1.Rapid Identification of Different Parts of Nardostachys jatamansi Based on HS-SPME-GC-MS and Ultra-fast Gas Phase Electronic Nose
Tao WANG ; Xiaoqin ZHAO ; Yang WEN ; Momeimei QU ; Min LI ; Jing WEI ; Xiaoming BAO ; Ying LI ; Yuan LIU ; Xiao LUO ; Wenbing LI
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(2):182-191
ObjectiveTo establish a model that can quickly identify the aroma components in different parts of Nardostachys jatamansi, so as to provide a quality control basis for the market circulation and clinical use of N. jatamansi. MethodsHeadspace solid-phase microextraction-gas chromatography-mass spectrometry(HS-SPME-GC-MS) combined with Smart aroma database and National Institute of Standards and Technology(NIST) database were used to characterize the aroma components in different parts of N. jatamansi, and the aroma components were quantified according to relative response factor(RRF) and three internal standards, and the markers of aroma differences in different parts of N. jatamansi were identified by orthogonal partial least squares-discriminant analysis(OPLS-DA) and cluster thermal analysis based on variable importance in the projection(VIP) value >1 and P<0.01. The odor data of different parts of N. jatamansi were collected by Heracles Ⅱ Neo ultra-fast gas phase electronic nose, and the correlation between compound types of aroma components collected by the ultra-fast gas phase electronic nose and the detection results of HS-SPME-GC-MS was investigated by drawing odor fingerprints and odor response radargrams. Chromatographic peak information with distinguishing ability≥0.700 and peak area≥200 was selected as sensor data, and the rapid identification model of different parts of N. jatamansi was established by principal component analysis(PCA), discriminant factor alysis(DFA), soft independent modeling of class analogies(SIMCA) and statistical quality control analysis(SQCA). ResultsThe HS-SPME-GC-MS results showed that there were 28 common components in the underground and aboveground parts of N. jatamansi, of which 22 could be quantified and 12 significantly different components were screened out. Among these 12 components, the contents of five components(ethyl isovalerate, 2-pentylfuran, benzyl alcohol, nonanal and glacial acetic acid,) in the aboveground part of N. jatamansi were significantly higher than those in the underground part(P<0.01), the contents of β-ionone, patchouli alcohol, α-caryophyllene, linalyl butyrate, valencene, 1,8-cineole and p-cymene in the underground part of N. jatamansi were significantly higher than those in the aboveground part(P<0.01). Heracles Ⅱ Neo electronic nose results showed that the PCA discrimination index of the underground and aboveground parts of N. jatamansi was 82, and the contribution rates of the principal component factors were 99.94% and 99.89% when 2 and 3 principal components were extracted, respectively. The contribution rate of the discriminant factor 1 of the DFA model constructed on the basis of PCA was 100%, the validation score of the SIMCA model for discrimination of the two parts was 99, and SQCA could clearly distinguish different parts of N. jatamansi. ConclusionHS-SPME-GC-MS can clarify the differential markers of underground and aboveground parts of N. jatamansi. The four analytical models provided by Heracles Ⅱ Neo electronic nose(PCA, DFA, SIMCA and SQCA) can realize the rapid identification of different parts of N. jatamansi. Combining the two results, it is speculated that terpenes and carboxylic acids may be the main factors contributing to the difference in aroma between the underground and aboveground parts of N. jatamansi.
2.Biomedical Data in China: Policy, Accumulation, Platform Construction, and Applications.
Jing-Chen ZHANG ; Jing-Wen SUN ; Xiao-Meng LIU ; Jin-Yan LIU ; Wei LUO ; Sheng-Fa ZHANG ; Wei ZHOU
Chinese Medical Sciences Journal 2025;40(1):9-17
Biomedical data is surging due to technological innovations and integration of multidisciplinary data, posing challenges to data management. This article summarizes the policies, data collection efforts, platform construction, and applications of biomedical data in China, aiming to identify key issues and needs, enhance the capacity-building of platform construction, unleash the value of data, and leverage the advantages of China's vast amount of data.
China
;
Humans
;
Biomedical Research
;
Data Management
;
Data Collection
3.Establishment of a Rat Model of Alzheimer's Disease by Introducing Human Triple Mutant APP Gene into Hippocampus via Brain Stereotactic Technology
Linlin XIAO ; Yixuan YANG ; Shanshan LI ; Lanshiyu LUO ; Siwei YIN ; Juming SUN ; Wei SHI ; Yiqiang OUYANG ; Xiyi LI
Laboratory Animal and Comparative Medicine 2025;45(3):269-278
Objective To establish a rat model of Alzheimer's disease (AD) expressing human triple mutant amyloid precursor protein (APP) in the hippocampus, and to provide a model for the study of disease mechanisms and drug development. Methods Twenty-four 12-week-old SPF-grade female SD rats were randomly divided into a blank control group, a virus control group and an experimental group, with eight rats in each group; among them, the experimental group received a stereotaxic injection of adeno-associated virus (AAV) carrying the human triple mutant APP and NanoLuc luciferase genes into the hippocampus. In vivo imaging was used to observe viral expression in the brains of rats in each group, the novel object recognition test was used to assess the recognition memory of the rats in each group, real-time fluorescent quantitative PCR was used to detect the expression level of the APP gene, HE staining was used to examine the brain histopathology, Nissl staining was used to assess the hippocampal lesions, and immunohistochemistry was used to detect the deposition of amyloid β-protein (Aβ). Results In vivo imaging showed that reporter fluorescence was detected in the brains of rats in both experimental and virus control groups. Fluorescence quantitative PCR showed that the expression level of the APP gene was significantly increased in the brains of rats in the experimental group (P<0.01). Novel object recognition test revealed that the recognition memory of rats in the experimental group was significantly reduced compared with that of the blank control group (P<0.01). Six months after recombinant AAV virus infection, HE staining and Nissl staining of brain tissues showed that the number of neurons and Nissl bodies in the CA1 region of the hippocampus in the experimental group was reduced and disorganized; immuno-histochemistry testing of the CA1 region of the hippocampus and the pyramidal cell layer of the experimental group revealed prominent brown deposits, indicating Aβ protein deposition. Conclusion The rat model successfully established by stereotaxic injection and AAV-mediated delivery of human triple mutant APP gene exhibits typical AD features, providing a valuable animal model for studying AD pathology and developing drug therapies targeting Aβ protein deposition.
4.Establishment of a Rat Model of Alzheimer's Disease by Introducing Human Triple Mutant APP Gene into Hippocampus via Brain Stereotactic Technology
Linlin XIAO ; Yixuan YANG ; Shanshan LI ; Lanshiyu LUO ; Siwei YIN ; Juming SUN ; Wei SHI ; Yiqiang OUYANG ; Xiyi LI
Laboratory Animal and Comparative Medicine 2025;45(3):269-278
Objective To establish a rat model of Alzheimer's disease (AD) expressing human triple mutant amyloid precursor protein (APP) in the hippocampus, and to provide a model for the study of disease mechanisms and drug development. Methods Twenty-four 12-week-old SPF-grade female SD rats were randomly divided into a blank control group, a virus control group and an experimental group, with eight rats in each group; among them, the experimental group received a stereotaxic injection of adeno-associated virus (AAV) carrying the human triple mutant APP and NanoLuc luciferase genes into the hippocampus. In vivo imaging was used to observe viral expression in the brains of rats in each group, the novel object recognition test was used to assess the recognition memory of the rats in each group, real-time fluorescent quantitative PCR was used to detect the expression level of the APP gene, HE staining was used to examine the brain histopathology, Nissl staining was used to assess the hippocampal lesions, and immunohistochemistry was used to detect the deposition of amyloid β-protein (Aβ). Results In vivo imaging showed that reporter fluorescence was detected in the brains of rats in both experimental and virus control groups. Fluorescence quantitative PCR showed that the expression level of the APP gene was significantly increased in the brains of rats in the experimental group (P<0.01). Novel object recognition test revealed that the recognition memory of rats in the experimental group was significantly reduced compared with that of the blank control group (P<0.01). Six months after recombinant AAV virus infection, HE staining and Nissl staining of brain tissues showed that the number of neurons and Nissl bodies in the CA1 region of the hippocampus in the experimental group was reduced and disorganized; immuno-histochemistry testing of the CA1 region of the hippocampus and the pyramidal cell layer of the experimental group revealed prominent brown deposits, indicating Aβ protein deposition. Conclusion The rat model successfully established by stereotaxic injection and AAV-mediated delivery of human triple mutant APP gene exhibits typical AD features, providing a valuable animal model for studying AD pathology and developing drug therapies targeting Aβ protein deposition.
5.Analysis of risk factors, pathogenic bacteria characteristics, and drug resistance of postoperative surgical site infection in adults with limb fractures.
Yan-Jun WANG ; Zi-Hou ZHAO ; Shuai-Kun LU ; Guo-Liang WANG ; Shan-Jin MA ; Lin-Hu WANG ; Hao GAO ; Jun REN ; Zhong-Wei AN ; Cong-Xiao FU ; Yong ZHANG ; Wen LUO ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(4):241-251
PURPOSE:
We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery.
METHODS:
A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics.
RESULTS:
Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%.
CONCLUSION
Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans
;
Surgical Wound Infection/epidemiology*
;
Male
;
Female
;
Risk Factors
;
Retrospective Studies
;
Middle Aged
;
Adult
;
Case-Control Studies
;
Fractures, Bone/surgery*
;
Aged
;
Drug Resistance, Bacterial
;
Logistic Models
;
Anti-Bacterial Agents/therapeutic use*
;
Incidence
;
Bacteria/drug effects*
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Laboratory Diagnosis and Molecular Epidemiological Characterization of the First Imported Case of Lassa Fever in China.
Yu Liang FENG ; Wei LI ; Ming Feng JIANG ; Hong Rong ZHONG ; Wei WU ; Lyu Bo TIAN ; Guo CHEN ; Zhen Hua CHEN ; Can LUO ; Rong Mei YUAN ; Xing Yu ZHOU ; Jian Dong LI ; Xiao Rong YANG ; Ming PAN
Biomedical and Environmental Sciences 2025;38(3):279-289
OBJECTIVE:
This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF.
METHODS:
Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus.
RESULTS:
LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response.
CONCLUSION
The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans
;
China/epidemiology*
;
Genome, Viral
;
Lassa Fever/virology*
;
Lassa virus/classification*
;
Molecular Epidemiology
;
Phylogeny
8.Exploration of New Susceptible Genes associated with Non-Alcoholic Fatty Liver Disease among Children with Obesity Using Whole Exome Sequencing.
Xiong Feng PAN ; Cai Lian WEI ; Jia You LUO ; Jun Xia YAN ; Xiang XIAO ; Jie WANG ; Yan ZHONG ; Mi Yang LUO
Biomedical and Environmental Sciences 2025;38(6):727-739
OBJECTIVE:
This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity.
METHODS:
We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set).
RESULTS:
In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes.
CONCLUSION
In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans
;
Non-alcoholic Fatty Liver Disease/genetics*
;
Child
;
Male
;
Female
;
Genetic Predisposition to Disease
;
Case-Control Studies
;
Exome Sequencing
;
Adolescent
;
Polymorphism, Single Nucleotide
;
Obesity/complications*
;
Pediatric Obesity/complications*
;
China
9.Effect of home-based exercise rehabilitation on cardiac structure and exercise capacity in patients with severe aortic stenosis after transcatheter aortic valve replacement
Zehan XIE ; Shouling MI ; Nianwei ZHOU ; Zhiyun SHEN ; Wei LI ; Xianhong SHU ; Limin LUO ; Xingguo ZHU ; Zhenglong XIAO ; Lei ZHUANG
Chinese Journal of Clinical Medicine 2025;32(5):827-834
Objective To explore the effects of home-based exercise rehabilitation on cardiac structure, valvular function, and exercise capacity in patients with severe aortic stenosis (AS) after transcatheter aortic valve replacement (TAVR). Methods 49 patients with severe AS who underwent TAVR at Zhongshan Hospital, Fudan University, from January 2024 to February 2025 were enrolled. They were divided into an exercise group (n=25) or a non-exercise group (n=24) based on participating or not in home-based rehabilitation after TAVR. The exercise group received 12 weeks of home-based exercise training (aerobic exercise plus resistance training every week); the non-exercise group received routine care. Transthoracic echocardiography (TTE) was used to assess cardiac structural parameters before discharge (T0) and after 12 weeks of exercise (T1). Functional outcomes including the 6-minute walk test (6MWT), Duke Activity Status Index (DASI), and Short Physical Performance Battery (SPPB) were compared between the two groups. A linear mixed-effects model was used to analyze the effect of home-based rehabilitation on echocardiographic parameters. Patients were stratified by baseline 6MWT (<240 m as low-function subgroup, ≥240 m as high-function subgroup) to compare exercise-related outcomes between subgroups. Results At T1, the exercise group had a longer 6MWT distance than the non-exercise group (P=0.012). The linear mixed-effects model showed that after 12 weeks of exercise, the left ventricular end-diastolic diameter (LVEDD) decreased in the exercise group but slightly increased in the non-exercise group, with a significant difference in changes over time between the two groups (Pinteraction=0.030). The exercise group also showed greater improvement in effective orifice area index (Pinteraction=0.028) and effective orifice area (Pinteraction=0.042) than the non-exercise group. Subgroup analysis revealed that in the low-function subgroup, the exercise group showed greater improvement in the 6MWT (Pinteraction=0.035) and the effective orifice area index (Pinteraction=0.046) compared to the non-exercise group; in the high-function subgroup, the exercise group showed greater improvement only in LVEDD compared to the non-exercise group (Pinteraction=0.046). Conclusions Home-based exercise rehabilitation improves exercise capacity, optimizes left ventricular remodeling, and enhances valvular function in patients with severe AS after TAVR, with greater benefits observed in patients with lower baseline 6MWT.
10.Analysis on the compositional differences of different processing products of Atractylodes lancea Rhizoma based on HS-GC-MS and UPLC-Q-Orbitrap HRMS
Li WANG ; Rong LUO ; Xuyang HAN ; Kaijing WANG ; Wei XIAO ; Dechun JIANG ; Songleng DUAN ; Peng ZHANG ; Yanxin ZHAI ; Jiankun WU
International Journal of Traditional Chinese Medicine 2025;47(6):833-842
Objective:To compare the differences in chemical compositions before and after processing by different processing methods; To optimize the processing method of Atractylodes lancea Rhizoma.Methods:Atractylodes lancea Rhizoma was processed by stir-frying with bran and treating with rice washing water. The volatile and non-volatile components of raw Atractylodes lancea Rhizoma, bran-fried Atractylodes lancea Rhizoma and rice washing water treated Atractylodes lancea Rhizome were qualitatively analyzed by headspace gas chromatography-mass spectrometry (HS-GC-MS) and ultra-performance liquid chromatography-quadrupole-electrostatic field orbitrap high-resolution mass spectrometry (UPLC-Q-Orbitrap HRMS), and the differences in chemical composition before and after processing were compared.Results:The volatile components of the three different products were determined to have 18 common components, such as agarospirol, β-eudesol, etc. In addition, 86 non-volatile components were determined. The peak area response value of atractylodin, the index component prescribed by pharmacopoeia, decreased after processing, but there was little difference in bran stir-frying and rice-washed water frying.Conclusions:Different processing methods have certain effects on the chemical composition of Atractylodes lancea Rhizoma. Among them, the bran-frying method is superior in improving the quality of preparations, reducing production costs and improving production efficiency. The bran-fried product can be used as raw material for preparation production.

Result Analysis
Print
Save
E-mail