1.Progress on antisense oligonucleotide in the field of antibacterial therapy
Jia LI ; Xiao-lu HAN ; Shi-yu SONG ; Jin-tao LIN ; Zhi-qiang TANG ; Zeng-ming WANG ; Liang XU ; Ai-ping ZHENG
Acta Pharmaceutica Sinica 2025;60(2):337-347
With the widespread use of antibiotics, drug-resistant bacterial infections have become a significant threat to human health. Finding new antibacterial strategies that can effectively control drug-resistant bacterial infections has become an urgent task. Unlike small molecule drugs that target bacterial proteins, antisense oligonucleotide (ASO) can target genes related to bacterial resistance, pathogenesis, growth, reproduction and biofilm formation. By regulating the expression of these genes, ASO can inhibit or kill bacteria, providing a novel approach for the development of antibacterial drugs. To overcome the challenge of delivering antisense oligonucleotide into bacterial cells, various drug delivery systems have been applied in this field, including cell-penetrating peptides, lipid nanoparticles and inorganic nanoparticles, which have injected new momentum into the development of antisense oligonucleotide in the antibacterial realm. This review summarizes the current development of small nucleic acid drugs, the antibacterial mechanisms, targets, sequences and delivery vectors of antisense oligonucleotide, providing a reference for the research and development of antisense oligonucleotide in the treatment of bacterial infections.
2.Determination of biological activity of teduglutide by a homogeneous time-resolved fluorescence method
Xiao-ming ZHANG ; Ran MA ; Li-jing LÜ ; Lü-yin WANG ; Ping LÜ ; Cheng-gang LIANG ; Jing LI
Acta Pharmaceutica Sinica 2025;60(1):211-217
In this study, we constructed a GLP-2R-HEK293 cell line and established a method for the determination of the
3.Identification of unknown pollutants in drinking water based on solid-phase extraction and supramolecular solvent extraction
Zixin QIAN ; Yuhang CHEN ; Chao FENG ; Yuanjie LIN ; Qian XU ; Ziwei LIANG ; Xinyu WANG ; Dasheng LU ; Ping XIAO ; Zhijun ZHOU
Journal of Environmental and Occupational Medicine 2025;42(7):854-861
Background With the progression of industrialization, an increasing number of emerging contaminants are entering aquatic environments, posing significant threats to the safety of drinking water. Therefore, establishing a system for identifying unknown hazardous factors and implementing safety warning mechanisms for drinking water is of paramount importance. Among these efforts, non-target screening plays a critical role, but its effectiveness is largely constrained by the scope of coverage of sample pre-treatment methods. Objective To integrate modern chromatography/mass spectrometry techniques with advanced data mining methods to develop a non-discriminatory sample pre-treatment method for comprehensive enrichment of unknown contaminants in drinking water, laying a technical foundation for the discovery and identification of unknown organic hazardous factors in drinking water. Methods A non-discriminatory pre-treatment method based on supramolecular and solid-phase extraction was developed. The final target compounds including 333 pesticides, 194 pharmaceuticals and personal care products (PPCPs), and 59 per- and polyfluoroalkyl substances (PFASs) were used for optimizing the pre-treatment method, confirming its coverage. The impacts of different eluents on the absolute recovery rates of target compounds were compared to select the conditions with the highest recovery for sample pre-treatment. The effects of different supramolecular solvents and salt concentrations on target compound recovery were also evaluated to determine the most suitable solvent and salt concentration. Results The solid-phase extraction elution solvents, supramolecular extraction solvents, and salt concentrations were optimized based on the target compound recovery rates. The optimal recovery conditions were achieved using 2 mL methanol, 2 mL methanol (containing 1% formic acid), 2 mL ethyl acetate, 2 mL dichloromethane, hexanediol supramolecular solvent, and 426 mg salt. The detection method developed based on these conditions showed a good linear relationship for all target compounds in the range of 0.1-100.0 ng·mL−1, with R² > 0.99. The method’s limit of detection ranged from 0.01 ng−1 to 0.95 ng−1, and 95% of target compounds were recovered in the range of 20%-120%, with relative standard deviation (RSD) less than 30%, indicating good precision. Conclusion The combined pre-treatment method of solid-phase extraction and supramolecular solvent extraction can effectively enrich contaminants in drinking water across low, medium, and high polarities, enabling broad-spectrum enrichment of diverse trace contaminants in drinking water. It provides technical support for broad-spectrum, high-throughput screening and identification of organic pollutants in drinking water, and also serves as a reference for establishing urban drinking water public safety warning systems.
4.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
5.Rapid characterization and identification of non-volatile components in Rhododendron tomentosum by UHPLC-Q-TOF-MS method.
Su-Ping XIAO ; Long-Mei LI ; Bin XIE ; Hong LIANG ; Qiong YIN ; Jian-Hui LI ; Jie DU ; Ji-Yong WANG ; Run-Huai ZHAO ; Yan-Qin XU ; Yun-Bo SUN ; Zong-Yuan LU ; Peng-Fei TU
China Journal of Chinese Materia Medica 2025;50(11):3054-3069
This study aimed to characterize and identify the non-volatile components in aqueous and ethanolic extracts of the stems and leaves of Rhododendron tomentosum by using sensitive and efficient ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry(UHPLC-Q-TOF-MS) combined with a self-built information database. By comparing with reference compounds, analyzing fragment ion information, searching relevant literature, and using a self-built information database, 118 compounds were identified from the aqueous and ethanolic extracts of R. tomentosum, including 35 flavonoid glycosides, 15 phenolic glycosides, 12 flavonoids, 7 phenolic acids, 7 phenylethanol glycosides, 6 tannins, 6 phospholipids, 5 coumarins, 5 monoterpene glycosides, 6 triterpenes, 3 fatty acids, and 11 other types of compounds. Among them, 102 compounds were reported in R. tomentosum for the first time, and 36 compounds were identified by comparing them with reference compounds. The chemical components in the ethanolic and aqueous extracts of R. tomentosum leaves and stems showed slight differences, with 84 common chemical components accounting for 71.2% of the total 118 compounds. This study systematically characterized and identified the non-volatile chemical components in the ethanolic and aqueous extracts of R. tomentosum for the first time. The findings provide a reference for active ingredient research, quality control, and product development of R. tomentosum.
Rhododendron/chemistry*
;
Chromatography, High Pressure Liquid/methods*
;
Drugs, Chinese Herbal/chemistry*
;
Mass Spectrometry/methods*
;
Plant Leaves/chemistry*
6.Research progress on prevention and treatment of hepatocellular carcinoma with traditional Chinese medicine based on gut microbiota.
Rui REN ; Xing YANG ; Ping-Ping REN ; Qian BI ; Bing-Zhao DU ; Qing-Yan ZHANG ; Xue-Han WANG ; Zhong-Qi JIANG ; Jin-Xiao LIANG ; Ming-Yi SHAO
China Journal of Chinese Materia Medica 2025;50(15):4190-4200
Hepatocellular carcinoma(HCC), the third leading cause of cancer-related death worldwide, is characterized by high mortality and recurrence rates. Common treatments include hepatectomy, liver transplantation, ablation therapy, interventional therapy, radiotherapy, systemic therapy, and traditional Chinese medicine(TCM). While exhibiting specific advantages, these approaches are associated with varying degrees of adverse effects. To alleviate patients' suffering and burdens, it is crucial to explore additional treatments and elucidate the pathogenesis of HCC, laying a foundation for the development of new TCM-based drugs. With emerging research on gut microbiota, it has been revealed that microbiota plays a vital role in the development of HCC by influencing intestinal barrier function, microbial metabolites, and immune regulation. TCM, with its multi-component, multi-target, and multi-pathway characteristics, has been increasingly recognized as a vital therapeutic treatment for HCC, particularly in patients at intermediate or advanced stages, by prolonging survival and improving quality of life. Recent global studies demonstrate that TCM exerts anti-HCC effects by modulating gut microbiota, restoring intestinal barrier function, regulating microbial composition and its metabolites, suppressing inflammation, and enhancing immune responses, thereby inhibiting the malignant phenotype of HCC. This review aims to elucidate the mechanisms by which gut microbiota contributes to the development and progression of HCC and highlight the regulatory effects of TCM, addressing the current gap in systematic understanding of the "TCM-gut microbiota-HCC" axis. The findings provide theoretical support for integrating TCM with western medicine in HCC treatment and promote the transition from basic research to precision clinical therapy through microbiota-targeted drug development and TCM-based interventions.
Humans
;
Gastrointestinal Microbiome/drug effects*
;
Carcinoma, Hepatocellular/microbiology*
;
Liver Neoplasms/microbiology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Animals
;
Medicine, Chinese Traditional
7.Short-term clinical efficacy of unilateral external fixator combined with percutaneous Kirschner wire fixation in the treatment of type C1 distal radius fractures in elderly patients.
Run-Bin SHEN ; Guo-Liang LI ; Xiao-Ping LIU ; Kang CHEN ; Guang-Pu HAN ; Jian-Yong ZHAO
China Journal of Orthopaedics and Traumatology 2025;38(1):25-30
OBJECTIVE:
To investigate the short-term clinical effect of closed reduction single arm external fixator combined with percutaneous needle fixation in the treatment of C1 distal radius fracture in elderly patients.
METHODS:
Between December 2022 and December 2023, a total of 60 elderly patients diagnosed with type C1 distal radius fractures were treated, comprising 9 males and 51 females. The age ranged from 65 to 84 years old, with an average of (72.69±8.14) years old. Among them, there were 18 cases on the left side and 42 cases on the right side. There were 55 cases of falling injury and 5 cases of traffic accident injury. According to the different surgical methods, the patients were divided into observation group and control group, with 30 cases in each group. The control group underwent manual reduction and unilateral external fixator fixation, consisting of 4 males and 26 females. The mean age was (72.54±8.67) years old. The body mass index (BMI) was (20.61±2.17) kg·m-2. There were 10 cases on the left side and 20 cases on the right side. Among them, there were 27 cases of falling injury and 3 cases of traffic accident injury. The observation group was treated with manual reduction and unilateral external fixator combined with percutaneous Kirschner wire fixation, including 5 males and 25 females. The mean age was (72.76±7.23) years old. BMI (20.82±2.03) kg·m-2. The left side was involved in 8 cases and the right side in 22 cases. There were 28 cases of falling injury and 2 cases of traffic accident injury. The changes in radial height, ulnar declination, palmar inclination angle parameters and patient-rated wrist evaluation (PRWE) were assessed on X-ray films before surgery, 2 days after surgery, and 12 weeks after surgery between the two groups.
RESULTS:
All surgical procedures were successfully completed in both groups without any significant complications. All patients were followed up for a duration from 12 to 20 weeks with an average of(14.50±2.78) weeks. The two groups exhibited significant differences in radial height, palmar inclination angle, and ulnar deviation angle at 2 days and 12 weeks post-operation (P<0.05). However, there was no statistically significant difference observed in radial height, palmar inclination, and ulnar deviation between the two groups at 2 days after the operation (P>0.05). There were significant differences in radial height, palmar inclination angle, and ulnar deviation between the two groups at 12 weeks after operation (P<0.05). At 2 days and 12 weeks after the operation, there were significant differences in PRWE scores of the two groups compared with preoperative scores(P<0.05). At 2 days after the operation, there was no significant difference in PRWE score between the two groups (P>0.05). The PRWE score showed a significant difference between the two groups at 12 weeks post-operation(P<0.05).
CONCLUSION
The combination of closed reduction and unilateral external fixator, along with percutaneous pin fixation provides move stable fixation for type C1 distal radius fractures. Gradual removal of external fixator further facilitatse the recovery of wrist joint function.
Humans
;
Male
;
Female
;
Radius Fractures/surgery*
;
External Fixators
;
Aged
;
Aged, 80 and over
;
Bone Wires
;
Fracture Fixation/instrumentation*
;
Wrist Fractures
8.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
9.Psychological stress-activated NR3C1/NUPR1 axis promotes ovarian tumor metastasis.
Bin LIU ; Wen-Zhe DENG ; Wen-Hua HU ; Rong-Xi LU ; Qing-Yu ZHANG ; Chen-Feng GAO ; Xiao-Jie HUANG ; Wei-Guo LIAO ; Jin GAO ; Yang LIU ; Hiroshi KURIHARA ; Yi-Fang LI ; Xu-Hui ZHANG ; Yan-Ping WU ; Lei LIANG ; Rong-Rong HE
Acta Pharmaceutica Sinica B 2025;15(6):3149-3162
Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.
10.International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025).
Sheng-Sheng ZHANG ; Lu-Qing ZHAO ; Xiao-Hua HOU ; Zhao-Xiang BIAN ; Jian-Hua ZHENG ; Hai-He TIAN ; Guan-Hu YANG ; Won-Sook HONG ; Yu-Ying HE ; Li LIU ; Hong SHEN ; Yan-Ping LI ; Sheng XIE ; Jin SHU ; Bin-Fang ZENG ; Jun-Xiang LI ; Zhen LIU ; Zheng-Hua XIAO ; Jing-Dong XIAO ; Pei-Yong ZHENG ; Shao-Gang HUANG ; Sheng-Liang CHEN ; Gui-Jun FEI
Journal of Integrative Medicine 2025;23(5):502-518
Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy*
;
Humans
;
Medicine, Chinese Traditional/methods*
;
Practice Guidelines as Topic
;
Drugs, Chinese Herbal/therapeutic use*

Result Analysis
Print
Save
E-mail