Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short in vivo circulation time, easy recognition, and clearance by the immune system in the body. In recent years, biomimetic nanoparticle delivery systems mediated by natural cell membranes have become a research hotspot to address these issues. The natural membrane biomimetic nanoparticle delivery system cleverly integrates the advantages of natural biofilm "autologous" and "artificial" functional carriers by using endogenous cell membranes to modify the surface of nanocarriers, endowing them with characteristics such as tumor targeting, low immunogenicity, and long blood circulation. Currently, biomimetic nanoparticle delivery systems have been used in the treatment of malignant tumors, cardiovascular diseases, bacterial infections, and other diseases. This paper analyzes the development status and current research hotspots of natural cell membrane camouflaged biomimetic nanoparticle delivery systems mainly reviews the latest research progress of red blood cell membrane camouflaged biomimetic nanoparticle delivery systems in the field of disease treatment in recent years. It focuses on exploring the advantages, future development prospects, and limitations of biomimetic nanoparticle delivery systems based on red blood cell membrane camouflage in improving drug delivery, to provide a reference for the in-depth research and development of this system.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

Objective To explore the effects of ropivacaine on cognitive dysfunction and synapses in aged rats after tibial fracture.Methods SD male rats were divided into sham operation group,model group and low,medium,high dose experimental groups.Sham operation group was incised and sutured under local anesthesia,and other four groups underwent open tibial fracture operation.Sham operation group and model group were given sevoflurane anesthesia,low,medium and high dose experimental groups were given 0.5,1.0,2.0 mg·kg-1 ropivacaine on the basis of sevoflurane anesthesia.Open field test and Morris water maze test were performed 7 days after operation;Longa score was evaluated;neurotransmitter levels were detected by kit;and Syn1 in hippocampus of rats was detected by immunohistochemistry.Western blot analysis was used to detected the expression of N-methyl-D-aspartate receptor 2B(NMDAR2B),calmodulin-dependent protein kinase Ⅱ(CaMK Ⅱ)and Syn1.Results The Longa scores of sham operation group,model group and low,medium,high dose experimental groups were 0,(3.50±0.71),(2.80±0.63),(2.20±0.63)and(0.90±0.32)points;the integrated optical density of Syn1 were 0.56±0.09,0.25±0.03,0.34±0.03,0.42±0.03 and 0.50±0.05;the expression of Syn1 protein were 1.08±0.12,0.42±0.05,0.55±0.07,0.72±0.06 and 0.86±0.05;the expression of NMDAR2B protein were 1.28±0.13,0.51±0.07,0.69±0.06,0.84±0.07 and 1.02±0.11;CaMK Ⅱ protein were 0.94±0.08,0.36±0.04,0.50±0.06,0.71±0.06 and 0.86±0.06.There were statistically significant differences between sham operation group and model group(P＜0.05);there were significant differences in the above indexes between model group and low,medium,high dose experimental groups(all P＜0.05).Conclusion Ropivacaine can improve cognitive dysfunction and synapses in aged rats after tibial fracture.

[Objective] To explore the value of the TyG index for predicting postoperative recurrence in persistent atrial fibrillation (AF) patients combined with on-alcoholic fatty liver disease (NAFLD) undergoing catheter ablation. [Methods] This study was a single-center, retrospective, cohort study. Clinical data of patients who underwent catheter ablation during hospitalization or outpatient visits at The First Affiliated Hospital of Xi’an Jiaotong University from January 2021 to December 2022 were retrospectively collected. The patients were divided into recurrence and non-recurrence groups based on whether AF recurred within 1 year after the procedure. General clinical data and relevant laboratory test results were collected, and the preoperative TyG index was calculated. The risk factors for AF recurrence after catheter ablation in these patients were analyzed using univariate and multivariate COX proportional hazards regression models. The value of the TyG index for predicting AF recurrence was assessed using receiver operating characteristic (ROC) curve analysis. [Results] We recruited 167 patients, among whom 103 were males and 64 were females. The mean follow-up time was 12±1.3 months, with 52 cases of AF recurrence and 115 ones of non-recurrence. Compared with the non-recurrence group, the TyG index was higher in the recurrence group (9.62±0.96 vs. 8.26±0.46, P<0.05). Multivariate COX regression analysis showed that the preoperative TyG index (HR=1.35, 95% CI: 1.10-1.60, P<0.05) and postoperative electrocardiogram P-wave dispersion (HR=1.51, 95% CI: 1.32-1.70, P<0.001) were risk factors for AF recurrence after catheter ablation in persistent AF patients with NAFLD. The ROC curve analysis showed that the area under the curve (AUC) for the TyG index in predicting AF recurrence after catheter ablation in these patients was 0.846 (95% CI: 0.773-0.919, P<0.001). [Conclusion] The TyG index is an effective indicator for predicting atrial fibrillation recurrence after catheter ablation in persistent AF patients combined with NAFLD.

Objective:To report the results of national surveillance on the distribution and antimicrobial resistance profile of clinical Gram-positive bacteria isolates from bloodstream infections in China in 2022.Methods:The clinical isolates of Gram-positive bacteria from blood cultures in member hospitals of National Bloodstream Infection Bacterial Resistant Investigation Collaborative System（BRICS）were collected during January 2022 to December 2022. Antibiotic susceptibility tests were conducted by agar dilution or broth dilution methods recommended by Clinical and Laboratory Standards Institute（CLSI）. WHONET 5.6 and SPSS 25.0 software were used to analyze the data.Results:A total of 3 163 strains of Gram-positive pathogens were collected from 51 member units，and the top five bacteria were Staphylococcus aureus（ n=1 147，36.3%），coagulase-negative Staphylococci（ n=928，29.3%）， Enterococcus faecalis（ n=369，11.7%）， Enterococcus faecium（ n=296，9.4%）and alpha-hemolyticus Streptococci（ n=192，6.1%）. The detection rates of methicillin-resistant Staphylococcus aureus（MRSA）and methicillin-resistant coagulase-negative Staphylococci（MRCNS）were 26.4%（303/1 147）and 66.7%（619/928），respectively. No glycopeptide and daptomycin-resistant Staphylococci were detected. The sensitivity rates of Staphylococcus aureus to cefpirome，rifampin，compound sulfamethoxazole，linezolid，minocycline and tigecycline were all >95.0%. Enterococcus faecium was more prevalent than Enterococcus faecalis. The resistance rates of Enterococcus faecium to vancomycin and teicoplanin were both 0.5%（2/369），and no vancomycin-resistant Enterococcus faecium was detected. The detection rate of MRSA in southern China was significantly lower than that in other regions（ χ2=14.578， P=0.002），while the detection rate of MRCNS in northern China was significantly higher than that in other regions（ χ2=15.195， P=0.002）. The detection rates of MRSA and MRCNS in provincial hospitals were higher than those in municipal hospitals（ χ2=13.519 and 12.136， P<0.001）. The detection rates of MRSA and MRCNS in economically more advanced regions（per capita GDP≥92 059 Yuan in 2022）were higher than those in economically less advanced regions（per capita GDP<92 059 Yuan）（ χ2=9.969 and 7.606， P=0.002和0.006）. Conclusions:Among the Gram-positive pathogens causing bloodstream infections in China， Staphylococci is the most common while the MRSA incidence decreases continuously with time；the detection rate of Enterococcus faecium exceeds that of Enterococcus faecalis. The overall prevalence of vancomycin-resistant Enterococci is still at a low level. The composition ratio of Gram-positive pathogens and resistant profiles varies slightly across regions of China，with the prevalence of MRSA and MRCNS being more pronounced in provincial hospitals and areas with a per capita GDP≥92 059 yuan.