,90 articles were finally included for review and analysis. RESULTS AND CONCLUSION:Mitophagy promotes the generation of osteoblasts through SIRT1,PINK1/Parkin,FOXO3 and PI3K signaling pathways,while inhibiting osteoclast function through PINK1/Parkin and SIRT1 signaling pathways.Mitophagy leads to bone loss by increasing calcium phosphate particles and tissue protein kinase K in bone tissue.Mitophagy improves the function of chondrocytes through PINK1/Parkin,PI3K/AKT/mTOR and AMPK signaling pathways.Modulation of mitophagy shows great potential in the treatment of bone diseases,but there are still some issues to be further explored,such as different stages of drug-activated mitophagy,and the regulatory mechanisms of different signaling pathways.

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

A 10-year-old girl was admitted with a 38-hour history of widespread subcutaneous petechiae and hematuria and a 6-hour history of jaundice and oliguria. Physical examination revealed widespread subcutaneous petechiae and jaundice of the skin and sclera. Laboratory tests showed anemia, thrombocytopenia, acute kidney injury, and markedly elevated lactate dehydrogenase. Thrombotic microangiopathy was initially diagnosed, with a high suspicion of atypical hemolytic uremic syndrome (aHUS). Eculizumab was initiated within 9 hours of admission (within 48 hours of onset). After the first infusion, hemolysis rapidly ceased, and the platelet count and renal function gradually returned to normal. Whole-exome sequencing identified homozygous deletions of CFHR1 exon 2 and CFHR4 exon 1. aHUS typically has abrupt onset and rapid progression. Clinicians should maintain high suspicion for aHUS when the triad of thrombocytopenia, microangiopathic hemolytic anemia, and acute kidney injury is present. Ultra-early eculizumab (within 48 hours of onset) rapidly blocks complement-mediated thrombotic microangiopathy, reverses organ injury, and improves long-term prognosis. Additionally, complement-related genetic testing is important for etiological clarification and individualized determination of eculizumab treatment duration.
Humans ; Antibodies, Monoclonal, Humanized/administration & dosage* ; Female ; Atypical Hemolytic Uremic Syndrome/drug therapy* ; Child ; Complement C3b Inactivator Proteins

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

Dry eye disease (DED) is a prevalent and intractable ocular disease induced by a variety of causes. Elevated sphingomyelin (SM) levels and pro-inflammatory cytokines were detected on the ocular surface of DED patients, particularly in the meibomian glands. Sphingomyelin synthase 2 (SMS2), one of the proteins involved in SM synthesis, would light a novel way of developing a DED therapy strategy. Herein, we report the design and optimization of a series of novel thiophene carboxamide derivatives to afford 14l with an improved highly potent inhibitory activity on SM synthesis (IC_{50, SMS2} = 28 nmol/L). Moreover, 14l exhibited a notable protective effect of anti-inflammation and anti-apoptosis on human corneal epithelial cells (HCEC) under TNF-α-hyperosmotic stress conditions in vitro, with an acceptable ocular specific distribution (corneas and meibomian glands) and pharmacokinetics (PK) profiles (t _{1/2, cornea} = 1.11 h; t _{1/2, meibomian glands} = 4.32 h) in rats. Furthermore, 14l alleviated the dry eye symptoms including corneal fluorescein staining scores and tear secretion in a dose-dependent manner in mice. Mechanically, 14l reduced the mRNA expression of Tnf-α, Il-1β and Mmp-9 in corneas, as well as the proportion of very long chain SM in meibomian glands. Our findings provide a new strategy for DED therapy based on selective SMS2 inhibitors.