ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

This study aimed to characterize and identify the non-volatile components in aqueous and ethanolic extracts of the stems and leaves of Rhododendron tomentosum by using sensitive and efficient ultra-performance liquid chromatography-quadrupole-time of flight mass spectrometry(UHPLC-Q-TOF-MS) combined with a self-built information database. By comparing with reference compounds, analyzing fragment ion information, searching relevant literature, and using a self-built information database, 118 compounds were identified from the aqueous and ethanolic extracts of R. tomentosum, including 35 flavonoid glycosides, 15 phenolic glycosides, 12 flavonoids, 7 phenolic acids, 7 phenylethanol glycosides, 6 tannins, 6 phospholipids, 5 coumarins, 5 monoterpene glycosides, 6 triterpenes, 3 fatty acids, and 11 other types of compounds. Among them, 102 compounds were reported in R. tomentosum for the first time, and 36 compounds were identified by comparing them with reference compounds. The chemical components in the ethanolic and aqueous extracts of R. tomentosum leaves and stems showed slight differences, with 84 common chemical components accounting for 71.2% of the total 118 compounds. This study systematically characterized and identified the non-volatile chemical components in the ethanolic and aqueous extracts of R. tomentosum for the first time. The findings provide a reference for active ingredient research, quality control, and product development of R. tomentosum.
Rhododendron/chemistry* ; Chromatography, High Pressure Liquid/methods* ; Drugs, Chinese Herbal/chemistry* ; Mass Spectrometry/methods* ; Plant Leaves/chemistry*

Hepatocellular carcinoma(HCC), the third leading cause of cancer-related death worldwide, is characterized by high mortality and recurrence rates. Common treatments include hepatectomy, liver transplantation, ablation therapy, interventional therapy, radiotherapy, systemic therapy, and traditional Chinese medicine(TCM). While exhibiting specific advantages, these approaches are associated with varying degrees of adverse effects. To alleviate patients' suffering and burdens, it is crucial to explore additional treatments and elucidate the pathogenesis of HCC, laying a foundation for the development of new TCM-based drugs. With emerging research on gut microbiota, it has been revealed that microbiota plays a vital role in the development of HCC by influencing intestinal barrier function, microbial metabolites, and immune regulation. TCM, with its multi-component, multi-target, and multi-pathway characteristics, has been increasingly recognized as a vital therapeutic treatment for HCC, particularly in patients at intermediate or advanced stages, by prolonging survival and improving quality of life. Recent global studies demonstrate that TCM exerts anti-HCC effects by modulating gut microbiota, restoring intestinal barrier function, regulating microbial composition and its metabolites, suppressing inflammation, and enhancing immune responses, thereby inhibiting the malignant phenotype of HCC. This review aims to elucidate the mechanisms by which gut microbiota contributes to the development and progression of HCC and highlight the regulatory effects of TCM, addressing the current gap in systematic understanding of the "TCM-gut microbiota-HCC" axis. The findings provide theoretical support for integrating TCM with western medicine in HCC treatment and promote the transition from basic research to precision clinical therapy through microbiota-targeted drug development and TCM-based interventions.
Humans ; Gastrointestinal Microbiome/drug effects* ; Carcinoma, Hepatocellular/microbiology* ; Liver Neoplasms/microbiology* ; Drugs, Chinese Herbal/administration & dosage* ; Animals ; Medicine, Chinese Traditional

Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy* ; Humans ; Medicine, Chinese Traditional/methods* ; Practice Guidelines as Topic ; Drugs, Chinese Herbal/therapeutic use*

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

OBJECTIVE: Coronavirus disease 2019 (COVID-19) can result in fatigue and post-exertional malaise; however, whether severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection exacerbates lower urinary tract symptoms (LUTS) is unclear. This study investigated the association between prenatal SARS-CoV-2 infection and postpartum LUTS. METHODS: A multicenter, retrospective cohort study was conducted at two tertiary hospitals in China from November 1, 2022, to November 1, 2023. Participants were classified into infected and uninfected groups based on SARS-CoV-2 antigen results. LUTS prevalence and severity were assessed using self-reported symptoms and the Incontinence Impact Questionnaire-Short Form (IIQ-7). Pelvic floor muscle activity was measured using electromyography following the Glazer protocol. Group comparisons were performed to evaluate the association of SARS-CoV-2 infection with LUTS and electromyography parameters, with stratified analyses conducted using SPSS version 26.0. RESULTS: Among 3,652 participants (681 infected, 2,971 uninfected), no significant differences in LUTS prevalence or IIQ-7 scores were observed. However, SARS-CoV-2 infection was an independent factor influencing the electromyographic activity of the pelvic floor muscles (mean tonic contraction amplitudes), regardless of delivery mode ( P = 0.001). CONCLUSION Prenatal SARS-CoV-2 infection was not significantly associated with an increased risk of postpartum LUTS but independently altered pelvic floor muscle electromyographic activity, suggesting potential neuromuscular effects.
Humans ; Female ; COVID-19/epidemiology* ; Retrospective Studies ; Adult ; Pregnancy ; Lower Urinary Tract Symptoms/virology* ; Postpartum Period ; Pregnancy Complications, Infectious/virology* ; China/epidemiology* ; Electromyography ; SARS-CoV-2/physiology* ; Pelvic Floor/physiopathology* ; Prevalence

Abstract In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.