This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Objective To investigate the clinical characteristics and management strategies of spinal infarction(SCI)combined with hypoxic-ischemic encephalopathy(HIE).Methods We report a case of SCI induced by cardiopulmonary arrest in a patient admitted to the General Hospital of Southern Theater Command in June 2021.A review of the relevant literature published in PubMed and CNKI from January 2014 to March 2024,was conducted to summarize the etiology,features,and treatment approaches for SCI.Results The patient presented with clinical features of quadriplegia accompanied by paresthesia,lumbar and cervical pain with paresthesia,dysphagia,dysphonia,and urinary and fecal incontinence.Spinal MRI revealed abnormal signals in the anterior and lateral columns at the C2-T1 spinal level,with no enhancement observed in contrast-enhanced scan.The patient was diagnosed as SCI combined with HIE,and was treated with antiplatelet therapy and rehabilitation.Literature review revealed that SCI is a rare central nervous system disease with multiple causes,often related to aortic surgery or pathology,presenting with segmental sensory disturbances among other clinical manifestations.MRI plays a significant role in its diagnosis,and there is currently no specific effective treatment available.Conclusions SCI has a sudden onset and is often insidious,frequently accompanying other diseases,leading to a high risk of misdiagnosis.In this case,SCI was considered to be caused by low blood pressure and vertebral artery tenuity.Clinical manifestations include paraplegia at the lesion level along with back/neck pain or limb paresthesia.Diagnosis primarily relies on MRI imaging while treatment involves secondary stroke prevention measures,rehabilitation training,complication prevention strategies as well as hyperbaric oxygen therapy.

Objective To investigate the population composition,seasonal dynamics,and infestation levels of cockroaches in Lanzhou,China,and to provide information for the scientific development of cockroach control strategies.Methods Monitoring was conducted at three locations using the sticky trap method.Habitats included farm product markets,catering establishments,hotels,hospitals,and residential areas.Results From 2016 to 2023,the average cockroach density was 0.77 insects per board,with an average infestation rate of 10.84%.Blattella germanica was the dominant species.Seasonal density of cockroaches showed an approximately unimodal distribution,peaking in September.The highest average density and infestation rates were observed in farm product markets.Conclusions Cockroach density and infestation levels in Lanzhou remained relatively low.A comprehensive prevention and control strategy focusing on environmental management in key areas should be implemented according to the seasonal fluctuations.

Objective: To investigate the correlations among clinicopathological features, histopathological growth patterns and prognosis of extrapulmonary multiple metastatic(stage ⅣB) pulmonary adenocarcinoma with epidermal growth factor receptor(EGFR) mutations. Methods : A total of 488 eligible patients with adenocarcinoma of stage ⅣB. Clinicopathological data,EGFRgene mutation subtypes, metastatic sites, histopathological growth patterns and survival information were collected. The chi-square test(χ2test) and Fisher's exact probability method were used to detect the correlation between the metastasis status and various clinical characteristics; the Kaplan-Meier method was used to conduct survival analysis on the median Progression-Free Survival(PFS) under different clinical characteristics. Cox univariate and multivariate regression analyses were conducted to evaluate the impact of various clinical characteristics on prognosis. Results : The metastatic patterns of stage ⅣB pulmonary adenocarcinoma withEGFRmutations was correlated with histopathological growth patterns(P<0.05). In the group with multiple metastases in a single organ, the proportion of micropapillary type in the group with multiple metastases in a single organ was higher than that in the group with multiple-organ metastases(51.1%vs41.1%), while the proportion of solid type in the group with multiple-organ metastases was higher than that in the group with multiple metastases in a single organ(23.8%vs14.2%). Multiple brain or multiple bone metastases were correlated with histopathological growth patterns and tumor differentiation degree. Compared with the multiple bone metastases group, the proportion of acinar type decreases in the multiple brain metastasis group, while the proportion of micropapillary type increased. Moreover, the proportion of poorly differentiated tumors increased significantly(P<0.05). Compared with multiple bone metastases, the proportion of poorly differentiated tumors significantly increases in the group with multiple brain metastases. The median progression-free survival(PFS) of patients with a predominant solid growth pattern was shorter than that of patients with other growth patterns(12.7 monthsvs17.8 months,P<0.05). The PFS of patients in the poorly differentiated group was worse than that in the moderately differentiated group(15.6 monthsvs17.8 months,P<0.05). There were significant differences in PFS among patients with common sensitive mutations and rare mutationsEGFR(17.3 monthsvs10.2 months,P<0.01). Cox proportional hazards regression model suggested that solid growth pattern, poor differentiation and rare single gene mutation were adverse prognostic factors. Conclusion In stage ⅣB pulmonary adenocarcinoma patients withEGFRmutations, both the metastatic patterns and metastatic sites are significantly correlated with the histopathological growth patterns of tumors. Moreover, theEGFRmutation subtypes as well as the histopathological growth patterns and differentiation degree of tumors significantly affect the prognosis of patients.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the genomic characteristics and prognostic factors of juvenile myelomonocytic leukemia (JMML) with RAS mutations. METHODS: A retrospective analysis was conducted on the clinical data of JMML children with RAS mutations treated at the Hematology Hospital of Chinese Academy of Medical Sciences, from January 2008 to November 2022. RESULTS: A total of 34 children were included, with 17 cases (50%) having isolated NRAS mutations, 9 cases (27%) having isolated KRAS mutations, and 8 cases (24%) having compound mutations. Compared to children with isolated NRAS mutations, those with NRAS compound mutations showed statistically significant differences in age at onset, platelet count, and fetal hemoglobin proportion (P<0.05). Cox proportional hazards regression model analysis revealed that hematopoietic stem cell transplantation (HSCT) and hepatomegaly (≥2 cm below the costal margin) were factors affecting the survival rate of JMML children with RAS mutations (P<0.05); hepatomegaly was a factor affecting survival in the non-HSCT group (P<0.05). CONCLUSIONS Children with NRAS compound mutations have a later onset age compared to those with isolated NRAS mutations. At initial diagnosis, children with NRAS compound mutations have poorer peripheral platelet and fetal hemoglobin levels than those with isolated NRAS mutations. Liver size at initial diagnosis is related to the prognosis of JMML children with RAS mutations. HSCT can improve the prognosis of JMML children with RAS mutations.
Humans ; Leukemia, Myelomonocytic, Juvenile/therapy* ; Mutation ; Male ; Female ; Child, Preschool ; Retrospective Studies ; Child ; Infant ; GTP Phosphohydrolases/genetics* ; Membrane Proteins/genetics* ; Adolescent ; Hematopoietic Stem Cell Transplantation ; Proportional Hazards Models ; Proto-Oncogene Proteins p21(ras)/genetics* ; Prognosis

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

Objective To investigate the association between gastroesophageal reflux disease(GERD)and the risk of incident chronic obstructive pulmonary disease(COPD)and explore potential effect modifiers influencing this association.Methods Clinical data from 476 175 participants in the UK Biobank(2006-2010)were collected.A Cox proportional hazards model was used to assess the relationship between GERD and the risk of incident COPD.Subgroup analyses were conducted to examine potential modifiers of the primary findings.Results A total of 11 587(2.43%)new COPD cases were diagnosed.The Cox proportional hazards model revealed that GERD was associated with an increased risk of incident COPD(HR=1.59,95%CI=1.46-1.74,P<0.001).GERD was linked to a higher risk of incident COPD in individuals aged<60 years(P<0.001)and non-smokers(P=0.011).No association was observed between GERD and the risk of incident COPD in current smokers with a daily cigarette consumption<10 cigarettes(P=0.261).Conclusion GERD may increase the risk of incident COPD.
Humans ; Pulmonary Disease, Chronic Obstructive/epidemiology* ; Gastroesophageal Reflux/epidemiology* ; Middle Aged ; Proportional Hazards Models ; Incidence ; Male ; Risk Factors ; Female ; Aged