The effect of Huanglian Jiedu Decoction on the intestinal flora of type 2 diabetes mellitus(T2DM) was investigated using 16S rRNA sequencing technology. Sixty rats were randomly divided into a normal group(10 rats) and a modeling group(50 rats). After one week of adaptive feeding, a high-fat diet + streptozotocin was given for modeling, and fasting blood glucose >16.7 mmol·L~(-1) was considered a sign of successful modeling. The modeling group was randomly divided into the model group, high-, medium-, and low-dose groups of Huanglian Jiedu Decoction, and metformin group. After seven days of intragastric treatment, the feces, colon, and pancreatic tissue of each group of rats were collected, and the pathological changes of the colon and pancreatic tissue of each group were observed by hematoxylin-eosin staining. The changes in the intestinal flora structure of each group were observed by the 16S rRNA sequencing method. The results showed that compared with the model group, the high-, medium-, and low-dose of Huanglian Jiedu Decoction reduced fasting blood glucose levels to different degrees and showed no significant changes in body weight. The number of islet cells increased, and intestinal mucosal damage attenuated. Alpha diversity analysis revealed that Huanglian Jiedu Decoction reduced the abundance and diversity of intestinal flora in rats with T2DM; at the phylum level, low-and mediam-dose of Huanglian Jiedu Decoction reduced the abundance of Bacteroidota, Proteobacteria, and Desulfobacterota and increased the abundance of Firmicute and Bacteroidota/Firmicutes, while the high-dose of Huanglian Jiedu Decoction increased the relative abundance of Proteobacteria and Bacteroidota/Firmicutes ratio, and decreaseal the relative; abundance of Firmicute; at the genus level, Huanglian Jiedu Decoction increased the relative abundance of Allobaculum, Blautia, and Lactobacillus; LEfse analysis revealed that the biomarker of low-and medium-dose groups of Huanglian Jiedu Decoction was Lactobacillus, and the structure of the intestinal flora of the low-dose group of Huanglian Jiedu Decoction was highly similar to that of the metformin group. PICRUSt2 function prediction revealed that Huanglian Jiedu Decoction mainly affected carbohydrate and amino acid metabolic pathways. It suggested that Huanglian Jiedu Decoction could reduce fasting blood glucose and increase the number of islet cells in rats with T2DM, and its mechanism of action may be related to increasing the abundance of short-chain fatty acid-producing strains and Lactobacillus and affecting carbohydrate and amino acid metabolic pathways.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Diabetes Mellitus, Type 2/metabolism* ; Gastrointestinal Microbiome/drug effects* ; Rats ; Male ; Rats, Sprague-Dawley ; Humans ; Bacteria/drug effects* ; Blood Glucose/metabolism*

This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals ; Osteoarthritis, Knee/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Male ; Humans ; Capsules ; Female ; Disease Models, Animal

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study aims to investigate the in vitro mechanisms underlying the beneficial effects of puerarin on hepatic insulin resistance(IR) based on the carbohydrate response element-binding protein(ChREBP)/peroxisome proliferator-activated receptor(PPAR)α/PPARγ axis involved in glucose and lipid metabolism. An IR-HepG2 cell model was established by treating cells with dexamethasone for 48 h, and the cells were then treated with 10, 20, and 40 μmol·L~(-1) puerarin for 24 h. Glucose levels and output in the extracellular fluid were measured by the glucose oxidase method, while cell viability was assessed by the cell counting kit-8(CCK-8) assay. The adenosine triphosphate(ATP) content and glycogen synthesis were evaluated through chemiluminescence and periodic acid-Schiff staining, respectively. Western blot was employed to quantify the protein levels of forkhead box protein O1(FoxO1), phosphorylated forkhead box protein O1 [p-FoxO1(Ser256)], glucagon, phosphofructokinase, liver type(PFKL), pyruvate kinase L-R(PKLR), pyruvate dehydrogenase complex 1(PDHA1), insulin receptor substrate 2(IRS2), phosphatidylinositol 3-kinase p85(PI3KR1), phosphorylated protein kinase B [p-Akt(Thr308)], glycogen synthase(GYS), glycogen phosphorylase, liver type(PYGL), adiponectin(ADPN), ChREBP, PPARα, and PPARγ. Additionally, the protein levels of acetyl-CoA carboxylase 1(ACC1), phosphorylated ATP citrate lyase [p-ACLY(Ser455)], sterol regulatory element binding protein 1c(SREBP-1c), peroxisome proliferator-activated receptor gamma coactivator 1α(PGC1α), carnitine palmitoyltransferase 1α(CPT1α), and glucagon receptor(GCGR) were also determined. Immunofluorescence was employed to visualize the expression and nuclear location of ChREBP/PPARα/PPARγ. Furthermore, quantitative PCR with the antagonists GW6471 and GW9662 was employed to assess Pparα, Pparγ, and Chrebp. The findings indicated that puerarin effectively reduced both the glucose level and glucose output in the extracellular fluid of IR-HepG2 cells without obvious effect on the cell viability, and it increased intracellular glycogen and ATP levels. Puerarin down-regulated the protein levels of FoxO1 and glucagon while up-regulating the protein levels of p-FoxO1(Ser256), PFKL, PKLR, PDHA1, IRS2, PI3KR1, p-Akt(Thr308), GYS, PYGL, ADPN, ACC1, SREBP-1c, p-ACLY(Ser455), PGC1α, CPT1α, and GCGR in IR-HepG2 cells. Furthermore, puerarin up-regulated both the mRNA and protein levels of ChREBP, PPARα, and PPARγ and promoted the translocation into the nucleus. GW6471 was observed to down-regulate the expression of Pparα while up-regulating the expression of Chrebp and Pparγ. GW9662 down-regulated the expression of Pparγ while up-regulating the expression of Pparα, with no significant effect on Chrebp. In summary, puerarin activated the hepatic ChREBP/PPARα/PPARγ axis, thereby coordinating the glucose and lipid metabolism, promoting the conversion of glucose to lipids to exert the blood glucose-lowering effect.
Isoflavones/pharmacology* ; Humans ; PPAR gamma/genetics* ; Hep G2 Cells ; Glucose/metabolism* ; Lipid Metabolism/drug effects* ; PPAR alpha/genetics* ; Liver/drug effects* ; Basic Helix-Loop-Helix Leucine Zipper Transcription Factors/genetics* ; Insulin Resistance

This paper aims to investigate the hypoglycemic effect and mechanism of berberine in improving energy metabolism based on the multi-pathway regulation of brain and muscle aromatic hydrocarbon receptor nuclear translocal protein 1(BMAL1): cyclin kaput complex of day-night spontaneous output cyclin kaput(CLOCK). The dexamethasone-induced hepatic insulin resistance(IR) HepG2 cell model was used; 0.5, 1, 5, 10, 20 μmol·L~(-1) berberine were administered at 15, 18, 21, 24, 30, 36 h. The time-dose effect of glucose content in extracellular fluid was detected by glucose oxidase method. The optimal dosage and time of berberine were determined for the follow-up study. Glucose oxidase method and chemiluminescence method were respectively performed to detect hepatic glucose output and relative content of ATP in cells; Ca~(2+), reactive oxygen species(ROS), mitochondrial structure and membrane potential were detected by fluorescent probes. Moreover, ultraviolet colorimetry method was used to detect the liver type of pyruvate kinase(L-PK) and phosphoenol pyruvate carboxykinase(PEPCK). In addition, pyruvate dehydrogenase E1 subunit α1(PDHA1), phosphate fructocrine-liver type(PFKL), forkhead box protein O1(FoxO1), peroxisome proliferator-activated receptor gamma co-activator 1α(PGC1α), glucose-6-phosphatase(G6Pase), glucagon, phosphorylated nuclear factor-red blood cell 2-related factor 2(p-Nrf2)(Ser40), heme oxygenase 1(HO-1), NAD(P)H quinone oxidoreductase 1(NQO1), fibroblast growth factor 21(FGF21), uncoupled protein(UCP) 1 and UCP2 were detected by Western blot. BMAL1:CLOCK complex was detected by immunofluorescence double-staining method, combined with small molecule inhibitor CLK8. Western blot was used to detect PDHA1, PFKL, FoxO1, PGC1α, G6Pase, glucagon, Nrf2, HO-1, NQO1, FGF21, UCP1 and UCP2 in the CLK8 group. The results showed that berberine downregulated the glucose content in extracellular fluid in IR-HepG2 cells in a time-and dose-dependent manner. Moreover, berberine inhibited hepatic glucose output and reduced intracellular Ca~(2+) and ROS whereas elevated JC-1 membrane potential and improved mitochondrial structure to enhance ATP production. In addition, berberine upregulated the rate-limiting enzymes such as PFKL, L-PK and PDHA1 to promote glycolysis and aerobic oxidation but also downregulated PGC1α, FoxO1, G6Pase, PEPCK and glucagon to inhibit hepatic gluconeogenesis. Berberine not only upregulated p-Nrf2(Ser40), HO-1 and NQO1 to enhance antioxidant capacity but also upregulated FGF21, UCP1 and UCP2 to promote energy metabolism. Moreover, berberine increased BMAL1, CLOCK and nuclear BMAL1:CLOCK complex whereas CLK8 reduced the nuclear BMAL1:CLOCK complex. Finally, CLK8 decreased PDHA1, PFKL, Nrf2, HO-1, NQO1, FGF21, UCP1, UCP2 and increased FoxO1, PGC1α, G6Pase and glucagon compared with the 20 μmol·L~(-1) berberine group. BMAL1:CLOCK complex inhibited gluconeogenesis, promoted glycolysis and glucose aerobic oxidation pathways, improved the reduction status within mitochondria, protected mitochondrial structure and function, increased ATP energy storage and promoted energy consumption in IR-HepG2 cells. These results suggested that berberine mediated BMAL1:CLOCK complex to coordinate the regulation of hepatic IR cells to improve energy metabolism in vitro.
Humans ; Berberine/pharmacology* ; Gluconeogenesis/drug effects* ; Hep G2 Cells ; Glucose/metabolism* ; Liver/drug effects* ; Energy Metabolism/drug effects* ; Hypoglycemic Agents/pharmacology* ; ARNTL Transcription Factors/genetics* ; Glycolysis/drug effects* ; Oxidation-Reduction/drug effects*

OBJECTIVES: To explore potential keywords, research clusters, collaborative pattern, and research trends in the field of medical technology management (MTM) through bibliometric analysis, providing insights for researchers, policy makers, and hospital administrators. METHODS: A retrieval formula was applied to the title, abstract, and keywords in the Web of Science (WoS) Core Collection, along with system-recommended terms, to identify articles on MTM. A total of 181 articles published between 1974 and 2022 were retained for quantitative analysis. The global trend of research output; total citations, average citations, and H-index; and bibliographic coupling, co-authorship, and keyword co-occurrence were analyzed using VOSviewer. RESULTS: The number of articles on MTM has been steadily increasing year by year. The focus of research has shifted from addressing basic medical needs to prioritizing emergency response and medical information security. The United States, Italy, and the United Kingdom emerged as the main contributors, with the United States leading in both volume of publications (60 articles) and academic impact (H-index = 21). Authors from the United Kingdom and the United States led the way in cross-border cooperation. The top five institutions, ranked by total link strength among cross-institutional authors, were primarily located in Canada and Spain. CONCLUSIONS The field of MTM has experienced stable growth over the past three decades (1993-2022). The shift of research focus has prompted a heightened emphasis on protecting patient privacy and ensuring the security of medical data. Future research should emphasize interdisciplinary and professional collaboration, as well as international cooperation and open sharing of knowledge.
Bibliometrics ; Humans ; Biomedical Technology

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVES: To evaluate the safety and efficacy of thiotepa (TT)-containing conditioning regimens for allogeneic hematopoietic stem cell transplantation (HSCT) in children with inborn errors of immunity (IEI). METHODS: Clinical data of 22 children with IEI who underwent HSCT were retrospectively reviewed. Survival after HSCT was estimated using the Kaplan-Meier method. RESULTS: Nine patients received a traditional conditioning regimen (fludarabine + busulfan + cyclophosphamide/etoposide) and underwent peripheral blood stem cell transplantation (PBSCT). Thirteen patients received a TT-containing modified conditioning regimen (TT + fludarabine + busulfan + cyclophosphamide), including seven PBSCT and six umbilical cord blood transplantation (UCBT) cases. Successful engraftment with complete donor chimerism was achieved in all patients. Acute graft-versus-host disease occurred in 12 patients (one with grade III and the remaining with grade I-II). Chronic graft-versus-host disease occurred in one patient. The incidence of EB viremia in UCBT patients was lower than that in PBSCT patients (P<0.05). Over a median follow-up of 36.0 months, one death occurred. The 3-year overall survival (OS) rate was 100% for the modified regimen and 88.9% ± 10.5% for the traditional regimen (P=0.229). When comparing transplantation types, the 3-year OS rates were 100% for UCBT and 93.8% ± 6.1% for PBSCT (P>0.05), and the 3-year event-free survival rates were 100% and 87.1% ± 8.6%, respectively (P>0.05). CONCLUSIONS TT-containing conditioning for allogeneic HSCT in children with IEI is safe and effective. Both UCBT and PBSCT may achieve high success rates.
Humans ; Retrospective Studies ; Transplantation Conditioning/methods* ; Thiotepa/therapeutic use* ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child, Preschool ; Infant ; Child ; Transplantation, Homologous ; Graft vs Host Disease ; Adolescent

OBJECTIVE: The aim of this study is to evaluate the clinical efficacy of Oxalicao Formula combined　with transacupuncture in the treatment of chronic nonbacterial prostatitis （CNP）characterized by dampness-heat stasis. METHODS: A total of 70 patients diagnosed with CNP and characterized by dampness-heat stasis were randomly divided into control group and treatment group, with 35 cases in each group. The patients in control group received Qianlie Beixi capsules． Ｗhile the patients in　treatment group were administered with oxalis decoction in conjunction with acupuncture therapy　which lasted for 8 weeks. Pre- and post-treatment evaluations for NIH-Chronic Prostatitis Symptom Index (NIH-CPSI), Traditional Chinese Medicine (TCM) symptom scores, urodynamic parameters, immune cell subsets and inflammatory factors were performed. RESULTS: Ultimately, 65 patients completed the study　with 33 in the treatment group and 32 in the control group. After 8 weeks of intervention, The patients in both of groups demonstrated significant improvements (P<0.05). Specifically, remarkable reductions in the NIH-CPSI total score　including pain score, urination score, quality of life impact score, TCM symptom score and inflammatory cytokine levels　were observed. Additionally, there were upward trend　in maximum and average urinary flow rates as well as the CD4+/CD8+ ratio of immune cells(P<0.05). Compared to the control group, the treatment group exhibited superior outcomes in reducing the NIH-CPSI total score, pain score, urination score, quality of life impact score, TCM symptom score, and inflammatory cytokine levels, and increasing in　CD4+/CD8+ ratios， maximum and average urine flow rates(P<0.05). CONCLUSION The combination of Oxalicao Formula and transacupuncture for treating CNP characterized by dampness-heat stasis demonstrates significant therapeutic benefits, which has considerable clinical application value.
Humans ; Male ; Prostatitis/therapy* ; Drugs, Chinese Herbal/therapeutic use* ; Acupuncture Therapy ; Medicine, Chinese Traditional ; Chronic Disease ; Treatment Outcome ; Adult