ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

Background/Aims: Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care. Methods: The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations. Results: Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing. Conclusions The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

The holistic view is the key in the study of traditional Chinese medicine(TCM). The component structure theory is based on the holistic view to investigate the correlation between material basis and efficiency, which enriches the holistic "component-effect" research of TCM. Gintonin is a newly isolated non-saponin component of ginseng. Compared to ginsenosides, gintonin has many different pharmacological activities, and it provides new knowledge for the holistic research of ginseng. Thus, taking the discovery of gintonin from ginseng as an example, this paper explored the linkage between ginsenosides and gintonin from the perspective of "component-effect" correlations and systematically sorted out the similarities and differences between them in terms of structural characteristics, modes of action, and pharmacological activities. Starting from the collaborative interaction of TCM compounds, the study discussed the application and value of the holistic view in TCM "component-effect" research in the light of the component structure theory to provide new thoughts for the development of modern TCM research.
Panax/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Medicine, Chinese Traditional ; Humans ; Ginsenosides/pharmacology* ; Animals

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

A single-center, randomized, double-blind, dose-controlled trial of modified Sini Powder in treating mild to moderate generalized anxiety disorder(GAD) in the patients with syndrome of liver depression transforming into fire was conducted at Xiyuan Hospital, China Academy of Chinese Medical Sciences. A total of 80 patients with mild to moderate GAD and the syndrome of liver depression transforming into fire were included. Patients were assigned by the central randomization system at a ratio of 3∶1 into an observation group(n=60, receiving a conventional-dose of granules of modified Sini Powder) and a control group(n=20, receiving low-dose granules with the active ingredients being 50% of that in observation group). Assessments were conducted before treatment(baseline), after 2 weeks of introduction, after 2/4/8 weeks of treatment, and after 4 weeks of follow-up. The results were summarized as follows. In terms of primary outcome indicators, the observation group(62.2%) showed higher total response rate than the control group(26.6%)(P<0.05), and greater Hamilton anxiety scale(HAMA) score reduction after 8 weeks of treatment(P<0.05). In terms of secondary outcome indicators, the HAMA score(somatic anxiety score), traditional Chinese medicine(TCM) syndrome scores, Pittsburgh sleep quality index(PSQI) scale, and clinical global impression(CGI) scale score in the observation group showed a significant compared to the control group at each visit points(P<0.05). Adverse events occurred in 10 cases, including 9(16.9%) cases in the observation group and 1(6.6%) case in the control group. No adverse reaction was observed. In conclusion, conventional-dose modified Sini Powder demonstrated superior efficacy and favorable safety for mild and moderate GAD in the patients with the syndrome of liver depression transforming into fire over low-dose treatment.
Humans ; Male ; Female ; Adult ; Middle Aged ; Double-Blind Method ; Drugs, Chinese Herbal/administration & dosage* ; Anxiety Disorders/drug therapy* ; Treatment Outcome ; Young Adult ; Powders ; Aged ; Liver/drug effects* ; Generalized Anxiety Disorder

In this study, lipopolysaccharide(LPS), ovalbumin(OVA), and compound 48/80(C48/80) were administered to establish non-infectious pneumonia models under simulated clinical conditions, and the correlation between their pathological characteristics and traditional Chinese medicine(TCM) syndromes was compared, providing the basis for the selection of appropriate animal models for TCM efficacy evaluation. An acute pneumonia model was established by nasal instillation of LPS combined with intraperitoneal injection for intensive stimulation. Three doses of OVA mixed with aluminum hydroxide adjuvant were injected intraperitoneally on days one, three, and five and OVA was administered via endotracheal drip for excitation on days 14-18 to establish an OVA-induced allergic pneumonia model. A single intravenous injection of three doses of C48/80 was adopted to establish a C48/80-induced pneumonia model. By detecting the changes in peripheral blood leukocyte classification, lung tissue and plasma cytokines, immunoglobulins(Ig), histamine levels, and arachidonic acid metabolites, the multi-dimensional analysis was carried out based on pathological evaluation. The results showed that the three models could cause pulmonary edema, increased wet weight in the lung, and obvious exudative inflammation in lung tissue pathology, especially for LPS. A number of pyrogenic cytokines, inclading interleukin(IL)-6, interferon(IFN)-γ, IL-1β, and IL-4 were significantly elevated in the LPS pneumonia model. Significantly increased levels of prostacyclin analogs such as prostaglandin E2(PGE2) and PGD2, which cause increased vascular permeability, and neutrophils in peripheral blood were significantly elevated. The model could partly reflect the clinical characteristics of phlegm heat accumulating in the lung or dampness toxin obstructing the lung. The OVA model showed that the sensitization mediators IgE and leukotriene E4(LTE4) were increased, and the anti-inflammatory prostacyclin 6-keto-PGF2α was decreased. Immune cells(lymphocytes and monocytes) were decreased, and inflammatory cells(neutrophils and basophils) were increased, reflecting the characteristics of "deficiency", "phlegm", or "dampness". Lymphocytes, monocytes, and basophils were significantly increased in the C48/80 model. The phenotype of the model was that the content of histamine, a large number of prostacyclins(6-keto-PGE1, PGF2α, 15-keto-PGF2α, 6-keto-PGF1α, 13,14-D-15-keto-PGE2, PGD2, PGE2, and PGH2), LTE4, and 5-hydroxyeicosatetraenoic acid(5S-HETE) was significantly increased, and these indicators were associated with vascular expansion and increased vascular permeability. The pyrogenic inflammatory cytokines were not increased. The C48/80 model reflected the characteristics of cold and damp accumulation. In the study, three non-infectious pneumonia models were constructed. The LPS model exhibited neutrophil infiltration and elevated inflammatory factors, which was suitable for the efficacy study of TCM for clearing heat, detoxifying, removing dampness, and eliminating phlegm. The OVA model, which took allergic inflammation as an index, was suitable for the efficacy study of Yiqi Gubiao formulas. The C48/80 model exhibited increased vasoactive substances(histamine, PGs, and LTE4), which was suitable for the efficacy study and evaluation of TCM for warming the lung, dispersing cold, drying dampness, and resolving phlegm. The study provides a theoretical basis for model selection for the efficacy evaluation of TCM in the treatment of pneumonia.
Animals ; Disease Models, Animal ; Mice ; Pneumonia/genetics* ; Medicine, Chinese Traditional ; Male ; Humans ; Cytokines/immunology* ; Female ; Lipopolysaccharides/adverse effects* ; Lung/drug effects* ; Drugs, Chinese Herbal ; Ovalbumin ; Mice, Inbred BALB C

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the early clinical efficacy and safety of trans-catheter aortic valve replacement (TAVR) for patients with severe pure native aortic regurgitation (PNAR) who are not suitable for conventional surgical aortic valve replace-ment. METHODS: A retrospective analysis was conducted on 48 patients with PNAR who underwent TAVR at the Department of Cardiac Surgery, the First Affiliated Hospital of Sun Yat-sen University between March 2019 and February 2025. These included 25 cases with transfemoral approach (TF-TAVR group) and 23 cases with transapical approach (TA-TAVR group). Efficacy and safety were assessed by analyzing baseline characteristics, all-cause mortality, and procedure-related complications. RESULTS: Compared with the TA-TAVR group, the TF-TAVR group exhibited significantly smaller aortic annulus circumference and diameter, left ventricular outflow tract circumference and diameter, diameters of the left, right, and non-coronary sinuses, and sinotubular junction (STJ) diameter, along with a shorter distance from the STJ to the aortic annular plane ring plane, a smaller annulus angle (all P<0.05). Additionally, the TF-TAVR group showed a deeper prosthesis implantation depth relative to the aortic annular plane (P<0.01). The overall technical success rate was 91.67%, and the device success rate was 83.33%. Post-TAVR, both groups demonstrated significant improvement in left ventricular end-diastolic diameter (both P<0.05), while only the TA-TAVR group showed significant reduction in left ventricular end-systolic diameter (P<0.05). For primary outcomes, in-hospital mortality occurred in 2 patients (4.17%). No additional deaths were reported at 60 or 90 d after surgery. During 90-180 d after surgery, one patient in the TF-TAVR group died of sudden cardiac death, and one in the TA-TAVR group died of gastroin-testinal bleeding. During 180 d-1 year after surgery, one patient in the TF-TAVR group died of low cardiac output syndrome. No statistically significant differences were observed in 1-year Kaplan-Meier survival curves between the two groups (P>0.05). No conduction block events occurred in TA-TAVR group during hospitalization or 1-year follow-up, while high-grade atrioventricular block, left bundle branch block, permanent pacemaker implantation occurred in TF-TAVR group during hospitalization (12.00%, 4.00%, and 12.00%, respectively). CONCLUSIONS TAVR demonstrates high feasibility and acceptable safety for severe PNAR patients who are not suitable for conventional SAVR. Both TF-TAVR and TA-TAVR show comparable early postoperative efficacy and safety profiles.
Humans ; Transcatheter Aortic Valve Replacement/adverse effects* ; Aortic Valve Insufficiency/surgery* ; Retrospective Studies ; Male ; Female ; Aged ; Treatment Outcome ; Aortic Valve/surgery* ; Aged, 80 and over ; Heart Valve Prosthesis

OBJECTIVE: To investigate the gene carrier rate and genotype distribution characteristics of thalassemia in the population of Kunming, and compare the differences of red blood cell (RBC) parameters between β⁺ heterozygous carriers, β⁰ heterozygous carriers and healthy population, as well as between different sexes of adults aged 18-45 years. METHODS: A retrospective analysis of 3 195 cases of thalassemia gene screened in the First Affiliated Hospital of Kunming Medical University from April 1, 2020 to March 31, 2022 was performed to detect 21 mutations of β-globin genes which was common in Chinese people using fluorescence PCR melting curve method. Patients with single heterozygous carrying β-thalassemia gene were divided into β⁺ heterozygote group and β⁰ heterozygote group, while the control group consisted of 219 healthy individuals. Four indices, including RBC, hemoglobin (Hb), mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) were collected from all β heterozygous carriers and 219 healthy people, and compared between β⁺ heterozygote group, β⁰ heterozygote group and control group, as well as between β⁺ heterozygous carriers, β⁰ heterozygous carriers and healthy population of different sexes aged 18-45 years. RESULTS: There were 688 cases confirmed thalassemia gene carriers, accounting for 21.53%. Among them, 322 cases were found to have β-globin gene mutations, including 145 cases of β⁺ heterozygote, 151 cases of β⁰ heterozygote, and 14 cases of β⁺ homozygotes as well as β⁺ and β⁰ dual heterozygotes. Additionally, 12 cases were found to have simultaneous mutation or deletion of β-globin and α-globin. The carrier rate of CD26 G>A mutation in β⁺ thalassemia was the highest, accounting for 57.9%, while in β⁰ thalassemia CD17 A>T was the highest, accounting for 46.4%. The erythrocyte parameters of 296 β heterozygous mutation carriers were compared with the normal reference interval, and it was found that 218 cases with RBC value greater than the highest value of reference interval, while 105, 281, and 269 cases with Hb, MCV, and MCH value less than the lowest value of reference interval, respectively. There were significant differences in the 4 erythrocyte parameters between β⁺ heterozygotes, β⁰ heterozygotes and healthy individuals (all P < 0.001), and further comparison between different sexes also showed significant differences (all P < 0.001). CONCLUSIONS The carrier rates of thalassemia gene and β-thalassemia heterozygote are both at high level in Kunming, and there are significant differences in the erythrocyte parameters between β⁺ heterozygous carriers, β⁰ heterozygous carriers and healthy individuals. When genetic counseling, it is necessary to inform and strengthen screening among adults of marriageable age to prevent birth of children with severe thalassemia.
Humans ; beta-Thalassemia/blood* ; Adult ; Heterozygote ; Male ; Female ; beta-Globins/genetics* ; Retrospective Studies ; Middle Aged ; Mutation ; Adolescent ; Genotype ; Erythrocytes ; Erythrocyte Indices ; Young Adult ; China ; Genetic Testing ; Asian People/genetics*