Cardiac fibrosis(CF) is a cardiac pathological process characterized by excessive deposition of extracellular matrix(ECM). When the heart is damaged by adverse stimuli, cardiac fibroblasts are activated and secrete a large amount of ECM, leading to changes in cardiac fibrosis, myocardial stiffness, and cardiac function declines and accelerating the development of heart failure. There is a close relationship between heart yin deficiency and cardiac fibrosis, which have similar pathogenic mechanisms. Heart Yin deficiency, characterized by insufficient Yin fluids, causes the heart to lose its nourishing function, which acts as the initiating factor for myocardial dystrophy. The deficiency of body fluids leads to stagnation of blood flow, resulting in blood stasis and water retention. Blood stasis and water retention accumulate in the heart, which aligns with the pathological manifestation of excessive deposition of ECM, as a tangible pathogenic factor. This is an inevitable stage of the disease process. The lingering of blood stasis combined with water retention eventually leads to the generation of heat and toxins, triggering inflammatory responses similar to heat toxins, which continuously stimulate the heart and cause the ultimate outcome of CF. Considering the syndrome of heart Yin deficiency, traditional Chinese medicine capable of nourishing Yin, activating blood, and promoting urination can reduce myocardial cell apoptosis, inhibit fibroblast activation, and lower the inflammation level, showing significant advantages in combating CF.
Humans ; Fibrosis/drug therapy* ; Animals ; Yin Deficiency/metabolism* ; Myocardium/metabolism* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

OBJECTIVE: Patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection frequently develop central nervous system damage, yet the mechanisms driving this pathology remain unclear. This study investigated the primary pathways and key factors underlying brain tissue damage induced by the SARS-CoV-2 beta variant (lineage B.1.351). METHODS: K18-hACE2 and C57BL/6 mice were intranasally infected with the SARS-CoV-2 beta variant. Viral replication, pathological phenotypes, and brain transcriptomes were analyzed. Gene Ontology (GO) analysis was performed to identify altered pathways. Expression changes of host genes were verified using reverse transcription-quantitative polymerase chain reaction and Western blot. RESULTS: Pathological alterations were observed in the lungs of both mouse strains. However, only K18-hACE2 mice exhibited elevated viral RNA loads and infectious titers in the brain at 3 days post-infection, accompanied by neuropathological injury and weight loss. GO analysis of infected K18-hACE2 brain tissue revealed significant dysregulation of genes associated with innate immunity and antiviral defense responses, including type I interferons, pro-inflammatory cytokines, Toll-like receptor signaling components, and interferon-stimulated genes. Neuroinflammation was evident, alongside activation of apoptotic and pyroptotic pathways. Furthermore, altered neural cell marker expression suggested viral-induced neuroglial activation, resulting in caspase 4 and lipocalin 2 release and disruption of neuronal molecular networks. CONCLUSION These findings elucidate mechanisms of neuropathogenicity associated with the SARS-CoV-2 beta variant and highlight therapeutic targets to mitigate COVID-19-related neurological dysfunction.
Animals ; COVID-19/genetics* ; Mice ; Brain/metabolism* ; Apoptosis ; Mice, Inbred C57BL ; SARS-CoV-2/physiology* ; Pyroptosis ; Gene Expression Profiling ; Transcriptome ; Male ; Female

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Objective:The genotoxicity risk of graphene artificial nerve sheath conduit was systematically evaluated to provide scientific evidence for their clinical safety and to establish methodological references for the genotoxicity assessment of nanomaterial medical devices.Methods:The potential effects of graphene artificial nerve sheath conduit on genetic and chromosomal endpoints were analyzed by integrating bacterial reverse mutation assays,in vitro chromosome aberration assays,mouse lymphoma cell TK gene mutation tests,and mammalian erythrocyte Pig-a gene mutation assays.Results:In the bacterial reverse mutation assay,all plates showed good background growth.There was no significant difference in the average number of revertant colonies between the test group and the negative control group,with a ratio around 1.0.In the in vitro chromosome aberration assay,the chromosomal aberration rate in the test group was less than 5％,showing no significant increase compared to the negative control group.In the mouse lymphoma cell TK gene mutation assay,the mutation frequency in the test group was less than twice that of the negative control group,with no significant difference.In the mammalian erythrocyte Pig-a gene mutation assay,the mutation frequencies of erythrocytes and reticulocytes in the test group were both less than 3× 10-6,showing no significant difference compared to the negative control group.Conclusions:Graphene artificial nerve sheath conduit exhibited no detectable genotoxicity under the tested conditions,the research results can provide reference and guidance for the genotoxicity evaluation of nanomaterial medical devices.

AIM:This study aimed to investigate the protective effects of Carthamus tinctorius L.-derived nanovesicles(CDNVs)and their regulatory mechanisms in endothelial cell injury induced by oxidized low-density lipopro-tein(ox-LDL).METHODS:Human umbilical vein endothelial cells(HUVECs)were cultured in vitro and subjected to ox-LDL treatment to establish an endothelial cell injury model.The experimental groups included the normal control(NC)group,ox-LDL group(HUVECs treated with 100 mg/L ox-LDL for 24 h),and CDNVs+ox-LDL group(pre-treated with 40 mg/L CDNVs for 1 hour followed by co-culture with 100 mg/L ox-LDL for 24 hours).Cell proliferation and apoptosis were assessed by the EdU incorporation assay and flow cytometry,respectively.Changes in signal-induced proliferation-associ-ated 1-like protein 2(SIPA1L2)mRNA expression were measured by RT-qPCR,and the expression levels of autophagy-related proteins and SIPA1L2 were evaluated by Western blot.SIPA1L2 ubiquitination was evaluated by immunoprecipita-tion assay.RESULTS:(1)CDNVs were successfully isolated and purified,characterized as nanoscale vesicles with a circular shape and a double-layered membrane structure.(2)CDNVs promoted the proliferation and inhibited apoptosis of ox-LDL-treated HUVECs(P＜0.05).(3)CDNVs suppressed the prorein expression of SIPA1L2 and promoted autophagy in ox-LDL-treated HUVECs(P＜0.05).(4)CDNVs facilitated the ubiquitination of SIPA1L2 protein,and reduced its protein level through the ubiquitin-proteasome pathway(P＜0.05).CONCLUSION:CDNVs exert a protective effect against ox-LDL-induced endothelial cell injury by mediating SIPA1L2 ubiquitination and promoting endothelial cell au-tophagy.

Objective To explore the variable pressure matress and thermoplastic mold applied to cone beam CT-guided radiotherapy of abdominal and pelvic cancer in terms of translation error,rotation angle error and setup reproducibility of patients with different body mass indexes(BMIs),so as to provide references for the selection of body fixation mode.Methods Totally 70 patients with abdominal and pelvic tumors admitted to some hospital from April 2021 to March 2022 were retrospectively selected,and divided into a variable pressure mattress group and a thermoplastic mold group according to the fixation method,with 35 patients in each group.All the patients in the two groups underwent examinations with cone beam computed tomography(CBCT)at the first radiotherapy treatment and during the course of the treatment,and the image registration was carried out between validation images and planning images.The two groups were compared in terms of rotation angle error and thranlation error at the directoins of x axis(lateral directions),y axis(cranial-caudal)and z axis(ventral-dorsal).Taking the center point image of the initial positioning as the reference,the errors of the center points of the two groups at z and y axes(Δz and Δy)were compared.The setup reproducibility was set as Δz≤5 mm and Δy≤3 mm,and the setup reproducibility rates of the two groups were summarized.All the patients were categorized into non-overweight ones(BMI<25 kg/m2)and overweight ones(BMI≥25 kg/m2),and the setup reproducibility rates of the patients with different BMIs were counted.SPSS 26.0 software was used for statistical analysis.Results The two groups had no significant differences in translation error at the directions of x and y axes(P>0.05).The variable pressure mattress group had the translation error at the direction of z axis statistically lower than that of the thermoplastic mold group(P<0.05).There were no significant differences between the two groups in rotation angle error(P=0.219 3).The two groups had significant differences in setup reproducibility(P=0.033 4).The non-overweight patients had the setup reproducibility rate being 40.00%in the variable pressure mattress group,and 77.14%in the thermoplastic mold group;the overweight patients had the setup reproducibility rate being 25.71%in the variable pressure mattress group and only 2.86%in the thermoplastic mold group,with the differences between the two groups being statistically significant(P=0.002 9).Conclusion The variable pressure mattress and thermoplastic mold both result in low setup errors when applied to fixation during the radiotherapy of abdominal and pelvic cancer,the thermoplastic mold fixation can be used for the patients with BMIs lower than 25 kg/m2 with decreased translation errors at the direction of z axis,and the variable pressure mattress fixation was suitable for the patients with BMIs not lower than 25 kg/m2.[Chinese Medical Equipment Journal,2025,46(7):45-50]

The aim of this study is to explore a new path of empowering ideological and political educa-tion in courses with digital intelligence technology,therefore to improve the teaching quality of biology courses in universities,promote the comprehensive implementation of the fundamental task of cultivating morality and talents,and continuously improve the level of"three pronged education".By using the biol-ogy course"Immunology"as a practical carrier,we have constructed a dual-driven framework of"ideo-logical and political guidance+digital intelligence empowerment"utilizing digital tools to further highlight pedagogical feature enhancement,curricular optimization,innovative teaching models,multidimensional assessment,and enhanced teaching refinement.The empowerment of digital intelligence in the ideological and political construction of the course"Immunology"has achieved notable progress.Students' profes-sional abilities and ideological and political literacy have significantly improved,and the proportion of students with excellent grades has been increasing year by year(81.93％of students with good grades or above in 2024),demonstrating outstanding performance in various social practice activities;The course exhibits excellent demonstration and radiation effects on campus,and the teaching results have been sup-ported by the Ministry of Education and provincial-level education reform projects.This study serves as a practical example for the digital transformation of ideological and political education in higher education courses,providing reference and innovative insights for implementing ideological and political elements in other courses of biology majors.

Objective:To investigate the incidence of shoulder work-related musculoskeletal disorders (WMSDs) among occupational population in China, and to explore their intrinsic association with personal and work-related factors.Methods:In April 2024, 73497 valid questionnaires of the Chinese version of the Musculoskeletal Disorders Electronic Questionnaire were retrospectively analyzed from June 2018 to December 2023 in 22 provinces and 29 key industries in China, and the general information, occurrence of WMSDs and related risk factors of key occupational populations in different regions in China were collected. By using Chi-square test and confirmatory factor analysis, the relationship between shoulder fatigue and pain in key occupational groups and individual factors, work type, work posture and work organization was discussed, and the internal relationship was analyzed based on structural equation model.Results:Higher incidence of shoulder fatigue and pain were associated with female, lack of physical exercise, uncomfortable working posture and neck leaning forward ( P<0.05). Structural equation model analysis showed that work type, work posture and work organization were strongly correlated ( r=0.58, 0.55). Work organization and work type were strongly correlated with shoulder fatigue ( r=0.65) and moderately correlated with shoulder fatigue ( r=0.21). Shoulder fatigue was moderately associated with shoulder pain ( r=0.40). Individual factors, work type, work posture and shoulder fatigue could directly affect shoulder pain ( OR=0.07, -0.09, 0.17 and 0.40), and work type and work posture could also indirectly affect shoulder pain through shoulder fatigue ( OR=0.08, 0.03). Work organization only indirectly affected shoulder pain through shoulder fatigue ( OR=0.26) . Conclusion:The main influencing factor of shoulder pain is shoulder fatigue, followed by work posture and individual factors. Structural equation model can better reflect the complex relationship between work type, work posture and work organization and shoulder WMSDs. Improving work posture and work organization may be an effective way to control the influence of shoulder fatigue on shoulder pain.