"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Objective To investigate the effects of Simo decoction on duodenal microinflammation and NOD-like receptor thermal protein domain associated protein 3(NLRP3)/cysteinyl aspartate-specific proteinase-1(Caspase-1)/gasdermin D(GSDMD)signaling pathway in rats with functional dyspepsia(FD).Methods The FD model was established by multifactorial method.SD rats were randomly divided into normal group,model group(FD model),positive control group(gavage administration of 0.305 mg·kg-1 mosapride injection)and experimental-H,-M,-L groups(gavage administration of 5.62,2.81,1.40 g·kg-1 Simo decoction).Small intestinal advancement rate and gastric emptying rate was determined;the levels of interleukin(IL)-1 β and IL-18 in serum were determined by enzyme linked immunosorbent assay(ELISA);the protein expression of NLRP3 and GSDMD in duodenal tissue was detected by Western blotting.Results The gastric emptying rates of normal,model,positive control and experimental-H,-M,-Lgroupswere(58.34±5.72)％,(29.16±8.37)％,(48.77±6.10)％,(48.35±6.04)％,(48.20±3.49)％and(39.24±4.20)％;the small intestinal propulsion rates were(82.01±7.55)％,(41.95±9.53)％,(64.61±10.18)％,(75.04±9.76)％,(60.58±7.13)％and(45.89±7.40)％;serum IL-1 β expression were(12.86±0.88),(43.73±4.60),(18.84±0.86),(24.61±1.57),(19.14±0.77)and(29.04±0.72)pg·mL-1;IL-18 expressions were(95.00±3.74),(170.60±8.78),(108.50±3.05),(118.90±3.45),(99.90±8.70)and(141.00±3.71)pg·mL-1;the relative expression levels of NLRP3 proteins were 0.32±0.02,0.84±0.05,0.42±0.03,0.48±0.02,0.61±0.04 and 0.62±0.05;the relative expression levels of GSDMD proteins were 0.34±0.05,0.93±0.06,0.35±0.03,0.52±0.02,0.53±0.06 and 0.55±0.05,respectively.Compared with the normal group,the above indexes in the model group have statistical significance;compared with the model group,the above indexes in the experimental-H group and the positive control group also have statistical significance(P＜0.01 or P＜0.05).Conclusion Simo decoction can effectively improve the general condition and duodenal microinflammation in FD rats,and the mechanism may be related to the inhibition of duodenal NLRP3/Caspase-1/GSDMD signaling pathway.

Objective To study the clinical efficacy and safety of dapagliflozin combined with sacubitril-valsartan in the treatment of heart failure with preserved ejection fraction (HFpEF).Methods A total of 128 patients with HFpEF hospitalized in the cardiovascular medicine department of this hospital from March to December 2022 were selected as the study subjects and divided into the observation group and control group by the random number table method,64 cases in each group.The control group was given the conventional an-ti-heart failure therapy and orally took sacubitril-valsartan,and the observation group took the combined ap-plication of dapagliflozin on the basis of the control group.The continuous treatment lasted for 12 months. The left ventricular end diastolic diameter (LVEDd) and left ventricular ejection fraction (LVEF) were com-pleted by the cardiac color Doppler ultrasound determination in 3,6,12 months after treatment,the blood was collected for detecting NT-poBNP and 6 min walking distance (6MWD) determination was completed.The outpatient follow up was conducted monthly,the follow up contents contained the adverse reactions and major adverse cardio vascular event (MACE) events.Results After 3-month treatment,the NT-proBNP level in the two groups was decreased compared with before treatment,moreover the observation group was lower than the control group,and the differences were statistically significant (P<0.05).Compared with before treat-ment,LVEDd after 3-month treatment in the two groups was decreased compared with before treatment,LVEF was increased compared with before treatment,and the differences were statistically significant (P<0.05).LVEDd after 6-,12-month treatment in the observation group was lower than that in the control group,LVEF was higher than that in the control group,and the differences were statistically significant (P<0.05).6MWD after 3-month treatment in the two groups was increased compared with before treatment,and the difference was statistically significant (P<0.05).6MWD after 6-,12-month treatment in the observation group was higher than that in the control group,and the difference was statistically significant (P<0.05). The re-admission rate due to heart failure and MACE total occurrence rate in the observation group were low-er than those in the control group (9.38％ vs. 23.44％,12.50％ vs. 26.50％,P<0.05),and the adverse re-actions occurrence rates had no statistical difference between the two groups (P>0.05).Conclusion Dapagliflozin combined with sacubitril-valsartan could significantly improve the cardiac function in elderly patients with HFpEF,reduce the occurrence rate of MACE,moreover has good safety.

Objective To investigate the effect of long noncoding RNA nuclear paraspeckle assembly transcript 1(lncRNA NEAT1)on autophagy in membranous nephropathy(MN)and its mechanism.Methods HK-2 cells were induced by albumin to construct MN model in vitro.HK-2 cells were divided into 5 groups:control group,model group,LY294002(PI3K inhibitor)group,OV-NEAT1(NEAT1 overexpression)group and OV-NEAT1+LY294002 group.Cell proliferation was detected by CCK-8.Cell apoptosis was detected by flow cytometry.Expressions of autophagy and PI3K/Akt/mTOR pathway-related mRNA and protein were detected by qRT-PCR and Western blotting.Results Compared with control group,the cell proliferation ability,LC3-Ⅱ and Beclin 1 mRNA levels as well as LC3-Ⅱ/Ⅰ and Beclin 1 protein expression levels in the model group were signifi-cantly decreased(all P＜0.01).The apoptosis rate,LC3-Ⅰ,PI3K,Akt,mTOR mRNA and p-PI3K,p-Akt,p-mTOR protein ex-pression levels were significantly increased(all P＜0.01).Compared with model group,the cell proliferation ability,LC3-Ⅱ and Beclin 1 mRNA and LC3-Ⅱ/Ⅰ and Beclin 1 protein expression levels in OV-NEAT1 group were significantly decreased(all P＜0.05).The apoptosis rate,LC3-Ⅰ,PI3K,Akt,mTOR mRNA and p-PI3K,p-Akt,p-mTOR protein expression levels were sig-nificantly increased(all P＜0.01).LY294002 group witnessed the opposite trend.Compared with LY294002 group,cell prolifer-ation ability,LC3-Ⅱ and Beclin 1 mRNA and LC3-Ⅱ/Ⅰ and Beclin 1 protein expression levels in OV-NEAT1+LY294002 group were significantly decreased(all P＜0.05).The apoptosis rate,LC3-Ⅰ,PI3K,Akt,mTOR mRNA and p-PI3K,p-Akt,p-mTOR protein expression levels were significantly increased(all P＜0.05).Conclusion lncRNA NEAT1 can inhibit albumin-induced autophagy in HK-2 cells,and the mechanism may be related to the activation of PI3K/Akt/mTOR signaling pathway.

Objective:To screen interleukin(IL)-1β secretion-related membrane transporters by macrophage experiment in vitro and conventional knockout mice.Methods:THP-1 cell line was differentiated to obtain human THP-1-derived macrophages,and the primary macrophages were obtained from human peripheral blood.FVB wild-type mice with the same sex and age were used as the controls of MRP1 knockout mice.The macrophages in abdominal cavity and bone marrow of mice were cultivated.The cells were treated with ABCC1/MRP1,ABCG2/BCRP,ABCB1/P-gp,OATP1B1,and MATE transporter inhibitors,then stimulated by lipopolysaccharide and adenosine triphosphate.The secretion level of IL-iβ was detected by ELISA,Western blot,and immunofluorescence.Results:After inhibiting ABCC1/MRP1 transporter,the secretion of IL-1β decreased significantly,while inhibition of the other 4 transporters had no effect.In animal experiment,the level of IL-1 β secreted by macrophages in bone marrow of MRP1 knockout mice was significantly lower than control group(P＜0.05).Conclusion:ABCC1/MRP1 transporter is a newly discovered IL-1β secretion pathway,which is expected to become a new target for solving clinical problems such as cytokine release syndrome.

As the search for effective treatments for COVID-19 continues, the high mortality rate among critically ill patients in Intensive Care Units (ICU) presents a profound challenge. This study explores the potential benefits of traditional Chinese medicine (TCM) as a supplementary treatment for severe COVID-19. A total of 110 critically ill COVID-19 patients at the Intensive Care Unit (ICU) of Vulcan Hill Hospital between Feb., 2020, and April, 2020 (Wuhan, China) participated in this observational study. All patients received standard supportive care protocols, with a subset of 81 also receiving TCM as an adjunct treatment. Clinical characteristics during the treatment period and the clinical outcome of each patient were closely monitored and analysed. Our findings indicated that the TCM group exhibited a significantly lower mortality rate compared with the non-TCM group (16 of 81 vs 24 of 29; 0.3 vs 2.3 person/month). In the adjusted Cox proportional hazards models, TCM treatment was associated with improved survival odds (P < 0.001). Furthermore, the analysis also revealed that TCM treatment could partially mitigate inflammatory responses, as evidenced by the reduced levels of proinflammatory cytokines, and contribute to the recovery of multiple organic functions, thereby potentially increasing the survival rate of critically ill COVID-19 patients.
Humans ; COVID-19 ; Medicine, Chinese Traditional ; SARS-CoV-2 ; Critical Illness ; Treatment Outcome