1.Clinical efficacy of open reduction and internal fixation with plates versus minimally invasive Kirschner wire fixation for osteoporotic Colles' fractures.
Jun-Wei ZHANG ; Jin-Yong HOU ; Zhao-Hui LI ; Zhen-Yuan MA ; Xiang GAO ; Hong-Zheng BI ; Ling-Ling CHEN ; Hai-Tao WANG ; Wei-Zhi NIE ; Yong-Zhong CHENG ; Xiao-Bing XI
China Journal of Orthopaedics and Traumatology 2025;38(1):18-24
OBJECTIVE:
To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients.
METHODS:
Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores.
RESULTS:
The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05).
CONCLUSION
Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans
;
Female
;
Male
;
Middle Aged
;
Aged
;
Fracture Fixation, Internal/instrumentation*
;
Bone Wires
;
Bone Plates
;
Retrospective Studies
;
Colles' Fracture/surgery*
;
Minimally Invasive Surgical Procedures/methods*
;
Open Fracture Reduction/methods*
;
Osteoporotic Fractures/surgery*
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.A practice guideline for therapeutic drug monitoring of mycophenolic acid for solid organ transplants.
Shuang LIU ; Hongsheng CHEN ; Zaiwei SONG ; Qi GUO ; Xianglin ZHANG ; Bingyi SHI ; Suodi ZHAI ; Lingli ZHANG ; Liyan MIAO ; Liyan CUI ; Xiao CHEN ; Yalin DONG ; Weihong GE ; Xiaofei HOU ; Ling JIANG ; Long LIU ; Lihong LIU ; Maobai LIU ; Tao LIN ; Xiaoyang LU ; Lulin MA ; Changxi WANG ; Jianyong WU ; Wei WANG ; Zhuo WANG ; Ting XU ; Wujun XUE ; Bikui ZHANG ; Guanren ZHAO ; Jun ZHANG ; Limei ZHAO ; Qingchun ZHAO ; Xiaojian ZHANG ; Yi ZHANG ; Yu ZHANG ; Rongsheng ZHAO
Journal of Zhejiang University. Science. B 2025;26(9):897-914
Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C0), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug-drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage*
;
Drug Monitoring/methods*
;
Humans
;
Organ Transplantation
;
Immunosuppressive Agents/administration & dosage*
;
Delphi Technique
4.Synaptic Vesicle Glycoprotein 2A Slows down Amyloidogenic Processing of Amyloid Precursor Protein via Regulating Its Intracellular Trafficking.
Qian ZHANG ; Xiao Ling WANG ; Yu Li HOU ; Jing Jing ZHANG ; Cong Cong LIU ; Xiao Min ZHANG ; Ya Qi WANG ; Yu Jian FAN ; Jun Ting LIU ; Jing LIU ; Qiao SONG ; Pei Chang WANG
Biomedical and Environmental Sciences 2025;38(5):607-624
OBJECTIVE:
To reveal the effects and potential mechanisms by which synaptic vesicle glycoprotein 2A (SV2A) influences the distribution of amyloid precursor protein (APP) in the trans-Golgi network (TGN), endolysosomal system, and cell membranes and to reveal the effects of SV2A on APP amyloid degradation.
METHODS:
Colocalization analysis of APP with specific tagged proteins in the TGN, ensolysosomal system, and cell membrane was performed to explore the effects of SV2A on the intracellular transport of APP. APP, β-site amyloid precursor protein cleaving enzyme 1 (BACE1) expressions, and APP cleavage products levels were investigated to observe the effects of SV2A on APP amyloidogenic processing.
RESULTS:
APP localization was reduced in the TGN, early endosomes, late endosomes, and lysosomes, whereas it was increased in the recycling endosomes and cell membrane of SV2A-overexpressed neurons. Moreover, Arl5b (ADP-ribosylation factor 5b), a protein responsible for transporting APP from the TGN to early endosomes, was upregulated by SV2A. SV2A overexpression also decreased APP transport from the cell membrane to early endosomes by downregulating APP endocytosis. In addition, products of APP amyloid degradation, including sAPPβ, Aβ 1-42, and Aβ 1-40, were decreased in SV2A-overexpressed cells.
CONCLUSION
These results demonstrated that SV2A promotes APP transport from the TGN to early endosomes by upregulating Arl5b and promoting APP transport from early endosomes to recycling endosomes-cell membrane pathway, which slows APP amyloid degradation.
Amyloid beta-Protein Precursor/genetics*
;
Membrane Glycoproteins/genetics*
;
Animals
;
Protein Transport
;
Nerve Tissue Proteins/genetics*
;
Humans
;
Mice
;
Endosomes/metabolism*
;
trans-Golgi Network/metabolism*
5.Regulatory Effect and Mechanism of Yichang Sanjie Granules on Intestinal Flora and Immune Function in Mice with Colon Cancer
Ai-Hua HOU ; Ling-Ling DAI ; Peng MENG ; Xiao-Ni ZHANG ; Song TAN ; Ze LIU ; Xiao-Hu ZHAO
Journal of Guangzhou University of Traditional Chinese Medicine 2024;41(3):719-728
Objective To observe the regulating effect and mechanism of Yichang Sanjie Granules on intestinal flora and immune function in mice with colon cancer.Methods Sixty mice were randomly divided into six groups,i.e.,the normal group,the model group,the low-,medium-and high-dose groups of Yichang Sanjie Granules,and the overexpression of melanoma absent gene 2(AIM2)plasmid(pcDNA-AIM2)intervention group,with 10 mice in each group.Colorectal cancer model was prepared by oxidized azomethine(AOM)/dextran sulfate sodium(DSS)induction method in all groups except normal group.After drug administration,the survival curves of mice in each group were plotted and the tumor volume was calculated;serum levels of immunoglobulin(Ig)G,IgM,interleukin(IL)-1β and IL-18 were detected by enzyme-linked immunosorbent assay(ELISA);peripheral blood levels of CD3+,CD4+,CD8+ T cells were detected by flow cytometry;the splenic index was determined;Hematoxylin-eosin(HE)staining was used to observe the pathological changes in colon tissues;16S-rDNA intestinal flora sequencing was used to detect the α-diversity of intestinal flora and the structure of intestinal flora communities;and protein immunoblotting(Wetsern Blot)was used to detect the protein expressions of AIM2,apoptosis-associated speckled-like protein containing a CARD(ASC),and cystatinase-1(caspase-1)in colon tissues.Results Compared with the normal group,the survival rate,serum levels of IgG and IgM,peripheral blood levels of CD3+ and CD4+ and CD4+/CD8+ ratio,protein expression levels of colon tissue AIM2,ASC and caspase-1 in the model group were significantly decreased,and the tumor volume,serum levels of IL-1β and IL-18,peripheral blood level of CD8+,and splenic index were significantly increased(all P<0.05),and the HE staining results showed the characteristic manifestations of colon cancer;compared with the model group,the survival rate,serum levels of IgG and IgM,peripheral blood levels of CD3+ and CD4+ and CD4+/CD8+ ratio,protein expression levels of colon tissue AIM2,ASC and caspase-1 in the low-,medium-and high-dose groups of Yichang Sanjie Granules and the pcDNA-AIM2 group were significantly increased,and the tumor volume,serum levels of IL-1β and IL-18,level of peripheral blood CD8+,and splenic index were significantly decreased(all P<0.05),and the HE staining results showed the manifestations of colon cancer were improved.Compared with the normal group,the Observed index,Chao1 index,Shannon index,the relative abundance of Bacteroidetes,Proteobacteria,Muribaculaceae,Lachnospiraceae-NK4A136group,and Ruminiclostridium in the model group were significantly decreased,while the relative abundance of Firmicutes,Actinobacteria,Patescibateria,Lactobacillus,Odoribacter,Alistipes,Ruminococcaceae-uncultured and Bacteroides was increased in the model group(P<0.05);compared with the model group,the Observed index,Chao1 index,Shannon index,the relative abundance of Bacteroidetes,Proteobacteria,Muribaculaceae,Lachnospiraceae-NK4A136group and Ruminiclostridium were significantly increased,and the relative abundance of Firmicutes,Actinobacteria,Patescibateria,Lactobacillus,Odoribacter,Alistipes,Ruminococcaceae-uncultured and Bacteroides was decreased in the low-,medium-and high-dose groups of Yichang Sanjie Granules and the pcDNA-AIM2 group(all P<0.05).Conclusion Yichang Sanjie Granules can increase autoimmunity and improve intestinal flora structure in mice with colon cancer,and its mechanism is related to the activation of AIM2 inflammatory vesicles.
6.Preliminary study on delaying aging induced thymus degeneration in SAMP6 mice with Bazi Bushen capsule
Zhao-Dong LI ; Yin-Xiao CHEN ; Bo-Yang GONG ; Zhe XU ; Zhi-Xian YU ; Yue-Xuan SHI ; Yan-Fei PENG ; Yu-Hong BIAN ; Yun-Long HOU ; Xiang-Ling WANG ; Shu-Wu ZHAO
Chinese Pharmacological Bulletin 2024;40(6):1186-1192
Aim To explore the improvement effect of Bazi Bushen capsule on thymic degeneration in SAMP6 mice and the possible mechanism.Methods Twenty 12 week old male SAMP6 mice were randomly divided into the model group(SAMP6)and the Bazi Busheng capsule treatment group(SAMP6+BZBS).Ten SAMR1 mice were assigned to a homologous control group(SAMR1).The SAMP6+BZBS group was oral-ly administered Bazi Bushen capsule suspension(2.8 g·kg-1)daily,while the other two groups were orally administered an equal amount of distilled water.After nine weeks of administration,the morphology of the thymus in each group was observed and the thymus in-dex was calculated;HE staining was used to observe the structural changes of thymus tissue;SA-β-gal stai-ning was used to detect thymic aging;flow cytometry was used to detect the proportion of thymic CD3+T cells in each group;Western blot was used to detect the levels of p16,Bax,Bcl-2,and cleaved caspase-3 proteins in thymus;immunofluorescence was applied to detect the proportion of cortical thymic epithelial cells in each group;ELISA was employed to detect IL-7 lev-els in thymus.Results Compared with the SAMP6 group,the thymic index of the SAMP6+BZBS group significantly increased(P<0.05);the disordered thy-mic structure was significantly improved;the positive proportion of SA-β-gal staining significantly decreased(P<0.01);the proportion of CD3+T cells apparently increased(P<0.05);the level of p16 protein signifi-cantly decreased(P<0.05);the level of Bcl-2 pro-tein significantly increased(P<0.05),while the lev-el of cleaved caspase-3 protein markedly decreased(P<0.05);the proportion of cortical thymic epithelial cells evidently increased;the level of IL-7 significantly increased(P<0.01).Conclusions Bazi Bushen capsule can delay thymic degeneration,inhibit cell ap-optosis in thymus and promote thymic cell development in SAMP6 mice,which may be related to increasing the proportion of cortical thymic epithelial cells and promoting IL-7 secretion.
7.Exploring the mechanism of IgA vasculitis pathogenesis through the interaction of thrombin and inflammatory factors using urinary proteomics
Meng-Meng LIU ; Gai-Ling HOU ; Xiao-Qing YANG ; Qiu-Shuang ZHANG ; Xiao-Feng MEI ; Ying DING ; Lan SONG ; Yan-Jie HUANG
Chinese Journal of Contemporary Pediatrics 2024;26(7):683-689
Objective To explore the evidence,urinary biomarkers,and partial mechanisms of hypercoagulability in the pathogenesis of IgA vasculitis(IgAV).Methods Differential expression of proteins in the urine of 10 healthy children and 10 children with IgAV was screened using high-performance liquid chromatography-tandem mass spectrometry,followed by Reactome pathway analysis.Protein-protein interaction(PPI)network analysis was conducted using STRING and Cytoscape software.In the validation cohort,15 healthy children and 25 children with IgAV were included,and the expression levels of differential urinary proteins were verified using enzyme-linked immunosorbent assay.Results A total of 772 differential proteins were identified between the IgAV group and the control group,with 768 upregulated and 4 downregulated.Reactome pathway enrichment results showed that neutrophil degranulation,platelet activation,and hemostasis pathways were involved in the pathogenesis of IgAV.Among the differential proteins,macrophage migration inhibitory factor(MIF)played a significant role in neutrophil degranulation and hemostasis,while thrombin was a key protein in platelet activation and hemostasis pathways.PPI analysis indicated that thrombin directly interacted with several proteins involved in inflammatory responses,and these interactions involved MIF.Validation results showed that compared to healthy children,children with IgAV had significantly higher urine thrombin/creatinine and urine MIF/creatinine levels(P<0.05).Conclusions Thrombin contributes to the pathogenesis of IgAV through interactions with inflammatory factors.Urinary thrombin and MIF can serve as biomarkers reflecting the hypercoagulable and inflammatory states in children with IgAV.
8.Correlation of CD4+/CD8+Ratio in Peripheral Blood with Progno-sis of Mantle Cell Lymphoma
Yan-Ling LI ; Xiao-Qi QIN ; Lu-Yao GUO ; Xiao-Xu HOU ; Yao CHAO ; Yan-Ping MA
Journal of Experimental Hematology 2024;32(4):1129-1135
Objective:To investigate the correlation of peripheral blood T lymphocyte subsets with overall survival(OS)and clinical baseline characteristics in mantle cell lymphoma(MCL).Methods:The clinical data of 55 MCL patients who were newly diagnosed in the Department of Hematology,Second Hospital of Shanxi Medical University from January 2012 to July 2022 were analyzed retrospectively.The percentages of T lymphocyte subsets and CD4+/CD8+ratio in peripheral blood were detected by flow cytometry,and their correlation with clinical characteristics of patients were analyzed.Kaplan-Meier method was used for survival analysis and survival curves were drawn.Log-rank test was used for univariate analysis,while Cox proportional hazards model was used for multivariate analysis.Results:The median follow-up was 40(1-68)months,and the median overall survival(OS)was 47 months.Among the 55 patients,30(54.5%)patients had a decrease in peripheral blood CD4+T lymphocyte,while 17(30.9%)patients had a increase in peripheral blood CD8+T lymphocyte,and 20(36.4%)patients had a decrease in CD4+/CD8+ratio.There were no significant correlations between CD4+/CD8+ratio and sex,age,Ki-67,B symptoms,leukocytes,hemoglobin,lymphocytes,platelets,albumin,lactate dehydrogenase(LDH),β2-microglobulin,splenomegaly,bone marrow invasion,primary site and MIPI score.Survival analysis showed that patients with CD4+T cell>23.3%,CD8+Tcell ≤33.4%and CD4+/CD8+ratio>0.6 had longer OS(P=0.020,P<0.001,P<0.001).Univariate analysis showed that Ki-67>30%,LDH>250 U/L,splenomegaly,bone marrow involvement,CD4+T cells 23.3%,CD8+T cells>33.4%,CD4+/CD8+ratio ≤0.6 were adverse prognostic factors affecting OS of MCL patients.Multivariate analysis showed that CD4+/CD8+ratio ≤0.6(HR=4.382,P=0.005)was an independent adverse prognostic factor for OS of MCL patients.Conclusions:Low CD4+/CD8+ratio is associated with poor prognosis in MCL,and the CD4+/CD8+ratio can be used as an important indicator to evaluate the prognosis risk in MCL patients.
9.Functional dyspepsia treated with WangShiBaoChiWan: a randomized, double-blind, parallel-controlled, multicenter clinical study
Huiyun ZHU ; Xiaoyang DONG ; Jianguo XIAO ; Xiangpeng HU ; Shengbao LI ; Jianlin REN ; Jianghong LING ; Guoxiong ZHOU ; Xi CHEN ; Xiaohua HOU ; Shengsheng ZHANG ; Jianting CAI ; Duowu ZOU ; Yanqing LI ; Bin CHENG ; Xiaoyan WANG ; Zhaoshen LI ; Yiqi DU
Chinese Journal of Digestion 2023;43(12):834-840
Objective:To compare the efficacy and safety between WangShiBaoChiWan and mosapride in the treatment of functional dyspepsia (FD).Methods:From September 2019 to September 2020, patients with postprandial fullness and early satiation who met the Rome Ⅳ criteria for FD diagnosis were enrolled from 15 hospitals, including the First Affiliated Hospital of Naval Medical University (Shanghai Changhai Hospital), Beijing Traditional Chinese Medicine Hospital Affiliated to Capital Medical College. The subjects were randomly divided into WangShiBaoChiWan (experimental) group and mosapride (control) group in the ratio of 1∶1. The treatment regimens were WangShiBaoChiWan+ mosapride simulator, WangShiBaoChiWan simulator+ mosapride, respectively with a treatment period of 2 weeks. The primary efficacy outcome was the improvement rates of main symptoms before and after treatment, the secondary efficacy primary efficacy outcome was the total clinical effective rate and the change of the single symptom score. And the safety indicator included adverse events. Independent sample t-test, paired t-test and chi-square test were used for statistical analysis. Results:A total of 251 FD patients were enrolled in the full analysis set, including 124 in the experimental group and 127 in the control group; 241 FD patients were in the per-protocol analysis set, including 117 in the experimental group and 124 in the control group. The analysis of per-protocol analysis set showed that the improvement rates of the main symptoms of the experimental group and the control group were (66±29)% and (60±30)%, respectively, and the difference was not statistically significant ( P>0.05). The improvement rate of the main symptoms of the experimental group reached 117% of that of the control group, which exceeded the expected non-inferiority standard of 80%. The total clinical effective rates of the experimental group and the control group were 76.07% (89/117) and 75.81% (94/124), respectively, and the difference was not statistically significant ( P>0.05). The results of full analysis set showed that the incidence of adverse events of the experimental group and the control group was 1.62% (2/124) and 1.57% (2/127), respectively, and the difference was not statistically significant ( P>0.05). There were no serious adverse events in the two groups. Conclusion:The improvement rate of the main symptoms of WangShiBaoChiWan is not inferior to that of mosapride in the treatment of FD, and it has good safety.
10.Quality evaluation of Cnidii Fructus in commodity grade based on theory of "quality evaluation through morphological identification".
Hui-Fang HU ; Shao-Yang XI ; Hou-Kang CAO ; Yan-Xiu GUO ; Yuan-Meng WANG ; Ling-Hui GE ; Xiao-Hui MA ; Zhi-Lai ZHAN ; Ling JIN
China Journal of Chinese Materia Medica 2023;48(4):900-907
From the perspective of market classification of Cnidii Fructus, this paper revealed the scientific connotation of evaluating the quality grade of Cnidii Fructus by its appearance traits. Thirty batches of Cnidii Fructus in different grades were selected as the research objects. The canonical correlation analysis and principal component analysis(PCA) were used to explore the measurement values of 15 appearance traits and intrinsic content indexes. The results of correlation analysis showed that except the aspect ratio, the 5 appearance trait indexes(length, width, 1 000-grain weight, broken grain weight proportion, and chroma) and 9 internal content indexes(the content of moisture, total ash, acid insoluble ash, osthole, imperatorin, 5-methoxy psoralen, isopimpinellin, xanthotoxin, and xanthotol) showed significant correlation to varying degrees. In addition, there was a significant positive correlation between the first typical variable U_1 composed of appearance traits and the first typical variable V_1 composed of internal content indexes(CR_1=0.963, P<0.01). The results of PCA showed that the classification results of appearance traits for 30 batches of Cnidii Fructus were consistent with the actual information of the samples. Under the same analysis conditions, 30 batches of Cnidii Fructus were reclassified by 9 groups of internal content indexes, and the analysis results were consistent. From the classification standard of the appearance traits of the system study, the statistical results of 6 appearance traits of Cnidii Fructus showed a correlation with grades. There was a good correlation between the appearance and the internal content of Cnidii Fructus, and the appearance quality effectively predicted the level of the internal content. There is a certain scientific basis for the quality classification of Cnidii Fructus by main appearance traits. Appearance classification can replace quality grading to realize the "quality evaluation through morphological identification" of Cnidii Fructus.
Fruit
;
Phenotype
;
Principal Component Analysis
;
Social Group

Result Analysis
Print
Save
E-mail