Cardiac fibrosis(CF) is a cardiac pathological process characterized by excessive deposition of extracellular matrix(ECM). When the heart is damaged by adverse stimuli, cardiac fibroblasts are activated and secrete a large amount of ECM, leading to changes in cardiac fibrosis, myocardial stiffness, and cardiac function declines and accelerating the development of heart failure. There is a close relationship between heart yin deficiency and cardiac fibrosis, which have similar pathogenic mechanisms. Heart Yin deficiency, characterized by insufficient Yin fluids, causes the heart to lose its nourishing function, which acts as the initiating factor for myocardial dystrophy. The deficiency of body fluids leads to stagnation of blood flow, resulting in blood stasis and water retention. Blood stasis and water retention accumulate in the heart, which aligns with the pathological manifestation of excessive deposition of ECM, as a tangible pathogenic factor. This is an inevitable stage of the disease process. The lingering of blood stasis combined with water retention eventually leads to the generation of heat and toxins, triggering inflammatory responses similar to heat toxins, which continuously stimulate the heart and cause the ultimate outcome of CF. Considering the syndrome of heart Yin deficiency, traditional Chinese medicine capable of nourishing Yin, activating blood, and promoting urination can reduce myocardial cell apoptosis, inhibit fibroblast activation, and lower the inflammation level, showing significant advantages in combating CF.
Humans ; Fibrosis/drug therapy* ; Animals ; Yin Deficiency/metabolism* ; Myocardium/metabolism* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

OBJECTIVE: Patients with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection frequently develop central nervous system damage, yet the mechanisms driving this pathology remain unclear. This study investigated the primary pathways and key factors underlying brain tissue damage induced by the SARS-CoV-2 beta variant (lineage B.1.351). METHODS: K18-hACE2 and C57BL/6 mice were intranasally infected with the SARS-CoV-2 beta variant. Viral replication, pathological phenotypes, and brain transcriptomes were analyzed. Gene Ontology (GO) analysis was performed to identify altered pathways. Expression changes of host genes were verified using reverse transcription-quantitative polymerase chain reaction and Western blot. RESULTS: Pathological alterations were observed in the lungs of both mouse strains. However, only K18-hACE2 mice exhibited elevated viral RNA loads and infectious titers in the brain at 3 days post-infection, accompanied by neuropathological injury and weight loss. GO analysis of infected K18-hACE2 brain tissue revealed significant dysregulation of genes associated with innate immunity and antiviral defense responses, including type I interferons, pro-inflammatory cytokines, Toll-like receptor signaling components, and interferon-stimulated genes. Neuroinflammation was evident, alongside activation of apoptotic and pyroptotic pathways. Furthermore, altered neural cell marker expression suggested viral-induced neuroglial activation, resulting in caspase 4 and lipocalin 2 release and disruption of neuronal molecular networks. CONCLUSION These findings elucidate mechanisms of neuropathogenicity associated with the SARS-CoV-2 beta variant and highlight therapeutic targets to mitigate COVID-19-related neurological dysfunction.
Animals ; COVID-19/genetics* ; Mice ; Brain/metabolism* ; Apoptosis ; Mice, Inbred C57BL ; SARS-CoV-2/physiology* ; Pyroptosis ; Gene Expression Profiling ; Transcriptome ; Male ; Female

Objective To investigate the impacts of epidural anesthesia with ropivacaine combined with dezocine on lower limb motor nerve block and maternal and infant outcomes in primipara undergoing painless delivery.Methods A total of 159 primiparas who delivered in Nanjing Jiangbei Hospital were selected as the research objects,and divided into the blank group(53 cases),the ropivacaine group(53 cases)and the combined group(53 cases)by the random number table method.Parturients in the blank group were given natural delivery mode,parturients in the ropivacaine group were given ropivacaine epidural anesthesia,and parturients in the combined group were given dezocine anesthesia on the basis of ropivacaine.Analgesic effect at different time points,time of the first,second and third stage of labor,pressing times of analgesic pump,lower limbs motor nerve block,maternal and infant outcomes,and adverse reactions of parturients were compared among the three groups.Results At 10 minutes after analgesia,60 minutes after analgesia,when the cervix was fully dilated and when the fetus was delivered,the VAS scores of the parturients in the ropivacaine group and the combined group were lower than those in the blank group(P<0.05),and the VAS scores of the parturients in the combined group were significantly lower than those in the ropivacaine group(P<0.05).There was no significant difference in the time of the first,second or third stage of labor of parturients among the three groups(P>0.05);The pressing times of analgesic pump of parturients in the combined group was significantly less than that in the ropivacaine group(P<0.05).There was no statistically significant difference in terms of low limb motor nerve block after painless labor of parturients among the three groups(P>0.05).There were no statistically significant differences in the perineal incision rate or the Apgar scores of newborns at 1 minute and 5 minutes after birth among the three groups(P>0.05).The usage rate of forceps and the rate of conversion to cesarean section in the combined group were significantly lower than those in the ropivacaine group and the blank group(P<0.05).There was no statistically significant difference in the incidence of total adverse reactions among the blank group,the ropivacaine group and the combined group(P>0.05).Conclusion The combination of ropivacaine and dezocine for epidural anesthesia has a better analgesic effect on primiparas with painless delivery,has a smaller impact on lower limb motor nerve block in parturients,and can achieve better maternal and infant outcomes.

Objective To investigate the impacts of epidural anesthesia with ropivacaine combined with dezocine on lower limb motor nerve block and maternal and infant outcomes in primipara undergoing painless delivery.Methods A total of 159 primiparas who delivered in Nanjing Jiangbei Hospital were selected as the research objects,and divided into the blank group(53 cases),the ropivacaine group(53 cases)and the combined group(53 cases)by the random number table method.Parturients in the blank group were given natural delivery mode,parturients in the ropivacaine group were given ropivacaine epidural anesthesia,and parturients in the combined group were given dezocine anesthesia on the basis of ropivacaine.Analgesic effect at different time points,time of the first,second and third stage of labor,pressing times of analgesic pump,lower limbs motor nerve block,maternal and infant outcomes,and adverse reactions of parturients were compared among the three groups.Results At 10 minutes after analgesia,60 minutes after analgesia,when the cervix was fully dilated and when the fetus was delivered,the VAS scores of the parturients in the ropivacaine group and the combined group were lower than those in the blank group(P<0.05),and the VAS scores of the parturients in the combined group were significantly lower than those in the ropivacaine group(P<0.05).There was no significant difference in the time of the first,second or third stage of labor of parturients among the three groups(P>0.05);The pressing times of analgesic pump of parturients in the combined group was significantly less than that in the ropivacaine group(P<0.05).There was no statistically significant difference in terms of low limb motor nerve block after painless labor of parturients among the three groups(P>0.05).There were no statistically significant differences in the perineal incision rate or the Apgar scores of newborns at 1 minute and 5 minutes after birth among the three groups(P>0.05).The usage rate of forceps and the rate of conversion to cesarean section in the combined group were significantly lower than those in the ropivacaine group and the blank group(P<0.05).There was no statistically significant difference in the incidence of total adverse reactions among the blank group,the ropivacaine group and the combined group(P>0.05).Conclusion The combination of ropivacaine and dezocine for epidural anesthesia has a better analgesic effect on primiparas with painless delivery,has a smaller impact on lower limb motor nerve block in parturients,and can achieve better maternal and infant outcomes.

Objective To establish a stable,reliable,and clinically relevant porcine model of endotoxin-induced acute respiratory distress syndrome(ARDS).Methods Ten 8-month-old male Bama minipigs were deeply sedated,followed by invasive mechanical ventilation and electrocardiographic monitoring.Lipopolysaccharide(LPS)was intravenously pumped at 600 μg/(kg·h)for 3 hours,then maintained at 15 μg/(kg·h)thereafter.Dynamic monitoring was performed at five time points after LPS injection(LPS 0,1,3,5,and 8 h),including arterial blood gas analysis and chest computed tomography(CT)scans.Pathological examination of lung tissues obtained via bronchoscopic biopsy(HE staining and transmission electron microscopy)was conducted.These indicators were comprehensively used to evaluate the success of the animal model.Results At 5 hours after LPS administration,8 minipigs developed symptoms such as skin cyanosis,elevated body temperature,and respiratory distress.The oxygenation index decreased to<300 mmHg.Chest CT scans showed diffuse pulmonary infiltrates.Histopathology revealed alveolar edema and hyaline membrane formation.Transmission electron microscopy demonstrated disruption of pulmonary blood-air barrier,depletion of lamellar bodies in type Ⅱ pneumocytes,inflammatory cell infiltration,and exudation of plasma proteins and fibrin.Compared with LPS 0 h,at LPS 8 h,the oxygenation index and arterial blood pH were significantly decreased(P<0.001),while blood lactic acid and serum potassium were significantly increased(P<0.05);serum calcium and base excess were significantly decreased(P<0.05),and the lung injury score based on HE-stained lung sections was significantly increased(P<0.01).Conclusion The porcine ARDS model established by continuous LPS injection can dynamically simulate the pathophysiological characteristics and typical pathological manifestations of clinical septic ARDS,making it an effective tool to study the pathogenesis,prevention,and treatment strategies of septic ARDS.

Excessive fat accumulation,viral infections and sustained inflammatory responses caused by non-alcoholic and alcoholic factors can contribute to liver inflammation,fibrosis and carcinogenesis,promoting the development of chronic liver disease.Gaining an in-depth understanding of the etiologic factors and underlying mechanisms that lead to chronic liver disease can help identify potential therapeutic targets for targeted therapy.Lactate,as an important substance in hepatic metabolism,has been found to be involved in the process of chronic liver disease through various pathways,and this review will provide a useful reference for the prevention and treatment of chronic liver disease.

This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.