ObjectiveTo investigate the mechanism by which Wumeiwan suppresses the development and progression of colorectal cancer（CRC） through the regulation of fatty acid metabolic reprogramming， thereby providing new experimental evidence for the prevention and treatment of CRC. MethodsA total of 120 C57BL/6 mice were randomly divided into the blank group， model group， Wumeiwan high-， medium-， and low-dose groups（54， 27， 13.5 g·kg^-1）， and the mesalazine group（0.01 g·kg^-1）， with 20 mice in each group. Except for the blank group， all mice were subjected to azoxymethane（AOM）/dextran sulfate sodium（DSS） treatment to establish an inflammation-associated CRC model. One week after AOM injection， mice in the treatment groups received intragastric administration of the designated drugs， while the blank and model groups received an equal volume of purified water， continuing until 20 d after the intervention endpoint. Hematoxylin-eosin（HE） staining was used to observe colonic histopathological alterations， and immunohistochemistry for vascular endothelial growth factor（VEGF） was performed to evaluate neovascularization and tumor invasion. Metabolomics combined with Kyoto Encyclopedia of Genes and Genomes（KEGG） and metabolite set enrichment analysis（MSEA） was applied to identify key CRC-related metabolic pathways， which were further validated by transcriptomic Gene Ontology（GO） enrichment and gene heatmap analysis. Subsequently， Western blot was performed to determine the expression levels of core proteins in these pathways， and immunofluorescence was used to analyze their localization and co-expression patterns in tissues， thereby elucidating the mechanism of Wumeiwan from multiple biological dimensions. ResultsCompared with the blank group， mice in the model group exhibited a significant decrease in body weight and a significant increase in the disease activity index（DAI） score（P<0.05）， with pronounced colonic mucosal damage accompanied by aggravated tumor invasion. Compared with the model group， Wumeiwan intervention markedly improved body weight loss and reduced DAI score， attenuated mucosal injury， and significantly decreased VEGF expression level（P<0.05）. Multi-omics analysis revealed that differential metabolites and genes across groups were commonly enriched in fatty acid metabolism， fatty acid biosynthesis， and other lipid-related pathways. Relative to the blank group， the model group showed significant upregulation levels of fatty acid synthesis-related genes， including sterol regulatory element-binding protein 1（SREBP1）， fatty acid synthase（FASN）， stearoyl-CoA desaturase 1（SCD1）， as well as saturated fatty acids（P<0.05）. Compared with the model group， treatment with Wumeiwan significantly reduced the expression of key genes involved in fatty acid metabolic pathways， including SREBP1， FASN， and SCD1（P<0.05）. Western blot results further confirmed that proteins in this pathway were significantly elevated in the model group， whereas they were markedly downregulated following Wumeiwan treatment（P<0.05）. Immunofluorescence analysis demonstrated enhanced co-localization of SREBP1 with the cancer-associated fibroblast（CAF） marker α-smooth muscle actin（SMA） in the model group， whereas this co-localization signal was attenuated after Wumeiwan intervention（P<0.05）. ConclusionWumeiwan can improve survival outcomes and alleviate colonic pathological damage in CRC mice， its therapeutic mechanism may be closely associated with the regulation of fatty acid metabolic reprogramming mediated by the SREBP1/FASN/SCD1 signaling pathway.

Objective To explore the construction of heart preservation model of empty beating donor based on extracorporeal membrane oxygenation (ECMO). Methods From January 2022 to August 2023, 20 Guangxi Bama miniature pigs weighing 25-30 kg were selected, half male and half female. Under general anesthesia and heparinization, a midline thoracotomy was performed. The pericardium was cut after freeing the anterior and posterior vena cavae, and a perfusion needle was inserted near the brachiocephalic artery in the ascending aorta, connected to a blood collection bag to collect 500-600 mL of blood. The anterior and posterior vena cavae were ligated, the aorta was blocked and perfused with HTK solution to stop the heart beating. The superior and inferior vena cavae were cut off, the right pulmonary vein was decompressed, the aorta and left and right pulmonary arteries and veins were cut off, and the whole heart was removed. An ECMO device was used to continuously perfuse a cardioprotective solution mainly composed of oxygenated warm blood, maintaining the isolated pig heart beating for 8 hours, monitoring (once/hour) ECMO perfusion parameters, blood gas indicators, perfusate electrolytes, inflammatory factors, myocardial enzymes, myoglobin, and troponin levels. Myocardial tissue was taken for hematoxylin-eosin (HE) staining to observe myocardial cell damage and evaluate the quality of heart preservation. Results Among the 20 isolated beating pig hearts, 17 successfully resumed beating, 3 experienced ventricular fibrillation, resuscitated after intracardiac electrical defibrillation, and all 20 pig hearts successfully beat for 8 hours. There was no statistical difference in ECMO perfusion parameters, blood gas indicators, perfusate electrolytes, and inflammatory factors at each time point (P>0.05). There were statistical increases in myocardial enzymes, myoglobin, and troponin levels (P<0.05). HE staining results suggested that there was no severe myocardial damage. Conclusion ECMO technology can be used for pig heart preservation with good results, and this study provides experimental evidence for improving heart preservation research in clinical heart transplantation.

ObjectiveTo establish a model that can quickly identify the aroma components in different parts of Nardostachys jatamansi， so as to provide a quality control basis for the market circulation and clinical use of N. jatamansi. MethodsHeadspace solid-phase microextraction-gas chromatography-mass spectrometry（HS-SPME-GC-MS） combined with Smart aroma database and National Institute of Standards and Technology（NIST） database were used to characterize the aroma components in different parts of N. jatamansi， and the aroma components were quantified according to relative response factor（RRF） and three internal standards， and the markers of aroma differences in different parts of N. jatamansi were identified by orthogonal partial least squares-discriminant analysis（OPLS-DA） and cluster thermal analysis based on variable importance in the projection（VIP） value >1 and P<0.01. The odor data of different parts of N. jatamansi were collected by Heracles Ⅱ Neo ultra-fast gas phase electronic nose， and the correlation between compound types of aroma components collected by the ultra-fast gas phase electronic nose and the detection results of HS-SPME-GC-MS was investigated by drawing odor fingerprints and odor response radargrams. Chromatographic peak information with distinguishing ability≥0.700 and peak area≥200 was selected as sensor data， and the rapid identification model of different parts of N. jatamansi was established by principal component analysis（PCA）， discriminant factor alysis（DFA）， soft independent modeling of class analogies（SIMCA） and statistical quality control analysis（SQCA）. ResultsThe HS-SPME-GC-MS results showed that there were 28 common components in the underground and aboveground parts of N. jatamansi， of which 22 could be quantified and 12 significantly different components were screened out. Among these 12 components， the contents of five components（ethyl isovalerate， 2-pentylfuran， benzyl alcohol， nonanal and glacial acetic acid，） in the aboveground part of N. jatamansi were significantly higher than those in the underground part（P<0.01）， the contents of β-ionone， patchouli alcohol， α-caryophyllene， linalyl butyrate， valencene， 1，8-cineole and p-cymene in the underground part of N. jatamansi were significantly higher than those in the aboveground part（P<0.01）. Heracles Ⅱ Neo electronic nose results showed that the PCA discrimination index of the underground and aboveground parts of N. jatamansi was 82， and the contribution rates of the principal component factors were 99.94% and 99.89% when 2 and 3 principal components were extracted， respectively. The contribution rate of the discriminant factor 1 of the DFA model constructed on the basis of PCA was 100%， the validation score of the SIMCA model for discrimination of the two parts was 99， and SQCA could clearly distinguish different parts of N. jatamansi. ConclusionHS-SPME-GC-MS can clarify the differential markers of underground and aboveground parts of N. jatamansi. The four analytical models provided by Heracles Ⅱ Neo electronic nose（PCA， DFA， SIMCA and SQCA） can realize the rapid identification of different parts of N. jatamansi. Combining the two results， it is speculated that terpenes and carboxylic acids may be the main factors contributing to the difference in aroma between the underground and aboveground parts of N. jatamansi.

Objective To explore the effects of home-based exercise rehabilitation on cardiac structure, valvular function, and exercise capacity in patients with severe aortic stenosis (AS) after transcatheter aortic valve replacement (TAVR). Methods 49 patients with severe AS who underwent TAVR at Zhongshan Hospital, Fudan University, from January 2024 to February 2025 were enrolled. They were divided into an exercise group (n＝25) or a non-exercise group (n＝24) based on participating or not in home-based rehabilitation after TAVR. The exercise group received 12 weeks of home-based exercise training (aerobic exercise plus resistance training every week); the non-exercise group received routine care. Transthoracic echocardiography (TTE) was used to assess cardiac structural parameters before discharge (T0) and after 12 weeks of exercise (T1). Functional outcomes including the 6-minute walk test (6MWT), Duke Activity Status Index (DASI), and Short Physical Performance Battery (SPPB) were compared between the two groups. A linear mixed-effects model was used to analyze the effect of home-based rehabilitation on echocardiographic parameters. Patients were stratified by baseline 6MWT (＜240 m as low-function subgroup, ≥240 m as high-function subgroup) to compare exercise-related outcomes between subgroups. Results At T1, the exercise group had a longer 6MWT distance than the non-exercise group (P＝0.012). The linear mixed-effects model showed that after 12 weeks of exercise, the left ventricular end-diastolic diameter (LVEDD) decreased in the exercise group but slightly increased in the non-exercise group, with a significant difference in changes over time between the two groups (P_interaction＝0.030). The exercise group also showed greater improvement in effective orifice area index (P_interaction＝0.028) and effective orifice area (P_interaction＝0.042) than the non-exercise group. Subgroup analysis revealed that in the low-function subgroup, the exercise group showed greater improvement in the 6MWT (P_interaction＝0.035) and the effective orifice area index (P_interaction＝0.046) compared to the non-exercise group; in the high-function subgroup, the exercise group showed greater improvement only in LVEDD compared to the non-exercise group (P_interaction＝0.046). Conclusions Home-based exercise rehabilitation improves exercise capacity, optimizes left ventricular remodeling, and enhances valvular function in patients with severe AS after TAVR, with greater benefits observed in patients with lower baseline 6MWT.

Osteosarcoma is the most common primary malignant bone tumor,typically treated with a combination of surgery and chemotherapy in clinical practice.However,the increasing prevalence of chemotherapy resistance poses a significant challenge.Chemotherapy resistance can lead to a sharp decline in patients'survival rates.Traditional Chinese medicine,known for its low cost,wide-ranging efficacy,and diverse varieties,has attracted significant attention from researchers.Their attempts to investigate the sensitizing effect of extracted ingredients on osteosarcoma chemoresistance both in vitro and in vivo have yielded promising results.This review has summarized the studies of single traditional Chinese medicine ingredients on reversing osteosarcoma chemoresistance by the mechanisms of chemoresistance,and found that the current research of the clinical mechanism of traditional Chinese medicine ingredients in reversing osteosarcoma chemoresistance is still lacking,indicating significant potential for future development.Utilizing the theory of herbal medicine properties as the theoretical basis for ingredient development may provide novel strategies for the development of new therapeutic approaches.

Objective:To investigate the efficacy and safety of transurethral incision for the treatment of ureterocele in infants.Methods:A retrospective analysis of 28 cases of ureterocele admitted from March 2012 to May 2023 were reviewed, all of which were less than 1 year old, 16 male and 12 female, with an average age of(5.7±3.5)months. The ureterocele was located on the left side in 8 cases, on the right side in 15 cases, and bilaterally in 5 cases. There were 12 cases of single system ureterocele, of which 7 cases were unilateral and 5 cases were bilateral. Duplex system ureterocele was observed in 16 cases, all of which were unilateral. Clinical manifestations: urinary tract infection in 13 cases, 11 cases of ureterocele or hydronephrosis and ureteral dilation were found during antenatal examination, and 4 cases of ureterocele were found after birth. Urological ultrasound, intravenous pyelography(IVP) and voiding cystourethrography(VCUG) were performed in all children, and 17 cases underwent magnetic resonance urolography (MRU), and confirm the diagnosis of ureterocele preoperatively. All of the cases were performed the transurethral incision.The ureterocele was punctured and incised 1-2 mm at the base of the bulge, and 2-4 points were punctured according to the bulge atrophy. Bilateral ureteroceles were punctured and incised simultaneously. Postoperative urine routine test, urinary tract color ultrasound and VCUG were performed to determine if there is urinary tract infection, hydronephrosis, ureteral dilation and bulging, and whether a second surgery is needed.Results:All operations were conducted successfully. The intraoperative bleeding was less than 3 ml and no intraoperative complications. The operative time was (28.4±10.3) min. The median postoperative follow-up was 34 (32, 36) months. Six cases underwent postoperative VCUG examination. Eleven children were recovered well with single systemic ureterocele. One child developed grade Ⅳ vesicoureteral reflux(VUR)and combined with bladder diverticulum, and ureterocele underwent open diverticulotomy and ureteral reimplantation six months after surgery. Nine children were recovered well with duplex systemic ureterocele. Six cases of children developed infection, of which 2 cases had an infection once within one month after TUI, and the other four cases still had intermittent infections after six months and VCUG was performed, and one case showed grade Ⅲ VUR of the lower ureter, which was observed conservatively, while the other three cases had enlarged cysts but no VUR, and upper heminephrectomy was performed, and the patients recovered well after surgery. Except for these 6 exceptions, in another case, after ten years of follow-up, the ureterocele became larger but no VUR, and the results were good after a second transurethral incision. There was no significant difference in the postoperative infections, new VUR cases, and secondary surgeries between the two groups.Conclusions:Transurethral incision has good surgical effect on children with single system ureterocele and duplex system ureterocele, and has advantages of easy operation, less trauma, safety and effectiveness, and few complications. It deserves to be recommended as the treatment of choice, especially for infants and young children.

Biomedical data is surging due to technological innovations and integration of multidisciplinary data, posing challenges to data management. This article summarizes the policies, data collection efforts, platform construction, and applications of biomedical data in China, aiming to identify key issues and needs, enhance the capacity-building of platform construction, unleash the value of data, and leverage the advantages of China's vast amount of data.
China ; Humans ; Biomedical Research ; Data Management ; Data Collection

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

The carbon ion proton therapy system,as one of the most advanced methods for treating solid tumors,has been unanimously recognized for its therapeutic effect.Its unique deep dose distribution and high relatively biological effects,which are outstanding advantages that conventional radiotherapy hardly matches,can provide important technical support for effectively increasing patients'5-year survival rate.Its industrial application and promotion are in line with the policy orientation of national scientific and technological innovation,and strategic emerging industries.This article established a preliminary framework for the standard system of operational services of carbon ion proton therapy system through analyzed the products'operation management,service requirements,and quality requirements in the field of operational services of carbon ion proton therapy system.It provided development direction for the formulation and revision of the standards in the field of operational services of carbon ion proton therapy system,and it contributed to promote products'popularization and industrial development.