BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

With the rapid development of generative artificial intelligence(GAI)technologies,their widespread application in academic research and writing is continuously expanding the boundaries of sci-entific inquiry.However,this trend has also raised a series of ethical and regulatory challenges,inclu-ding issues related to authorship,content authenticity,citation accuracy,and accountability.In light of the growing involvement of AI in generating academic content,establishing an open,controllable,and trustworthy ethical governance framework has become a key task for safeguarding research integrity and maintaining trust within the academic community.This expert consensus outlines ethical requirements across key stages of AI-assisted academic writing-including topic selection,data management,citation practices,and authorship attribution.It aims to clarify the boundaries and ethical obligations surrounding AI use in academic writing,ensuring that technological tools enhance efficiency without compromising in-tegrity.The goal is to provide guidance and institutional support for building a responsible and sustainable research ecosystem.

Objective To observe the clinical effect of Zuogui Pill combined with western medi-cine in treatment of gestational diabetes mellitus(GDM)with qi and yin deficiency syndrome.Meth-ods A total of 92 GDM patients with qi and yin deficiency syndrome from the Second Affiliated Hos-pital of Guizhou University of Traditional Chinese Medicine between January 2022 and October 2023 were enrolled and randomly divided into study group and control group,with 46 patients in each group.The control group received western medicine treatment,while the study group received Zuogui Pill combined with western medicine treatment.Both groups were treated for 4 weeks.The treatment effects,as well as the levels of glycolipid indicators[total cholesterol(TC),triglyceride(TG),fast-ing plasma glucose(FPG),low-density lipoprotein cholesterol(LDL-C),high-density lipoprotein cholesterol(HDL-C),and glycated hemoglobin(HbA1c)],insulin resistance indicators[fasting in-sulin(FINS),homeostasis model assessment of β-cell function(HOMA-β),and homeostasis model assessment of insulin resistance(HOMA-IR)],inflammatory and stress factors[serum amyloid A(SAA),interleukin-6(IL-6),malondialdehyde(MDA),and reactive oxygen species(ROS)],serum microRNA(miR)-21 and miR-149 levels,and occurrence of adverse pregnancy outcomes were compared be-tween the two groups before and after treatment.Results After 4 weeks of treatment,the total ef-fective rate was higher in the study group than that in the control group(P＜0.05).After treat-ment,the levels of FPG,HbA1c,TC,LDL-C,and TG were lower,and the levels of HDL-C were higher in both groups than before treatment,and the levels of FPG,HbA1c,TC,LDL-C in the study group were lower than those in the control group,and the level of HDL-C was higher in the study group than that in the control group(P＜0.05).After treatment,the levels of FINS and HOMA-IR were lower in both groups than before treatment,and their levels in the study group were lower than those in the control group;the levels of HOMA-β were higher in both groups than before treatment,and its level in the study group was higher than that in the control group(P＜0.05).After treat-ment,the levels of SAA,IL-6,MDA,and ROS were lower in both groups than before treatment,and their levels in the study group were lower than those in the control group(P＜0.05).Before treatment,there were no statistically significant differences in the levels of serum miR-21 and miR-149 between the two groups(P＞0.05);after treatment,the levels of serum miR-21 and miR-149 were lower in both groups than before treatment,and their levels in the study group were lower than those in the control group(P＜0.05).Before treatment,the traditional Chinese medicine syndrome score was(8.12±1.31)in the study group and(7.86±1.28)in the control group,with no statisti-cally significant difference between the two groups(P＞0.05);after treatment,the traditional Chi-nese medicine syndrome score was(3.31±0.46)in the study group,which was lower than(4.57±0.59)in the control group(t=11.423,P＜0.05).Compared with the control group,the incidence of adverse pregnancy outcomes was lower in the study group(P＜0.05).Conclusion Zuogui Pill combined with western medicine can effectively improve glycolipid metabolism and insulin resistance in GDM patients and reduce the incidence of adverse pregnancy outcomes.

Radiation-induced thrombocytopenia(RIT)faces a perplexing challenge in the clinical treatment of cancer patients,and current therapeutic approaches are inadequate in the clinical settings.In this research,oxy-matrine,a new molecule capable of healing RIT was screened out,and the underlying regulatory mecha-nism associated with magakaryocyte(MK)differentiation and thrombopoiesis was demonstrated.The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro.The ability to induce thrombopoiesis was subsequently demonstrated in Tg(cd41:enhanced green fluorescent protein(eGFP))zebrafish and RIT model mice.In addition,we carried out network pharmacological pre-diction,drug affinity responsive target stability assay(DARTS)and cellular thermal shift assay(CETSA)analyses to explore the potential targets of oxymatrine.Moreover,the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes(KEGG)enrichment analyses,Western blot(WB),and immunofluorescence.Oxymatrine markedly promoted MK differentiation and maturation in vitro.Moreover,oxymatrine induced thrombopoiesis in Tg(cd41:eGFP)zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice.Mechanistically,oxymatrine directly binds to toll-like receptor 2(TLR2)and further regulates the downstream pathway stimulator of interferon genes(STING)/nuclear factor-kappaB(NF-κB),which can be blocked by C29 and C-176,which are specific inhibitors of TLR2 and STING,respectively.Taken together,we demonstrated that oxymatrine,a novel TLR2 agonist,plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis,suggesting that oxymatrine is a promising candidate for RIT therapy.

Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.

Objective To investigate the correlation of corneal α angle and κ angle with lens tilt in normal human eyes using a new swept-source optical biometer.Methods A cross-sectional study was conducted,involving 303 healthy eyes(148 right eyes and 155 left eyes)of patients who visited the First Affiliated Hospital of Kunming Medical University from June to August 2024.ZW-30 swept-source optical biometer was used to collect the lens tilt angle,κ angle(distance from the corneal light reflex to the pupil center),and α angle(distance from corneal light reflex to the corneal geometric center,which is the midpoint of the horizontal white to white(WTW)diameter).The degrees(°)and directions of κ angle and α angle were calculated by the ratio of the above measurements to the anterior chamber depth(ACD)respectively.Spearman correlation analysis and linear regression analysis were employed to evaluate the correlations between the magnitude and direction of corneal α angle,κ angle and lens tilt angle.Results The magnitude and direction of corneal α angle,κ angle,and lens tilt angle in the right eye were as follows respectively:(0.54±0.19)mm(7.81°±3.88°),194.43°±39.75°;(0.27±0.23)mm(4.72°±3.90°),181.07°±79.59°;5.52°±1.67°,188.21°±25.73°.For the left eye,the corresponding values were:(0.47±0.27)mm(8.12°±5.26°),336.04°±46.64°;(0.26±0.27)mm(4.45°±4.80°),322.86°±107.79°;5.50°±1.61°,340.65°±32.84°.Spearman's correlation analysis showed that the correlation coefficients between corneal α angle and lens tilt angle in the right eye were 0.609(distance correlation)and 0.625(angle correlation),while those for κ angle were 0.559(distance correlation)and 0.578(angle correlation).In the left eye,the correlation coefficients between corneal α angle and lens tilt angle were 0.545(distance correlation)and 0.552(angle correlation),and those for κ angle were 0.377(distance correlation)and 0.395(angle correlation).In addition,the correlation coefficient between the direction of corneal α angle and the direction of lens tilt angle in the right eye was 0.343,and that for κ angle direction was 0.284;in the left eye,the correlation coefficients were 0.216(α angle direction)and 0.198(κ angle direction),all with statistical significance(P<0.05).Univariate linear regression analysis showed that lens tilt was positively correlated with both corneal α angle and Kappa angle(P<0.05).Conclusions Corneal α angle and κ angle are highly correlated with lens tilt angle in both eyes,and the correlation of corneal α angle is stronger than that of κ angle in both left and right eyes.The correlation expressed by degree(°)is better than that by distance(mm).It is recommended to refer to the corneal α angle and κ angle expressed in degrees during preoperative evaluation.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*