1.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
2.Clinical Applications of Circulating Tumor DNA in Response Evaluation and Relapse Monitoring of Primary Mediastinal Large B-Cell Lymphoma.
Lu PAN ; Xin-Miao JIANG ; Yan TENG ; Ning WANG ; Ling HUANG ; Han-Guo GUO ; Si-Chu LIU ; Xiao-Juan WEI ; Fei-Li CHEN ; Zhan-Li LIANG ; Wen-Yu LI
Journal of Experimental Hematology 2025;33(2):407-415
OBJECTIVE:
To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL).
METHODS:
The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS).
RESULTS:
Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy.
CONCLUSION
CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans
;
Circulating Tumor DNA/blood*
;
Female
;
Mediastinal Neoplasms
;
Male
;
Retrospective Studies
;
High-Throughput Nucleotide Sequencing
;
Prognosis
;
Lymphoma, Large B-Cell, Diffuse/genetics*
;
Middle Aged
;
Adult
;
Aged
;
Neoplasm Recurrence, Local
;
Mutation
3.Erratum: Author Correction: Targeting of AUF1 to vascular endothelial cells as a novel anti-aging therapy.
Jian HE ; Ya-Feng JIANG ; Liu LIANG ; Du-Jin WANG ; Wen-Xin WEI ; Pan-Pan JI ; Yao-Chan HUANG ; Hui SONG ; Xiao-Ling LU ; Yong-Xiang ZHAO
Journal of Geriatric Cardiology 2025;22(9):834-834
[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].
4.Effectiveness of Xuanshen Yishen Decoction on Intensive Blood Pressure Control: Emulation of a Randomized Target Trial Using Real-World Data.
Xiao-Jie WANG ; Yuan-Long HU ; Jia-Ming HUAN ; Shi-Bing LIANG ; Lai-Yun XIN ; Feng JIANG ; Zhen HUA ; Zhen-Yuan WANG ; Ling-Hui KONG ; Qi-Biao WU ; Yun-Lun LI
Chinese journal of integrative medicine 2025;31(8):677-684
OBJECTIVE:
To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension.
METHODS:
Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate.
RESULTS:
The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse.
CONCLUSIONS
XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Antihypertensive Agents/pharmacology*
;
Blood Pressure/drug effects*
;
Drugs, Chinese Herbal/pharmacology*
;
Hypertension/physiopathology*
;
Patient Readmission
;
Treatment Outcome
5.A novel anti-ischemic stroke candidate drug AAPB with dual effects of neuroprotection and cerebral blood flow improvement.
Jianbing WU ; Duorui JI ; Weijie JIAO ; Jian JIA ; Jiayi ZHU ; Taijun HANG ; Xijing CHEN ; Yang DING ; Yuwen XU ; Xinglong CHANG ; Liang LI ; Qiu LIU ; Yumei CAO ; Yan ZHONG ; Xia SUN ; Qingming GUO ; Tuanjie WANG ; Zhenzhong WANG ; Ya LING ; Wei XIAO ; Zhangjian HUANG ; Yihua ZHANG
Acta Pharmaceutica Sinica B 2025;15(2):1070-1083
Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.
6.Comparison of the toxicity and safety of protein derivatives from novel fusion strains of Mycobacterium tuberculosis
Hao-qi XU ; Jiang-tao DONG ; Jie ZHANG ; Fang WU ; Su LIANG ; Xiao-ling LIU ; Lan-ru GAO ; Ju WANG ; Hui ZHANG ; Jiang-dong WU ; Le ZHANG ; Xi-ling DENG ; Wan-jiang ZHANG
Chinese Journal of Zoonoses 2025;41(4):376-384
The objective of this study was to evaluate the toxicity and safety of novel Mycobacterium tuberculosis fusion strain protein derivatives,referred to as B/R strain active proteins.In cellular experiments,RAW264.7 cells were treated with each vaccine preparation,and apoptosis rates were measured.In subsequent animal experiments,C57BL/6 mice were immunized via subcutaneous injection,and their survival and body weight changes were monitored and recorded at 2,4,8,12,and 16 weeks.The lungs and spleens were harvested to calculate organ coefficients,and pathological examinations were conducted.At the eighth week of immunization,the mice were infected with high concentrations of BCG,and pathological changes in the lungs and spleens were observed 4 weeks post-infection.The apoptosis rate at 6 hours was significantly higher in the experimental group than the PBS group(P<0.05).At 12 and 24 hours,the apoptosis rate in the experimental group remained higher than that in the PBS group,although this difference was not statistically significant.After immunization,mice in all four groups exhibited normal growth patterns,as indicated by stable body weight changes.At 4 and 12 weeks post-immunization,the lung coefficients in the protein group were significantly higher than those in the PBS group at the same time points.Additionally,the lung coefficients in the BCG group were significantly elevated across all time periods(P<0.05).The spleen coefficients in the protein and BCG groups were significantly higher than those in the PBS group at 2,4,8,12,and 16 weeks,whereas the ICD B/R group showed higher spleen coefficients than the PBS group only at week 8(P<0.05).Pathological examination revealed normal lung and spleen tissues in the PBS group.However,during the 2-8 weeks immunization period,lung and spleen tissues in all experimental groups exhibited varying degrees of damage,which gradually diminished by 12-16 weeks.Notably,no tuberculosis nodules were observed in any experimental group.After infection with high concentrations of BCG,no overt pathological changes were observed on the surfaces of the lungs and spleens in any group.Microscopic examination revealed less severe pathological changes in the lungs and spleens of mice in the experimental groups than the PBS group.Furthermore,no statistically significant differences were observed between the protein group and the BCG group.Our findings suggested that the B/R strain active proteins'toxicity and safety profiles were comparable to those of BCG,and showed immunoprotective effects.This study provides an experimental foundation for the development of a novel tuberculosis vaccine.
7.Present situation of sensors applied to monitoring of spinal morphology and motion
Shi-yu ZHOU ; Ya-qin LI ; Yang-xi HUANG ; Xiao CHEN ; Jing WANG ; Zhi-min LIANG ; Yu-chen GUO ; Xue YANG ; Ling-li LI
Chinese Medical Equipment Journal 2025;46(6):105-110
The application of sensors to the monitoring of spinal morphology and motion was reviewed in terms of the research object and monitoring index.The present situation of the application of sensors was introduced,such as inertial sensor,stretchable strain sensor and electromagnetic sensor.The deficiencies of sensors applied to the monitoring of spinal morphology and motion were analyzed,and the future directions of the application were pointed out.[Chinese Medical Equipment Journal,2025,46(6):105-110]
8.Progress in Basic Research on Acupuncture and Moxibustion Based on Non-coding RNA
Ying WEI ; Jian XIONG ; Xiao LI ; Jinqun HU ; Yi ZHAO ; Yuxin SUN ; Fayang LING ; Yu LIU ; Liyuan YANG ; Fanrong LIANG ; Wenchuan QI
Chinese Journal of Information on Traditional Chinese Medicine 2025;32(3):174-179
Acupuncture and moxibustion therapy is a kind of treatment and health care method with original advantages of China.With the rapid development of epigenetics and systems biology technology,non-coding RNA(ncRNA)related research has made continuous breakthroughs in the field of acupuncture and moxibustion.This article collected the basic research literature on acupuncture and moxibustion related to ncRNA,and reviewed the research subsystems related to microRNA(miRNA),long chain non coding RNA(lncRNA)and circular RNA(circRNA).NcRNAs are widely involved in the growth,development and reproduction of the organism,as well as in the occurrence and development of various diseases,which fits with the multi-layer,multi-pathway and multi-target action network of acupuncture and moxibustion therapy.Taking ncRNAs as the breakthrough point to explore the mechanism of acupuncture and moxibustion in depth is not only conducive to promoting the exploration of new targets of acupuncture and moxibustion effect,but also can reveal the epigenetic regulation axis of acupuncture and moxibustion effect molecules,and provide ideas and methods for clinical diagnosis and treatment of diseases and evaluation of efficacy.
9.Biomimetic nanoparticle delivery systems b ased on red blood cell membranes for disease treatment
Chen-xia GAO ; Yan-yu XIAO ; Yu-xue-yuan CHEN ; Xiao-liang REN ; Mei-ling CHEN
Acta Pharmaceutica Sinica 2025;60(2):348-358
Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short
10.Study on Colorimetric Sensor Array Based on Enzymatic Method for Highly Selective Detection of Sarin
Lian-Bo JIANG ; Guo-Hong LIU ; Zhuang-Hu XU ; Jian LI ; Yong-Ling SHEN ; Cai-Xia XU ; Chuan-Qin ZANG ; Yan-Hua XIAO ; Dan-Ping LI ; Ting LIANG
Chinese Journal of Analytical Chemistry 2025;53(5):832-841,中插21-中插23
Sarin(GB)is a typical representative of nerve agents with high toxicity,and very low amount can cause death.GB can cause water and atmospheric environment poisoning,so the detection of GB in water and air is of great significance.In this work,a colorimetric sensor array(CSA)based on GB inhibition of cholinesterase activity was constructed to detect GB with high selectivity.A 4×4 colorimetric array was constructed using acetylcholinesterase(AChE),butyryl cholinesterase(BuChE)and the corresponding substrate acetylthiocholine iodide(S-ACh),butyryl thiocholine iodide(S-BCh),acetylcholine chloride(ACh),butyryl choline chloride(BCh)and 2,6-dichloroindophenol ethyl ester(DCIE).The linear curve of the sensor was Y=131.3×lgC+271.6(R2=0.997),where Y was the array response Euclidean distance,C was the concentration of GB(mg/L),the linear range was 0.03?0.32 mg/L,and the detection limit was 27.6 μg/L.The method could effectively distinguish chemical warfare agents(CWA)such as VX,Soman(GD),mustard gas(HD),Louie reagent(L),and had high anti-interference ability,sensitivity and good repeatability.It was successfully applied to the detection of GB in simulated water and simulated air samples,and the sample recovery rate was 97.2% ?100.9%.This method would be potentially applied to the field rapid detection of nerve agents.

Result Analysis
Print
Save
E-mail