Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

OBJECTIVE: To explore the displacement and pressure distribution of American Chiropractic in a model of third lumbar syndrome based on finite element analysis. METHODS: On March 2021, CT and MRI images of a 23-year-old male patient with right third lumbar syndrome were selected. A 3D stl model was established using Mimics and CATIA, and the data was imported into Hypermesh, Abaqus & ANSYS. The elastic modulus and Poisson's ratio of the affected side material were adjusted to establish its finite element model. Based on the comparison of the operating positions and routines of the American Chiropractic and the lumbar spine oblique pull method, but with differences in the focus and direction of force, the experimental group simulated the American Chiropractic with the healthy side (left side) lying position of the model. The upper endplate of L₃ and the lower part below L₃ twisted accordingly with the body position, we applied a vertical forward thrust of 246 N to the plane formed by the L₄, L₅ spinous processes and L₄ upper articular processes;The control group simulates the oblique pull method of the lumbar spine, requiring the model to lie on the healthy side (left side), fix the upper endplate of L₄, and perform a horizontal rotation along the longitudinal axis of L₃ vertebral body. At this time, the contact force in the upward direction is also set to 246 N. Compare the displacement and stress differences between the L₁-L₅ intervertebral bodies, intervertebral discs, articular processes, and transverse process muscles in two intervention models. RESULTS: ① Under safe load conditions, a test force of 246 N was applied to the model, and the maximum vertebral displacement occurred on the right side of the L₃ vertebral body (1.197 mm) after manual intervention in the control group. The vertebral displacement between L₁-L₅ induced by manual intervention in the experimental group was smaller than that of the control group's manual intervention (P<0.05). ② The maximum vertebral body stress occurred on the right side of the L₃ vertebral body after manual intervention in the control group (98.425 MPa). The stress on each vertebral body formed by the experimental group's manual intervention was lower than that of the control group's manual intervention (P<0.05). ③The maximum intervertebral disc stress occurred on the right side of the L_2,3 intervertebral disc (6.282 MPa) after manual intervention in the control group. ④ The maximum joint process stress occurred on the right side of the L₄ upper joint process after manual intervention in the experimental group (1.587 MPa). The joint process stress on the left side below L₁ and the left side above and below L₂ induced by manual intervention in the experimental group was lower than that of the control group (P<0.05). ⑤The maximum stress on the intertransverse process muscle was observed at the right lateral L₃ process end (31.960 MPa) of L_3,4 in the control group after manual intervention. The stress on the L_2,3 and L_4,5 segments of the intertransverse process muscle induced by manual intervention in the experimental group was lower than that of the control group's manual intervention (P<0.05). CONCLUSION The mechanical feedback of the L₁-L₅ vertebral body, the lower left side of the articular process L₁, the upper and lower left side of the articular process L₂, and the L_2,3 and L_4,5 segments of the transverse process muscle in the model indicates that performing American Chiropractic for the treatment of third lumbar transverse process syndrome can accurately hit the target pain point and allow the patient's tissue to form a low stress and low tension state after manual operation, thereby reducing the possibility of tissue damage caused by hypertonia after intervertebral joint movement, making it relatively safe. The application of American Chiropractic will be a new supplement to the traditional treatment plan for third lumbar transverse process syndrome.
Humans ; Finite Element Analysis ; Male ; Lumbar Vertebrae/physiopathology* ; Biomechanical Phenomena ; Young Adult ; Manipulation, Chiropractic ; Adult ; Tomography, X-Ray Computed ; Magnetic Resonance Imaging

OBJECTIVE: To explore the co-morbid influencing factors of postmenopausal osteoporosis(PMOP) and dyslipidemia, and to provide evidence-based basis for clinical co-morbidity management. METHODS: Based on the 2017 to 2018 Beijing community cross-sectional survey data, PMOP patients were included and divided into the dyslipidemia group and the uncomplicated dyslipidemia group according to whether they were comorbid with dyslipidemia. Demographic characteristics, living habits and disease history were collected through questionnaires, and bone mineral density and bone metabolism biomarkers (osteocalcin, blood calcium, serum typeⅠprocollagen N-terminal prepeptide, etc.) were detected on site. Co-morbidity risk factors were analyzed using binary logistic regression. RESULTS: Three hundred and twenty patients with PMOP were included, including the comorbid group (75 patients) and the uncomplicated group (245 patients). The results showed that history of cardiovascular disease [OR=1.801, 95%CI(1.003, 3.236), P=0.049], history of cerebrovascular disease [OR=2.923, 95%CI(1.460, 5.854), P=0.002], frying and cooking methods[OR=5.388, 95%CI(1.632, 17.793), P=0.006], OST results[OR=0.910, 95%CI(0.843, 0.983), P=0.016], and blood Ca results [OR=60.249, 95%CI(1.862, 1 949.926), P=0.021] were the influencing factors of PMOP complicated with dyslipidemia. CONCLUSION Focus should be placed on the influencing factors of PMOP and dyslipidemia co-morbidities, with emphasis on multidimensional assessment, combining lifestyle interventions with bone metabolism marker monitoring to optimize co-morbidity management.
Humans ; Dyslipidemias/epidemiology* ; Female ; Middle Aged ; Osteoporosis, Postmenopausal/metabolism* ; Aged ; Cross-Sectional Studies ; Risk Factors ; Bone Density

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study

OBJECTIVE: To determine the prevalence of lumbar spondylolysis (LS) and the proportion of spondylolytic spondylolisthesis (SS) in China, and to evaluate the musculoskeletal status of patients with LS and SS. METHODS: Spine Computed Tomography (CT) images were collected from community populations aged 40 and above in a nationwide multi-center project. LS was diagnosed, and SS was graded by an experienced radiologist. Bone mineral density (BMD) and paraspinal muscle parameters were quantified based on CT images. RESULTS: One hundred and seventeen patients of a total of 3,317 individuals were diagnosed with LS, corresponding to a prevalence rate of 3.53%. 63 of the 1,214 males (5.18%) and 54 of the 2,103 females (2.57%) were diagnosed with LS. SS occurred in 64/121 vertebrae (52.89%). BMD was not associated with LS ( P = 0.341). The L5 extensor paraspinal muscle density was higher in the LS group than in the non-LS group. In the LS group, patients with SS had a smaller L5 paraspinal extensor muscle cross-sectional area than those without SS ( P = 0.003). CONCLUSION The prevalence of LS in Chinese adults was 3.53%, with prevalence rates of 5.18% in males and 2.57% in females. Patients with LS have higher muscle density, whereas those with SS have smaller muscle cross-sectional areas at the L5 level.
Humans ; Male ; Female ; Middle Aged ; China/epidemiology* ; Prevalence ; Adult ; Lumbar Vertebrae/diagnostic imaging* ; Spondylolysis/diagnostic imaging* ; Aged ; Bone Density ; Tomography, X-Ray Computed ; Aged, 80 and over ; Spondylolisthesis/epidemiology* ; East Asian People