Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans ; Lymphoma, B-Cell, Marginal Zone/pathology* ; Lymph Nodes/pathology* ; Neck/pathology* ; Male

Objective lt focuses on the pivotal role of physician-scientists as a central driving force in the advancement of research-oriented hospitals,with particular emphasis on mapping the cultivation pathways and structural framework of their core competencies,while integrating existing evidence to propose optimization strategies.Methods A systematic review was conducted using PubMed,Web of Science,Embase,CNKl,and Wanfang databases to identify studies published between 2000 and 2024 concerning the core competencies of physician-scientists.Results A total of 29 studies were included.The synthesized core competency framework comprises four domains:clinical research capacity,interdisciplinary integration ability,teamwork ability and leadership,and professional integrity and accountability.Conclusion The core competencies of physician-scientists exhibit a progressive trajectory aligned with career development.Future efforts should further clarify the professional role of physician-scientists and accelerate the research on the core competencies of physician-scientists in line with the requirements of job competence,thereby advancing the high-quality development of research-oriented hospitals.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

With the rapid development of generative artificial intelligence(GAI)technologies,their widespread application in academic research and writing is continuously expanding the boundaries of sci-entific inquiry.However,this trend has also raised a series of ethical and regulatory challenges,inclu-ding issues related to authorship,content authenticity,citation accuracy,and accountability.In light of the growing involvement of AI in generating academic content,establishing an open,controllable,and trustworthy ethical governance framework has become a key task for safeguarding research integrity and maintaining trust within the academic community.This expert consensus outlines ethical requirements across key stages of AI-assisted academic writing-including topic selection,data management,citation practices,and authorship attribution.It aims to clarify the boundaries and ethical obligations surrounding AI use in academic writing,ensuring that technological tools enhance efficiency without compromising in-tegrity.The goal is to provide guidance and institutional support for building a responsible and sustainable research ecosystem.

Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.

Objective To investigate the comparative neuroprotective effects of human umbilical cord mesenchymal stem cells(hUC-MSCs-Exos)administered via different routes on hypoxic ischemic brain damage(HIBD)in neonatal mice.Methods Healthy one-week-old SPF-grade BALB/c mice were randomly divided into 4 groups:sham operation group(n=6),model group(n=6),exosome group 1(n=8),exosome group 2(n=8).HIBD was induced using the Rice-Vannucci method.Exosome group 1 and Exosome group 2 were intraperitoneal injection/intranasal drip of phosphate buffer(PBS)100 μl containing 10 μl exosomes within 24 h after successful modeling,respectively.Sham operation and model groups were intraperitoneal injection of PBS 100 μl.On the 7th day after the intervention,neuromotor function was assessed using the horizontal grid test and pole climbing test.On the 2nd day after the evaluation,all mice were killed and their brains were removed by decapitation.HE staining was used to observe the pathological injury of brain tissue,toluidine blue staining was used to observe the survival of neurons in cerebral cortex,and TUNEL staining was used to observe the apoptosis of cerebral cortex cells.Results Compared with sham operation group,model group,exosome group 1 and exosome group 2 exhibited increased hind limb drops in horizontal grid test and climbing scores(P<0.05).No significant difference was found in model group,exosome group 1 and exosome group 2 in these measures(P<0.05).Significant pathology was observed in model group,exosome group 1 and exosome group 2 compared to sham operation group(P<0.05),with significantly reduced damage in exosome group 1 and exosome group 2 compared to model group(P<0.05).Compared with sham operation group,Nissl body count was lower in model group and exosome group 1 and exosome group 2,with a higher count in exosome group 2 compared to exosome group 1(P<0.05).Compared with sham operation group,apoptotic cells were higher in model group and exosome group 1 and exosome group 2,with a significant reduction in exosome group 1 and exosome group 2 compared to model group,and the lowest in exosome group 2(P<0.05).Conclusions hUC-MSCs-Exos can improve the neuronal motor function,promote neuron repair and inhibit apoptosis in HIBD mice.Intranasal administration of hUC-MSCs-Exos is more effective than intraperitoneal administration for reducing neuronal apoptosis in HIBP neonatal mice,offering a convenient and rapid method suitable for clinical application.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy. METHODS: A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG. RESULTS: After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05). CONCLUSIONS The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.
Humans ; Thrombelastography ; Hemophilia A/physiopathology* ; Male ; Child ; Antibodies, Bispecific/therapeutic use* ; Antibodies, Monoclonal, Humanized/therapeutic use* ; Blood Coagulation/drug effects* ; Child, Preschool ; Retrospective Studies ; Female ; Partial Thromboplastin Time ; Adolescent ; Infant