Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

The quality of medical insurance settlement lists directly affects the accuracy and rationality of medical insurance payments. This study analyzed the quality problems existing in L City′s 2023 medical insurance settlement list from three dimensions: integrity, standardization and rationality, and introduced a series of medical insurance settlement list quality management measures implemented with a problem-oriented approach. City L has effectively improved the overall quality of medical insurance settlement list by compiling local medical insurance settlement list filling standards, building a closed-loop model for quality control management of medical insurance settlement lists, establishing a quality grading management system for medical insurance settlement lists, and incorporating the quality of medical insurance settlement lists into performance appraisal and agreement management. The proportion of medical insurance settlement lists with quality problems in the city decreased from 8.12% (87 500 out of 1 077 300) in 2023 to 1.80% (20 700 out of 1 152 000) in 2024. The number of problems related to integrity, standardization, and rationality decreased from 39 900, 129 300, and 105 300 to 12 600, 14 800, and 24 800, respectively. These findings could provide a reference for medical insurance settlement list quality management in other regions.

Radiation-induced thrombocytopenia(RIT)faces a perplexing challenge in the clinical treatment of cancer patients,and current therapeutic approaches are inadequate in the clinical settings.In this research,oxy-matrine,a new molecule capable of healing RIT was screened out,and the underlying regulatory mecha-nism associated with magakaryocyte(MK)differentiation and thrombopoiesis was demonstrated.The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro.The ability to induce thrombopoiesis was subsequently demonstrated in Tg(cd41:enhanced green fluorescent protein(eGFP))zebrafish and RIT model mice.In addition,we carried out network pharmacological pre-diction,drug affinity responsive target stability assay(DARTS)and cellular thermal shift assay(CETSA)analyses to explore the potential targets of oxymatrine.Moreover,the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes(KEGG)enrichment analyses,Western blot(WB),and immunofluorescence.Oxymatrine markedly promoted MK differentiation and maturation in vitro.Moreover,oxymatrine induced thrombopoiesis in Tg(cd41:eGFP)zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice.Mechanistically,oxymatrine directly binds to toll-like receptor 2(TLR2)and further regulates the downstream pathway stimulator of interferon genes(STING)/nuclear factor-kappaB(NF-κB),which can be blocked by C29 and C-176,which are specific inhibitors of TLR2 and STING,respectively.Taken together,we demonstrated that oxymatrine,a novel TLR2 agonist,plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis,suggesting that oxymatrine is a promising candidate for RIT therapy.

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

Objective:To investigate protective mechanism of resveratrol(RES)on brain injury after ischemic stroke(IS)and its regulatory mechanism on nico-tinamide adenine dinucleotide phosphate oxidase 2(NOX2)mediated polarization of microglia.Methods:Low and high doses of RES were used for intervention.Tetrabromocinnamic acid(TBCA),a specific agonist of NOX2,was used to save function.PC12 and LMAI Bio cell models with oxygen-glucose deprivation/reoxygenation(OGD/R)were constructed.TUNEL was used to detect apoptosis of PC12 cells.Immunofluorescence was used to detect polarization of LMAI Bio cells.Western blot was used to detect expressions of NOX2,NF-κB,TNF-α,IL-1β,IL-10 and TGF-β in PC12 and LMAI Bio cells.Results:RES could significantly inhibit apoptosis of PC12 cells induced by OGD/R,and regulate LMAI Bio cells polarization to M2 type.Western blot showed that RES could significantly down-regulate NOX2,NF-κB,TNF-α and IL-1β expressions in OGD/R cells,up-regulate IL-10 and TGF-β expressions,while TBCA could partially reverse protective effect of RES on neurons.Conclusion:RES can inhibit neuronal apoptosis after IS,which may be related to its regulation of NOX2-mediated polarization of microglia.

Purpose To explore the effect of Calumenin(CALU)on migration and invasion ability of gastric cancer cells,as well as epithelial-mesenchymal transition(EMT).Methods The immunohistochemical experiments and Western blot were applied to evaluate the protein level of CALU in gastric cancer.After constructing a gastric canc-er cell line with low expression of CALU,CCK8 assay,wound-healing analysis and Transwell migration and invasion assays were performed to determine cell proliferation,Migration and invasion ability.Western blot was performed to an-alyse the effect of CALU knockdown on EMT molecules.Results CALU expression was significantly higher in gastric cancer tissues compared to normal gastric tissues(P＜0.05),and high CALU expression was significantly associated with TNM stage and lymph node metastasis(P＜0.05).Compared with GES-1 cells,the protein expression of CALU upregulated in gastric cancer cells(P＜0.05).CALU knockdown suppressed the proliferation,migration,invasion of BGC823 cells and SGC7901 cells(P＜0.05).Rescue experimental evidence showed that synonymous mutations of CALU could reverse the inhibitory effect of CALU knockdown on the proliferation,migration,and invasion ability of gastric cancer cells(P＜0.05).Knockdown of CALU resulted in the downregulation of vimentin and Snail expression,while E-cadherin and β-catenin expression were upregulated in human gastric cancer cells(P＜0.05).Conclusion CALU knockdown inhibits the proliferation,migration,invasion,and EMT of human gastric cancer cells.