ObjectiveTo observe the clinical effectiveness and safety of Dingchan Granule （定颤颗粒） for paroxysmal atrial fibrillation with syndrome of qi stagnation and blood stasis. MethodsUsing a randomised， double-blind， placebo controlled study method， 90 patients with paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome were divided into 45 cases each in the treatment group and the control group. Both groups were given conventional western medicine treatment， and the treatment group was additionally treated with Dingchan Granule， while the control group was treated with Dingchan Granule placebo， both of which were taken orally for 8 g each time twice a day. Both groups were treated for 8 weeks. We compared the clinical effectiveness， the improvement of traditional Chinese medicine （TCM） symptoms and the recovery rate of atrial fibrillation between the two groups. We compared the number and duration of atrial fibrillation episodes， TCM symptoms score， atrial fibrillation symptom classification， 24-hour average ventricular rate， Pittsburgh Sleep Quality Index （PSQI）， anxiety index， depression index before and after treatment， and evaluated the safety of the two groups. ResultsThe total clinical effectiveness rate in the treatment group was 82.22% （37/45）， which was better than 60.00% （27/45） in the control group （P＜0.05）. The total effective rate of TCM syndrome effectiveness in the treatment group was 88.89% （40/45）， which was better than 66.67% （30/45） in the control group （P＜0.05）； and the rate of atrial fibrillation regression in the treatment group was 26.67% （12/45）， better than 6.67% （3/45） in the control group （P＜0.05）. The number and duration of atrial fibrillation episodes in both groups were significantly decreased （P＜0.01）， and the number and duration of atrial fibrillation episodes in the treatment group were lower than those in the control group （P＜0.01）. The TCM syndrome scores of both groups after treatment were significantly lower than before treatment （P＜0.01）， and the scores of the treatment group was lower than those of the control group （P＜0.05）. The severity of atrial fibrillation symptoms and the grading of atrial fibrillation symptoms in both groups after treatment were improved （P＜0.01）， and the degree of symptom improvement in the treatment group was better than that in the control group （P＜0.01）. The 24-hour average ventricular rate of both groups after treatment was significantly lower （P＜0.01）. The PSQI， anxiety index and depression index of the treatment group were all lower than before treatment （P＜0.01）， while the PSQI and anxiety index of the control group were both lower than before treatment （P＜0.01 or P＜0.05）， the PSQI， anxiety index and depression index of the treatment group being lower than those of the control group （P＜0.05 or P＜0.01）. No adverse events occurred in both groups， and no abnormalities were observed in blood， urine， stool routine， liver and kidney function， and coagulation function indexes. ConclusionDingchan Granule for paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome can alleviate clinical symptom， improve TCM symptom scores， increase atrial fibrillation recovery rate， stabilise the average ventricular rate， and significantly improve the quality of sleep， alleviate the anxiety and depression， with a good safety profile.

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study

OBJECTIVE: To determine the prevalence of lumbar spondylolysis (LS) and the proportion of spondylolytic spondylolisthesis (SS) in China, and to evaluate the musculoskeletal status of patients with LS and SS. METHODS: Spine Computed Tomography (CT) images were collected from community populations aged 40 and above in a nationwide multi-center project. LS was diagnosed, and SS was graded by an experienced radiologist. Bone mineral density (BMD) and paraspinal muscle parameters were quantified based on CT images. RESULTS: One hundred and seventeen patients of a total of 3,317 individuals were diagnosed with LS, corresponding to a prevalence rate of 3.53%. 63 of the 1,214 males (5.18%) and 54 of the 2,103 females (2.57%) were diagnosed with LS. SS occurred in 64/121 vertebrae (52.89%). BMD was not associated with LS ( P = 0.341). The L5 extensor paraspinal muscle density was higher in the LS group than in the non-LS group. In the LS group, patients with SS had a smaller L5 paraspinal extensor muscle cross-sectional area than those without SS ( P = 0.003). CONCLUSION The prevalence of LS in Chinese adults was 3.53%, with prevalence rates of 5.18% in males and 2.57% in females. Patients with LS have higher muscle density, whereas those with SS have smaller muscle cross-sectional areas at the L5 level.
Humans ; Male ; Female ; Middle Aged ; China/epidemiology* ; Prevalence ; Adult ; Lumbar Vertebrae/diagnostic imaging* ; Spondylolysis/diagnostic imaging* ; Aged ; Bone Density ; Tomography, X-Ray Computed ; Aged, 80 and over ; Spondylolisthesis/epidemiology* ; East Asian People

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child