Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets

Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe₃O₄ loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4⁺/CD8⁺ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.

Image 1.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the therapeutic effects and mechanisms of 2,6-dimethoxy-1,4-benzoquinone (2,6-DMBQ) in a mouse model of asthma. METHODS: SPF-grade BALB/c mice were randomly divided into 7 groups (n=8 each group): normal control group, ovalbumin (OVA) group, dimethyl sulfoxide+corn oil group, budesonide (BUD) group, and low, medium, and high dose 2,6-DMBQ groups. An asthma mouse model was established by OVA induction, followed by corresponding drug interventions. Non-invasive lung function tests were performed to measure airway hyperresponsiveness, and enzyme-linked immunosorbent assay was used to determine levels of interleukin (IL)-17, IL-10, and serum immunoglobulin E in bronchoalveolar lavage fluid. A cell counter was employed to detect eosinophil counts in bronchoalveolar lavage fluid, while hematoxylin-eosin staining and periodic acid-Schiff staining were used to assess lung tissue pathological changes. Western blot was conducted to examine the expression of proteins related to the mammalian target of rapamycin pathway (p-AKT/AKT and p-p70S6K/p70S6K), and a fully automated biochemical analyzer was used to evaluate liver and kidney functions. RESULTS: Compared with the normal control group, the OVA group showed increased enhanced pause values, inflammation scores from hematoxylin-eosin staining, positive area from periodic acid-Schiff staining, percentage of eosinophils, IL-17/IL-10 ratio, serum immunoglobulin E levels, and relative expression levels of p-AKT/AKT and p-p70S6K/p70S6K (P<0.05). The BUD group and the medium and high dose 2,6-DMBQ groups exhibited decreased values for these indicators compared to the OVA group (P<0.05). CONCLUSIONS 2,6-DMBQ can inhibit the mTOR pathway to alleviate airway inflammation in asthmatic mice, possibly by mitigating the imbalance between Th17 and regulatory T cells.
Animals ; Asthma/pathology* ; Mice, Inbred BALB C ; Signal Transduction/drug effects* ; Mice ; TOR Serine-Threonine Kinases/physiology* ; Female ; Benzoquinones/pharmacology* ; Immunoglobulin E/blood* ; Interleukin-10/analysis* ; Interleukin-17/analysis* ; Bronchoalveolar Lavage Fluid ; Lung/pathology*

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

OBJECTIVE: To explore the improvement effect of rehabilitation nursing based on information-knowledge-belief-behavior (IKAP) theory on urinary incontinence patients after radical prostatectomy. METHODS Sixty-six patients with urinary incontinence who received robot-assisted laparoscopic radical prostatectomy in General Hospital of Eastern Theater Command from January 2021 to January 2023 were selected and divided into control group (n=33) and observation group (n=33) according to random number table method. The patients in the control group were treated with rehabilitation nursing. The patients in the observation group were treated with rehabilitation nursing guided by IKAP theory. The recovery of urinary incontinence, duration of urinary incontinence, subjective well-being, quality of life, psychological and emotional indexes of patients in the two groups were compared. Results： The total effective rate of urinary incontinence recovery in the observation group was significantly higher than that in the control group (90.91% vs 60.61%，P<0.05). The duration of urinary incontinence in the observation group was significantly shorter than that in the control group (［3.36±1.54］d vs ［4.15±1.36］d，P<0.05). And the subjective well-being score in observation group was significantly higher than that in the control group (［19.36±2.69］points vs ［11.65±2.65］points， P<0.05). There was no significant difference in preoperative physical function, social function，and mental health scores between the two groups (P>0.05). And all scores in the observation group were significantly higher than those in the control group after surgery (P<0.05). There was no significant difference in the preoperative SAS and SDS scores between the two groups of patients (P>0.05). And the scores of SAS and SDS in observation group were lower than those of the control group after the operation (P<0.05). Conclusion： Rehabilitation nursing based on IKAP theory can significantly improve urinary incontinence in patients with prostate cancer after surgery, which promotes the recovery of urinary incontinence, shortens the time of urinary incontinence, and improves the subjective well-being and quality of life, as well as reduces the negative impact of negative emotions. Therefore, it can be widely promoted and implemented in clinical practice.
Humans ; Prostatectomy/adverse effects* ; Urinary Incontinence/etiology* ; Male ; Quality of Life ; Rehabilitation Nursing ; Middle Aged ; Aged