OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the genomic characteristics and prognostic factors of juvenile myelomonocytic leukemia (JMML) with RAS mutations. METHODS: A retrospective analysis was conducted on the clinical data of JMML children with RAS mutations treated at the Hematology Hospital of Chinese Academy of Medical Sciences, from January 2008 to November 2022. RESULTS: A total of 34 children were included, with 17 cases (50%) having isolated NRAS mutations, 9 cases (27%) having isolated KRAS mutations, and 8 cases (24%) having compound mutations. Compared to children with isolated NRAS mutations, those with NRAS compound mutations showed statistically significant differences in age at onset, platelet count, and fetal hemoglobin proportion (P<0.05). Cox proportional hazards regression model analysis revealed that hematopoietic stem cell transplantation (HSCT) and hepatomegaly (≥2 cm below the costal margin) were factors affecting the survival rate of JMML children with RAS mutations (P<0.05); hepatomegaly was a factor affecting survival in the non-HSCT group (P<0.05). CONCLUSIONS Children with NRAS compound mutations have a later onset age compared to those with isolated NRAS mutations. At initial diagnosis, children with NRAS compound mutations have poorer peripheral platelet and fetal hemoglobin levels than those with isolated NRAS mutations. Liver size at initial diagnosis is related to the prognosis of JMML children with RAS mutations. HSCT can improve the prognosis of JMML children with RAS mutations.
Humans ; Leukemia, Myelomonocytic, Juvenile/therapy* ; Mutation ; Male ; Female ; Child, Preschool ; Retrospective Studies ; Child ; Infant ; GTP Phosphohydrolases/genetics* ; Membrane Proteins/genetics* ; Adolescent ; Hematopoietic Stem Cell Transplantation ; Proportional Hazards Models ; Proto-Oncogene Proteins p21(ras)/genetics* ; Prognosis

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

OBJECTIVE: To investigate the risk factors, clinical characteristics, and bacterial resistance of bloodstream infections caused by Streptococcus mitis in children with hematological disease, so as to provide a reference for infection control. METHODS: The clinical information and laboratory findings of pediatric patients complicated with blood cultures positive for Streptococcus mitis from January 2018 to December 2020 in the Institute of Hematology & Blood Diseases Hospital were searched and collected. The clinical characteristics, susceptibility factors, and antibiotic resistance of the children were retrospectively analyzed. RESULTS: Data analysis from 2018 to 2020 showed that the proportion of Streptococcus mitis isolated from bloodstream infections in children (≤14 years old) with hematological diseases was the highest (19.91%) and significantly higher than other bacteria, accounting for 38.64% of Gram-positive cocci, and presented as an increasing trend year by year. A total of 427 children tested positive blood cultures, including 85 children with bloodstream infections caused by Streptococcus mitis who tested after fever. Most children experienced a recurrent high fever in the early and middle stages (≤6 d) of neutropenia and persistent fever for more than 3 days. After adjusting the antibiotics according to the preliminary drug susceptibility results, the body temperature of most children (63.5%) returned to normal within 4 days. The 85 children were mainly diagnosed with acute myeloid leukemia (AML), accounting for 84.7%. The proportion of children in the neutropenia stage was 97.7%. The incidence of oral mucosal damage, lung infection, and gastrointestinal injury symptoms was 40%, 31.8%, and 27.1%, respectively. The ratio of elevated C-reactive protein (CRP) and procalcitonin was 65.9% and 9.4%, respectively. All isolated strains of Streptococcus mitis were not resistant to vancomycin and linezolid, and the resistance rate to penicillin, cefotaxime, levofloxacin, and quinupristin-dalfopristin was 10.6%, 8.2%, 9.4%, and 14.1%, respectively. None of children died due to bloodstream infection caused by Streptococcus mitis. CONCLUSION The infection rate of Streptococcus mitis is increasing year by year in children with hematological diseases, especially in children with AML. Among them, neutropenia and oral mucosal damage after chemotherapy are high-risk infection factors. The common clinical symptoms include persistent high fever, oral mucosal damage, and elevated CRP. Penicillin and cephalosporins have good sensitivity. Linezolid, as a highly sensitive antibiotic, can effectively control infection and shorten the course of disease.
Humans ; Child ; Streptococcal Infections/microbiology* ; Retrospective Studies ; Hematologic Diseases/complications* ; Streptococcus mitis ; Drug Resistance, Bacterial ; Risk Factors ; Microbial Sensitivity Tests ; Anti-Bacterial Agents ; Female ; Male ; Bacteremia/microbiology* ; Child, Preschool ; Adolescent

Objective To investigate the association between gastroesophageal reflux disease(GERD)and the risk of incident chronic obstructive pulmonary disease(COPD)and explore potential effect modifiers influencing this association.Methods Clinical data from 476 175 participants in the UK Biobank(2006-2010)were collected.A Cox proportional hazards model was used to assess the relationship between GERD and the risk of incident COPD.Subgroup analyses were conducted to examine potential modifiers of the primary findings.Results A total of 11 587(2.43%)new COPD cases were diagnosed.The Cox proportional hazards model revealed that GERD was associated with an increased risk of incident COPD(HR=1.59,95%CI=1.46-1.74,P<0.001).GERD was linked to a higher risk of incident COPD in individuals aged<60 years(P<0.001)and non-smokers(P=0.011).No association was observed between GERD and the risk of incident COPD in current smokers with a daily cigarette consumption<10 cigarettes(P=0.261).Conclusion GERD may increase the risk of incident COPD.
Humans ; Pulmonary Disease, Chronic Obstructive/epidemiology* ; Gastroesophageal Reflux/epidemiology* ; Middle Aged ; Proportional Hazards Models ; Incidence ; Male ; Risk Factors ; Female ; Aged

Objective: To investigate the correlations among clinicopathological features, histopathological growth patterns and prognosis of extrapulmonary multiple metastatic(stage ⅣB) pulmonary adenocarcinoma with epidermal growth factor receptor(EGFR) mutations. Methods : A total of 488 eligible patients with adenocarcinoma of stage ⅣB. Clinicopathological data,EGFRgene mutation subtypes, metastatic sites, histopathological growth patterns and survival information were collected. The chi-square test(χ2test) and Fisher's exact probability method were used to detect the correlation between the metastasis status and various clinical characteristics; the Kaplan-Meier method was used to conduct survival analysis on the median Progression-Free Survival(PFS) under different clinical characteristics. Cox univariate and multivariate regression analyses were conducted to evaluate the impact of various clinical characteristics on prognosis. Results : The metastatic patterns of stage ⅣB pulmonary adenocarcinoma withEGFRmutations was correlated with histopathological growth patterns(P<0.05). In the group with multiple metastases in a single organ, the proportion of micropapillary type in the group with multiple metastases in a single organ was higher than that in the group with multiple-organ metastases(51.1%vs41.1%), while the proportion of solid type in the group with multiple-organ metastases was higher than that in the group with multiple metastases in a single organ(23.8%vs14.2%). Multiple brain or multiple bone metastases were correlated with histopathological growth patterns and tumor differentiation degree. Compared with the multiple bone metastases group, the proportion of acinar type decreases in the multiple brain metastasis group, while the proportion of micropapillary type increased. Moreover, the proportion of poorly differentiated tumors increased significantly(P<0.05). Compared with multiple bone metastases, the proportion of poorly differentiated tumors significantly increases in the group with multiple brain metastases. The median progression-free survival(PFS) of patients with a predominant solid growth pattern was shorter than that of patients with other growth patterns(12.7 monthsvs17.8 months,P<0.05). The PFS of patients in the poorly differentiated group was worse than that in the moderately differentiated group(15.6 monthsvs17.8 months,P<0.05). There were significant differences in PFS among patients with common sensitive mutations and rare mutationsEGFR(17.3 monthsvs10.2 months,P<0.01). Cox proportional hazards regression model suggested that solid growth pattern, poor differentiation and rare single gene mutation were adverse prognostic factors. Conclusion In stage ⅣB pulmonary adenocarcinoma patients withEGFRmutations, both the metastatic patterns and metastatic sites are significantly correlated with the histopathological growth patterns of tumors. Moreover, theEGFRmutation subtypes as well as the histopathological growth patterns and differentiation degree of tumors significantly affect the prognosis of patients.

Objective To investigate the clinical characteristics and management strategies of spinal infarction(SCI)combined with hypoxic-ischemic encephalopathy(HIE).Methods We report a case of SCI induced by cardiopulmonary arrest in a patient admitted to the General Hospital of Southern Theater Command in June 2021.A review of the relevant literature published in PubMed and CNKI from January 2014 to March 2024,was conducted to summarize the etiology,features,and treatment approaches for SCI.Results The patient presented with clinical features of quadriplegia accompanied by paresthesia,lumbar and cervical pain with paresthesia,dysphagia,dysphonia,and urinary and fecal incontinence.Spinal MRI revealed abnormal signals in the anterior and lateral columns at the C2-T1 spinal level,with no enhancement observed in contrast-enhanced scan.The patient was diagnosed as SCI combined with HIE,and was treated with antiplatelet therapy and rehabilitation.Literature review revealed that SCI is a rare central nervous system disease with multiple causes,often related to aortic surgery or pathology,presenting with segmental sensory disturbances among other clinical manifestations.MRI plays a significant role in its diagnosis,and there is currently no specific effective treatment available.Conclusions SCI has a sudden onset and is often insidious,frequently accompanying other diseases,leading to a high risk of misdiagnosis.In this case,SCI was considered to be caused by low blood pressure and vertebral artery tenuity.Clinical manifestations include paraplegia at the lesion level along with back/neck pain or limb paresthesia.Diagnosis primarily relies on MRI imaging while treatment involves secondary stroke prevention measures,rehabilitation training,complication prevention strategies as well as hyperbaric oxygen therapy.

Objective To investigate the population composition,seasonal dynamics,and infestation levels of cockroaches in Lanzhou,China,and to provide information for the scientific development of cockroach control strategies.Methods Monitoring was conducted at three locations using the sticky trap method.Habitats included farm product markets,catering establishments,hotels,hospitals,and residential areas.Results From 2016 to 2023,the average cockroach density was 0.77 insects per board,with an average infestation rate of 10.84%.Blattella germanica was the dominant species.Seasonal density of cockroaches showed an approximately unimodal distribution,peaking in September.The highest average density and infestation rates were observed in farm product markets.Conclusions Cockroach density and infestation levels in Lanzhou remained relatively low.A comprehensive prevention and control strategy focusing on environmental management in key areas should be implemented according to the seasonal fluctuations.

This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model: Z = 688.310 11 - 3 023.722 22X₁ - 11.477 00X₂ + 62.721 67X₃ + 14.600 00X₁X₂ - 179.666 67X₁X₃ - 3.152 00X₂X₃ + 4 031.111 11X₁² + 0.525 28X₂² + 9.772 00X₃². This model is stable and reliable, determining the optimal taste-masking formulation to be 3.9 g·L^-1 of stevioside, 100 g L^-1 of xylitol, and 30 g L^-1 of methyl-β-cyclodextrin. The comprehensive score of the verification test is 88.14, with a relative RSD of 0.39%, indicating the feasibility of this model. This study achieved the improvement of the taste of ibuprofen oral solution through a combination of objective and subjective methods. Three types of corrigent were identified for enhancing drug taste, leading to the selection of the optimal taste-masking formulation for ibuprofen oral solution. This significantly enhanced the taste of the original formulation, improved patient compliance, and offered a new approach to mitigating the undesirable taste of formulations.