This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Aim To investigate the role of FRMD4A in autophagy of placental trophoblast cells in preeclampsia(PE).Methods The placental tissues and clinical data of normal pregnancy and PE were obtained,and the histopathological changes were observed by HE staining.An in vitro model of hypoxia-induced HTR-8/SVneo trophoblast cells was established.The expres-sions of LC3B Ⅱ/Ⅰ and p62 in placental tissues and hypoxic cell models were analyzed by Western blot.The expression of FRMD4A was detected by qRT-PCR,Western blot and immunofluorescence,and the correlation between the expression level of FRMD4A and the clinical characteristics of the subjects was ana-lyzed by Pearson correlation analysis.Hypoxia induced trophoblast cells were transfected with si-FRMD4A,and the expression of LC3 B Ⅱ/Ⅰ and p62 was analyzed by Western blot.Results Compared with the normal group,the expression of LC3B Ⅱ/Ⅰ in PE placental tissues and hypoxia-induced trophoblast models was significantly upregulated,while the expression of p62 was significantly downregulated.Meanwhile,the ex-pression of FRMD4A increased significantly.Moreo-ver,its expression was positively correlated with the maternal systolic blood pressure,diastolic blood pres-sure,and platelet count,but negatively correlated with the neonatal weight(P＜0.01).In addition,hypoxia-induced trophoblast cells transfected with si-FRMD4A showed a significant decrease in LC3B Ⅱ/Ⅰ and an increase in p62 expression.Conclusions The expres-sion of FRMD4A is upregulated in PE placenta and hy-poxia-induced trophoblast cell model.Interfering with it can significantly hinder the autophagy process of trophoblast cells,suggesting that it may serve as a po-tential molecular target to participate in the pathologi-cal process of PE.

Aim To perform high-throughput screen-ing of immunomodulatory traditional Chinese medicine(TCMs)based on an in vitro B cell differentiation-antibody secretion model,identifying active herbal candidates with immune-enhancing properties to pro-vide novel therapeutic options and theoretical support for influenza virus treatment in immunocompromised in-dividuals.Methods B cells were stimulated with dif-ferent concentrations of cytosine-phosphate-guanine oli-godeoxynucleotide 2006(CpG)and nterleukin-2(IL-2)to promote proliferation,differentiation,and anti-body secretion,and the effects of varying concentra-tions of the solvent DMSO were also evaluated.The op-timal conditions for the B cell differentiation-anti-body secretion model were determined based on the se-cretion levels of three antibody isotypes.The feasibility of the model was further validated using rapamycin,a known B cell function inhibitor.On this basis,a high-throughput screening platform for immunomodulatory a-gents was optimized and established.Subsequently,the immune-enhancing activity of 465 polarity extract from TCMs was evaluated.Results The optimal con-ditions for the model were determined as 2 mg·L-1 CpG,1.67 × 106 nkat·L-1 IL-2,and DMSO with a volume fraction of 0.1％.Rapamycin effectively inhib-ited B cell differentiation into plasmablast and signifi-cantly reduced antibody production,indicating the reli-ability of the model.Multiple rounds of screening re-vealed that the dichloromethane extract of licorice,the dichloromethane extract of Vinegar-processed Curcumae Rhizoma,the cyclohexane extract of Honey-prepared Radix Asteris,and the aqueous extract of Siphonostegia chinensis Benth were identified to significantly promote both B cell proliferation and differentiation and anti-body secretion at a concentration of 600 μg·L-1.Conclusion This study successfully optimizes an in vitro B cell differentiation-antibody secretion model and identifies several TCM extracts,including licorice,with potential immune-enhancing activity.

Aim To perform high-throughput screen-ing of immunomodulatory traditional Chinese medicine(TCMs)based on an in vitro B cell differentiation-antibody secretion model,identifying active herbal candidates with immune-enhancing properties to pro-vide novel therapeutic options and theoretical support for influenza virus treatment in immunocompromised in-dividuals.Methods B cells were stimulated with dif-ferent concentrations of cytosine-phosphate-guanine oli-godeoxynucleotide 2006(CpG)and nterleukin-2(IL-2)to promote proliferation,differentiation,and anti-body secretion,and the effects of varying concentra-tions of the solvent DMSO were also evaluated.The op-timal conditions for the B cell differentiation-anti-body secretion model were determined based on the se-cretion levels of three antibody isotypes.The feasibility of the model was further validated using rapamycin,a known B cell function inhibitor.On this basis,a high-throughput screening platform for immunomodulatory a-gents was optimized and established.Subsequently,the immune-enhancing activity of 465 polarity extract from TCMs was evaluated.Results The optimal con-ditions for the model were determined as 2 mg·L-1 CpG,1.67 × 106 nkat·L-1 IL-2,and DMSO with a volume fraction of 0.1％.Rapamycin effectively inhib-ited B cell differentiation into plasmablast and signifi-cantly reduced antibody production,indicating the reli-ability of the model.Multiple rounds of screening re-vealed that the dichloromethane extract of licorice,the dichloromethane extract of Vinegar-processed Curcumae Rhizoma,the cyclohexane extract of Honey-prepared Radix Asteris,and the aqueous extract of Siphonostegia chinensis Benth were identified to significantly promote both B cell proliferation and differentiation and anti-body secretion at a concentration of 600 μg·L-1.Conclusion This study successfully optimizes an in vitro B cell differentiation-antibody secretion model and identifies several TCM extracts,including licorice,with potential immune-enhancing activity.

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the genomic characteristics and prognostic factors of juvenile myelomonocytic leukemia (JMML) with RAS mutations. METHODS: A retrospective analysis was conducted on the clinical data of JMML children with RAS mutations treated at the Hematology Hospital of Chinese Academy of Medical Sciences, from January 2008 to November 2022. RESULTS: A total of 34 children were included, with 17 cases (50%) having isolated NRAS mutations, 9 cases (27%) having isolated KRAS mutations, and 8 cases (24%) having compound mutations. Compared to children with isolated NRAS mutations, those with NRAS compound mutations showed statistically significant differences in age at onset, platelet count, and fetal hemoglobin proportion (P<0.05). Cox proportional hazards regression model analysis revealed that hematopoietic stem cell transplantation (HSCT) and hepatomegaly (≥2 cm below the costal margin) were factors affecting the survival rate of JMML children with RAS mutations (P<0.05); hepatomegaly was a factor affecting survival in the non-HSCT group (P<0.05). CONCLUSIONS Children with NRAS compound mutations have a later onset age compared to those with isolated NRAS mutations. At initial diagnosis, children with NRAS compound mutations have poorer peripheral platelet and fetal hemoglobin levels than those with isolated NRAS mutations. Liver size at initial diagnosis is related to the prognosis of JMML children with RAS mutations. HSCT can improve the prognosis of JMML children with RAS mutations.
Humans ; Leukemia, Myelomonocytic, Juvenile/therapy* ; Mutation ; Male ; Female ; Child, Preschool ; Retrospective Studies ; Child ; Infant ; GTP Phosphohydrolases/genetics* ; Membrane Proteins/genetics* ; Adolescent ; Hematopoietic Stem Cell Transplantation ; Proportional Hazards Models ; Proto-Oncogene Proteins p21(ras)/genetics* ; Prognosis

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes