Cardiac fibrosis(CF) is a cardiac pathological process characterized by excessive deposition of extracellular matrix(ECM). When the heart is damaged by adverse stimuli, cardiac fibroblasts are activated and secrete a large amount of ECM, leading to changes in cardiac fibrosis, myocardial stiffness, and cardiac function declines and accelerating the development of heart failure. There is a close relationship between heart yin deficiency and cardiac fibrosis, which have similar pathogenic mechanisms. Heart Yin deficiency, characterized by insufficient Yin fluids, causes the heart to lose its nourishing function, which acts as the initiating factor for myocardial dystrophy. The deficiency of body fluids leads to stagnation of blood flow, resulting in blood stasis and water retention. Blood stasis and water retention accumulate in the heart, which aligns with the pathological manifestation of excessive deposition of ECM, as a tangible pathogenic factor. This is an inevitable stage of the disease process. The lingering of blood stasis combined with water retention eventually leads to the generation of heat and toxins, triggering inflammatory responses similar to heat toxins, which continuously stimulate the heart and cause the ultimate outcome of CF. Considering the syndrome of heart Yin deficiency, traditional Chinese medicine capable of nourishing Yin, activating blood, and promoting urination can reduce myocardial cell apoptosis, inhibit fibroblast activation, and lower the inflammation level, showing significant advantages in combating CF.
Humans ; Fibrosis/drug therapy* ; Animals ; Yin Deficiency/metabolism* ; Myocardium/metabolism* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

OBJECTIVE: Patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection frequently develop central nervous system damage, yet the mechanisms driving this pathology remain unclear. This study investigated the primary pathways and key factors underlying brain tissue damage induced by the SARS-CoV-2 beta variant (lineage B.1.351). METHODS: K18-hACE2 and C57BL/6 mice were intranasally infected with the SARS-CoV-2 beta variant. Viral replication, pathological phenotypes, and brain transcriptomes were analyzed. Gene Ontology (GO) analysis was performed to identify altered pathways. Expression changes of host genes were verified using reverse transcription-quantitative polymerase chain reaction and Western blot. RESULTS: Pathological alterations were observed in the lungs of both mouse strains. However, only K18-hACE2 mice exhibited elevated viral RNA loads and infectious titers in the brain at 3 days post-infection, accompanied by neuropathological injury and weight loss. GO analysis of infected K18-hACE2 brain tissue revealed significant dysregulation of genes associated with innate immunity and antiviral defense responses, including type I interferons, pro-inflammatory cytokines, Toll-like receptor signaling components, and interferon-stimulated genes. Neuroinflammation was evident, alongside activation of apoptotic and pyroptotic pathways. Furthermore, altered neural cell marker expression suggested viral-induced neuroglial activation, resulting in caspase 4 and lipocalin 2 release and disruption of neuronal molecular networks. CONCLUSION These findings elucidate mechanisms of neuropathogenicity associated with the SARS-CoV-2 beta variant and highlight therapeutic targets to mitigate COVID-19-related neurological dysfunction.
Animals ; COVID-19/genetics* ; Mice ; Brain/metabolism* ; Apoptosis ; Mice, Inbred C57BL ; SARS-CoV-2/physiology* ; Pyroptosis ; Gene Expression Profiling ; Transcriptome ; Male ; Female

This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model: Z = 688.310 11 - 3 023.722 22X₁ - 11.477 00X₂ + 62.721 67X₃ + 14.600 00X₁X₂ - 179.666 67X₁X₃ - 3.152 00X₂X₃ + 4 031.111 11X₁² + 0.525 28X₂² + 9.772 00X₃². This model is stable and reliable, determining the optimal taste-masking formulation to be 3.9 g·L^-1 of stevioside, 100 g L^-1 of xylitol, and 30 g L^-1 of methyl-β-cyclodextrin. The comprehensive score of the verification test is 88.14, with a relative RSD of 0.39%, indicating the feasibility of this model. This study achieved the improvement of the taste of ibuprofen oral solution through a combination of objective and subjective methods. Three types of corrigent were identified for enhancing drug taste, leading to the selection of the optimal taste-masking formulation for ibuprofen oral solution. This significantly enhanced the taste of the original formulation, improved patient compliance, and offered a new approach to mitigating the undesirable taste of formulations.

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L^-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Objective To make an epidemiological investigation on traditional Chinese medicine(TCM)dampness syndrome manifestations in the population at risk of cerebrovascular diseases in Guangdong area.Methods A cross-sectional study was conducted to analyze the clinical data related to the risk of cerebrovascular diseases in 330 Guangdong permanent residents.The diagnosis of dampness syndrome,quantitative scoring of dampness syndrome and rating of the risk of stroke were performed for the investigation of the distribution pattern of dampness syndrome and its influencing factors.Results(1)A total of 306(92.73%)study subjects were diagnosed as dampness syndrome.The percentage of dampness syndrome in the risk group was 93.82%(258/275),which was slightly higher than that of the healthy group(48/55,87.27%),but the difference was not statistically significant(χ2 = 2.91,P = 0.112).The quantitative score of dampness syndrome in the risk group was higher than that of the healthy group,and the difference was statistically significance(Z =-2.24,P = 0.025).(2)Among the study subjects at risk of cerebrovascular disease,evaluation time(χ2 = 26.11,P = 0.001),stroke risk grading(χ2= 8.85,P = 0.031),and history of stroke or transient ischemic attack(TIA)(χ2 = 9.28,P = 0.015)were the factors influencing the grading of dampness syndrome in the population at risk of cerebrovascular disease.Conclusion Dampness syndrome is the common TCM syndrome in the population of Guangdong area.The manifestations of dampness syndrome are more obvious in the population with risk factors of cerebrovascular disease,especially in the population at high risk of stroke,and in the population with a history of stroke or TIA.The assessment and intervention of dampness syndrome should be taken into account for future project of stroke prevention in Guangdong.

Background Chronic excessive exposure to fluoride can cause damage to the central nervous system and a certain degree of learning and memory impairment. However, the associated mechanism is not yet clear and further exploration is needed. Objective Using 4D unlabelled quantitative proteomics techniques to explore differentially expressed proteins and their potential mechanisms of action in chronic excessive fluoride exposure induced brain injury. Methods Twenty-four SPF-grade adult SD rats, half male and half male, were selected and divided into a control group and a fluoride group by random number table method, with 12 rats in each group. Among them, the control group drank tap water (fluorine content<1 mg·L⁻¹), the fluoride group drank sodium fluoride solution (fluorine content 10 mg·L⁻¹), and both groups were fed with ordinary mouse feed (fluoride content<0.6 mg·kg⁻¹). After 180 d of feeding, the SD rats were weighed, and then part of the brain tissue was sampled for pathological examination by hematoxylin-eosin (HE) staining and Nissl staining. The rest of the brain tissue was frozen and stored at −80 ℃. Three brain tissue samples from each group were randomly selected for proteomics detection. Differentially expressed proteins were screened and subcellular localization analysis was performed, followed by Gene Ontology (GO) function analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, cluster analysis, and protein-protein interaction analysis. Finally, Western blotting was used to detect the expression levels of key proteins extracted from the brain tissue samples. Results After 180 d of feeding, the average weight of the rats in the fluoride group was significantly lower than that in the control group (P<0.05). The brain tissue stained with HE showed no significant morphological changes in the cerebral cortex of the fluoride treated rats, and neuron loss, irregular arrangement of neurons, eosinophilic changes, and cell body pyknosis were observed in the hippocampus. The Nissl staining results showed that the staining of neurons in the cerebral cortex and hippocampus of rats exposed to fluoride decreased (Nissl bodies decreased). The proteomics results showed that a total of 6927 proteins were identified. After screening, 206 differentially expressed proteins were obtained between the control group and the fluoride group, including 96 up-regulated proteins and 110 down-regulated proteins. The differential proteins were mainly located in cytoplasm (30.6%), nucleus (27.2%), mitochondria (13.6%), plasma membrane (13.6%), and extracellular domain (11.7%). The GO analysis results showed that differentially expressed proteins mainly participated in biological processes such as iron ion transport, regulation of dopamine neuron differentiation, and negative regulation of respiratory burst in inflammatory response, exercised molecular functions such as ferrous binding, iron oxidase activity, and cytokine activity, and were located in the smooth endoplasmic reticulum membrane, fixed components of the membrane, chloride channel complexes, and other cellular components. The KEGG significantly enriched pathways included biosynthesis of secondary metabolites, carbon metabolism, and microbial metabolism in diverse environments. The results of differential protein-protein interaction analysis showed that the highest connectivity was found in glucose-6-phosphate isomerase (Gpi). The expression level of Gpi in the brain tissue of the rats in the fluoride group was lower than that in the control group by Western blotting (P<0.05). Conclusion Multiple differentially expressed proteins are present in the brain tissue of rats with chronic fluorosis, and their functions are related to biosynthesis of secondary metabolites, carbon metabolism, and microbial metabolism in diverse environments; Gpi may be involved in cerebral neurological damage caused by chronic overdose fluoride exposure.

Interleukin-11(IL-11)is a multifunctional cytokine that plays a crucial role in various bio-logical processes,including the promotion of hematopoiesis,regulation of the immune system,and facili-tation of tissue repair.These functions highlight its significant importance in both medical research and clinical therapy.Consequently,the precise detection and assessment of IL-11's biological activity are es-sential.The currently employed cell proliferation inhibition assay is cumbersome,time-consuming,and susceptible to interference from Interleukin-6.Here we study the JAK-STAT signaling pathway,a key mechanism of IL-11 actions.We initially establish a stable monoclonal cell line that expresses a luciferase reporter gene responsive to IL-11.We subsequently optimized critical parameters,including the pre-dilu-tion concentration and gradient of IL-11,cell inoculum size,and IL-11 incubation duration.Comprehen-sive validation was undertaken to evaluate accuracy,precision,specificity,stability,and concordance with pharmacopeial methods,ultimately leading to the establishment of a novel reporter gene-based ap-proach for detecting the biological activity of IL-11.This innovative method significantly enhances the de-tection accuracy and sensitivity while reducing the testing time,thereby offering promising prospects for broad applications.