1.Hydrogen and Methane Breath Test: The Asian Neurogastroenterology andMotility Association Monograph
Yinglian XIAO ; Kewin T H SIAH ; Mengyu ZHANG ; Benjamin Wei Rong TAY ; Kee Huat CHUAH ; Victoria TAN ; Yen Po WANG ; Yingxuan CHEN ; Ling LIU ; Uday C GHOSHAL ; Justin C Y WU ; Xiaohua HOU
Journal of Neurogastroenterology and Motility 2026;32(2):150-171
Despite of the widespread use of hydrogen and methane breath test, the variability in testing protocols, gas measurement techniques, and interpretation criteria continues to challenge the reproducibility and comparability across centers, especially in the Asia-Pacific region. The Asian Neurogastroenterology and Motility Association hence presents the first Asian monograph guiding application and interpretation of breath test. The monograph was formulated according to the framework of indications, preparatory process, performance, and interpretation of results, as well as future direction for research.
2.Progress on the hazards and control of ship-borne vector organisms
Yun-chuan HE ; Hui-ling HAO ; Bin SUN ; Hong-yan LYU ; Deng-yong HOU ; Xiao-meng REN
Acta Parasitologica et Medica Entomologica Sinica 2026;33(2):144-151
In the context of burgeoning economic trade, there has been a remarkable increase in the number of ships travelling between domestic and international ports. Inbound and outbound cargo ships, cruise liners, ferries, and other types of vessels have emerged as critical vehicles for the dispersal of vector organisms and the spread of infectious disease agents. Public health concerns associated with these vessels represent a significant threat to human welfare. In this paper, we comprehensively review the hazards posed by vector organisms on ships, the latest advances in prevention and control strategies, and proposes appropriate countermeasures. The aim is to provide effective guidance for the prevention and control of public health security issues caused by ship-borne vector organisms.
3.Assessment of Genotoxicity of Tissue Engineered Materials Based on Improved in vivo Hepatocyte Unscheduled DNA Synthesis(UDS)Assay
Luan-luan WANG ; Li HOU ; Xiang-yu CHU ; Zi-yi YANG ; Ling-xiao SUN ; Xiao-fei WANG ; Qiu-jin QU ; Jing XU ; Zeng-xiang LIU ; Xiao-xia SUN
Progress in Modern Biomedicine 2025;25(17):2740-2748
Objective:An in vivo mammalian hepatocyte Unscheduled DNA Synthesis(UDS)test was used to evaluate the genotoxicity of Cross-linked Sodium Hyaluronate Gel and Bone Repair Materials,providing experimental evidence for establishing a UDS testing method for medical devices and materials.Methods:0.9%sodium chloride injection and cottonseed oil were used as the solvent for test materials and negative control,respectively.N-dimethylnitrosamine(NDMA)was used as the positive control for the early sampling times,and 2-acetylaminofluorene(2-AAF)was used as the positive control for the late sampling times.SD rats were administered a single dose for toxic exposure,and liver tissues were collected at 4 h and 16 h,respectively.Hepatocytes were isolated using collagenase perfusion.After labeling with 5-ethynyl-2'-deoxyuridine(EdU),and the net average fluorescence intensity(NAFI)of cell nuclei and nucleoplasm was measured by fluorescence microscope.Data from 50 cells were used to analyze the DNA repair level.Results:Compared with the negative control groups,the positive control groups(NDMA and 2-AAF)showed highly statistically significant differences in NAFI(P<0.01),indicating successful induction of DNA damage.There was no statistically significant differences between the cross-linked sodium hyaluronate gel groups,bone repair material groups and the negative control group(P>0.05),suggesting that these materials did not significantly induce DNA damage under the experimental conditions.Conclusion:This study first applied EdU labeling technology to the in vivo hepatic UDS assay,achieving non-radioactive labeling through click chemistry reactions.Under the conditions of this study,cross-linked sodium hyaluronate gel and bone repair materials did not exhibit genotoxicity.In the follow-up,the sample range can be expanded and the observation period can be prolonged to further improve the genotoxicity evaluation system of medical devices.
4.Assessment of Genotoxicity of Tissue Engineered Materials Based on Improved in vivo Hepatocyte Unscheduled DNA Synthesis(UDS)Assay
Luan-luan WANG ; Li HOU ; Xiang-yu CHU ; Zi-yi YANG ; Ling-xiao SUN ; Xiao-fei WANG ; Qiu-jin QU ; Jing XU ; Zeng-xiang LIU ; Xiao-xia SUN
Progress in Modern Biomedicine 2025;25(17):2740-2748
Objective:An in vivo mammalian hepatocyte Unscheduled DNA Synthesis(UDS)test was used to evaluate the genotoxicity of Cross-linked Sodium Hyaluronate Gel and Bone Repair Materials,providing experimental evidence for establishing a UDS testing method for medical devices and materials.Methods:0.9%sodium chloride injection and cottonseed oil were used as the solvent for test materials and negative control,respectively.N-dimethylnitrosamine(NDMA)was used as the positive control for the early sampling times,and 2-acetylaminofluorene(2-AAF)was used as the positive control for the late sampling times.SD rats were administered a single dose for toxic exposure,and liver tissues were collected at 4 h and 16 h,respectively.Hepatocytes were isolated using collagenase perfusion.After labeling with 5-ethynyl-2'-deoxyuridine(EdU),and the net average fluorescence intensity(NAFI)of cell nuclei and nucleoplasm was measured by fluorescence microscope.Data from 50 cells were used to analyze the DNA repair level.Results:Compared with the negative control groups,the positive control groups(NDMA and 2-AAF)showed highly statistically significant differences in NAFI(P<0.01),indicating successful induction of DNA damage.There was no statistically significant differences between the cross-linked sodium hyaluronate gel groups,bone repair material groups and the negative control group(P>0.05),suggesting that these materials did not significantly induce DNA damage under the experimental conditions.Conclusion:This study first applied EdU labeling technology to the in vivo hepatic UDS assay,achieving non-radioactive labeling through click chemistry reactions.Under the conditions of this study,cross-linked sodium hyaluronate gel and bone repair materials did not exhibit genotoxicity.In the follow-up,the sample range can be expanded and the observation period can be prolonged to further improve the genotoxicity evaluation system of medical devices.
5.Synaptic Vesicle Glycoprotein 2A Slows down Amyloidogenic Processing of Amyloid Precursor Protein via Regulating Its Intracellular Trafficking.
Qian ZHANG ; Xiao Ling WANG ; Yu Li HOU ; Jing Jing ZHANG ; Cong Cong LIU ; Xiao Min ZHANG ; Ya Qi WANG ; Yu Jian FAN ; Jun Ting LIU ; Jing LIU ; Qiao SONG ; Pei Chang WANG
Biomedical and Environmental Sciences 2025;38(5):607-624
OBJECTIVE:
To reveal the effects and potential mechanisms by which synaptic vesicle glycoprotein 2A (SV2A) influences the distribution of amyloid precursor protein (APP) in the trans-Golgi network (TGN), endolysosomal system, and cell membranes and to reveal the effects of SV2A on APP amyloid degradation.
METHODS:
Colocalization analysis of APP with specific tagged proteins in the TGN, ensolysosomal system, and cell membrane was performed to explore the effects of SV2A on the intracellular transport of APP. APP, β-site amyloid precursor protein cleaving enzyme 1 (BACE1) expressions, and APP cleavage products levels were investigated to observe the effects of SV2A on APP amyloidogenic processing.
RESULTS:
APP localization was reduced in the TGN, early endosomes, late endosomes, and lysosomes, whereas it was increased in the recycling endosomes and cell membrane of SV2A-overexpressed neurons. Moreover, Arl5b (ADP-ribosylation factor 5b), a protein responsible for transporting APP from the TGN to early endosomes, was upregulated by SV2A. SV2A overexpression also decreased APP transport from the cell membrane to early endosomes by downregulating APP endocytosis. In addition, products of APP amyloid degradation, including sAPPβ, Aβ 1-42, and Aβ 1-40, were decreased in SV2A-overexpressed cells.
CONCLUSION
These results demonstrated that SV2A promotes APP transport from the TGN to early endosomes by upregulating Arl5b and promoting APP transport from early endosomes to recycling endosomes-cell membrane pathway, which slows APP amyloid degradation.
Amyloid beta-Protein Precursor/genetics*
;
Membrane Glycoproteins/genetics*
;
Animals
;
Protein Transport
;
Nerve Tissue Proteins/genetics*
;
Humans
;
Mice
;
Endosomes/metabolism*
;
trans-Golgi Network/metabolism*
6.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
7.Clinical efficacy of open reduction and internal fixation with plates versus minimally invasive Kirschner wire fixation for osteoporotic Colles' fractures.
Jun-Wei ZHANG ; Jin-Yong HOU ; Zhao-Hui LI ; Zhen-Yuan MA ; Xiang GAO ; Hong-Zheng BI ; Ling-Ling CHEN ; Hai-Tao WANG ; Wei-Zhi NIE ; Yong-Zhong CHENG ; Xiao-Bing XI
China Journal of Orthopaedics and Traumatology 2025;38(1):18-24
OBJECTIVE:
To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients.
METHODS:
Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores.
RESULTS:
The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05).
CONCLUSION
Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans
;
Female
;
Male
;
Middle Aged
;
Aged
;
Fracture Fixation, Internal/instrumentation*
;
Bone Wires
;
Bone Plates
;
Retrospective Studies
;
Colles' Fracture/surgery*
;
Minimally Invasive Surgical Procedures/methods*
;
Open Fracture Reduction/methods*
;
Osteoporotic Fractures/surgery*
8.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
9.A practice guideline for therapeutic drug monitoring of mycophenolic acid for solid organ transplants.
Shuang LIU ; Hongsheng CHEN ; Zaiwei SONG ; Qi GUO ; Xianglin ZHANG ; Bingyi SHI ; Suodi ZHAI ; Lingli ZHANG ; Liyan MIAO ; Liyan CUI ; Xiao CHEN ; Yalin DONG ; Weihong GE ; Xiaofei HOU ; Ling JIANG ; Long LIU ; Lihong LIU ; Maobai LIU ; Tao LIN ; Xiaoyang LU ; Lulin MA ; Changxi WANG ; Jianyong WU ; Wei WANG ; Zhuo WANG ; Ting XU ; Wujun XUE ; Bikui ZHANG ; Guanren ZHAO ; Jun ZHANG ; Limei ZHAO ; Qingchun ZHAO ; Xiaojian ZHANG ; Yi ZHANG ; Yu ZHANG ; Rongsheng ZHAO
Journal of Zhejiang University. Science. B 2025;26(9):897-914
Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C0), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug-drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage*
;
Drug Monitoring/methods*
;
Humans
;
Organ Transplantation
;
Immunosuppressive Agents/administration & dosage*
;
Delphi Technique
10.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.


Result Analysis
Print
Save
E-mail