1.Effects of total extract of Anthriscus sylvestris on immune inflammation and thrombosis in rats with pulmonary arterial hypertension based on TGF-β1/Smad3 signaling pathway.
Ya-Juan ZHENG ; Pei-Pei YUAN ; Zhen-Kai ZHANG ; Yan-Ling LIU ; Sai-Fei LI ; Yuan RUAN ; Yi CHEN ; Yang FU ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(9):2472-2483
This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals
;
Male
;
Smad3 Protein/metabolism*
;
Transforming Growth Factor beta1/metabolism*
;
Rats, Sprague-Dawley
;
Rats
;
Signal Transduction/drug effects*
;
Hypertension, Pulmonary/genetics*
;
Thrombosis/immunology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Humans
;
Apoptosis/drug effects*
2.Effects of combined use of active ingredients in Buyang Huanwu Decoction on oxygen-glucose deprivation/reglucose-reoxygenation-induced inflammation and oxidative stress of BV2 cells.
Tian-Qing XIA ; Ying CHEN ; Jian-Lin HUA ; Qin SU ; Cun-Yan DAN ; Meng-Wei RONG ; Shi-Ning GE ; Hong GUO ; Bao-Guo XIAO ; Jie-Zhong YU ; Cun-Gen MA ; Li-Juan SONG
China Journal of Chinese Materia Medica 2025;50(14):3835-3846
This study aims to explore the effects and action mechanisms of the active ingredients in Buyang Huanwu Decoction(BYHWD), namely tetramethylpyrazine(TMP) and hydroxy-safflor yellow A(HSYA), on oxygen-glucose deprivation/reglucose-reoxygenation(OGD/R)-induced inflammation and oxidative stress of microglia(MG). Network pharmacology was used to screen the effective monomer ingredients of BYHWD and determine the safe concentration range for each component. Inflammation and oxidative stress models were established to further screen the best ingredient combination and optimal concentration ratio with the most effective anti-inflammatory and antioxidant effects. OGD/R BV2 cell models were constructed, and BV2 cells in the logarithmic growth phase were divided into a normal group, a model group, an HSYA group, a TMP group, and an HSYA + TMP group. Enzyme-linked immunosorbent assay(ELISA) was used to detect the levels of inflammatory cytokines such as interleukin-1β(IL-1β), tumor necrosis factor-α(TNF-α), and interleukin-6(IL-6). Oxidative stress markers, including superoxide dismutase(SOD), nitric oxide(NO), and malondialdehyde(MDA), were also measured. Western blot was used to analyze the protein expression of both inflammation-related pathway [Toll-like receptor 4(TLR4)/nuclear factor-kappa B(NF-κB)] and oxidative stress-related pathway [nuclear factor erythroid 2-related factor 2(Nrf2)/heme oxygenase-1(HO-1)]. Immunofluorescence was used to assess the expression of proteins such as inducible nitric oxide synthase(iNOS) and arginase-1(Arg-1). The most effective ingredients for anti-inflammatory and antioxidant effects in BYHWD were TMP and HSYA. Compared to the normal group, the model group showed significantly increased levels of IL-1β, TNF-α, IL-6, NO, and MDA, along with significantly higher protein expression of NF-κB, TLR4, Nrf2, and HO-1 and significantly lower SOD levels. The differences between the two groups were statistically significant. Compared to the model group, both the HSYA group and the TMP group showed significantly reduced levels of IL-1β, TNF-α, IL-6, NO, and MDA, lower expression of NF-κB and TLR4 proteins, higher levels of SOD, and significantly increased protein expression of Nrf2 and HO-1. Additionally, the expression of the M1-type MG marker iNOS was significantly reduced, while the expression of the M2-type MG marker Arg-1 was significantly increased. The results of the HSYA group and the TMP group had statistically significant differences from those of the model group. Compared to the HSYA group and the TMP group, the HSYA + TMP group showed further significant reductions in IL-1β, TNF-α, IL-6, NO, and MDA levels, along with significant reductions in NF-κB and TLR4 protein expression, an increase in SOD levels, and elevated Nrf2 and HO-1 protein expression. Additionally, the expression of the M1-type MG marker iNOS was reduced, while the M2-type MG marker Arg-1 expression increased significantly in the HSYA + TMP group compared to the TMP or HSYA group. The differences in the results were statistically significant between the HSYA + TMP group and the TMP or HSYA group. The findings indicated that the combined use of HSYA and TMP, the active ingredients of BYHWD, can effectively inhibit OGD/R-induced inflammation and oxidative stress of MG, showing superior effects compared to the individual use of either component.
Oxidative Stress/drug effects*
;
Drugs, Chinese Herbal/pharmacology*
;
Animals
;
Mice
;
Glucose/metabolism*
;
Cell Line
;
Inflammation/genetics*
;
Oxygen/metabolism*
;
Pyrazines/pharmacology*
;
Microglia/metabolism*
;
NF-E2-Related Factor 2/immunology*
;
NF-kappa B/immunology*
;
Toll-Like Receptor 4/immunology*
;
Anti-Inflammatory Agents/pharmacology*
;
Humans
3.Inhibition of KLK8 promotes pulmonary endothelial repair by restoring the VE-cadherin/Akt/FOXM1 pathway.
Ying ZHAO ; Hui JI ; Feng HAN ; Qing-Feng XU ; Hui ZHANG ; Di LIU ; Juan WEI ; Dan-Hong XU ; Lai JIANG ; Jian-Kui DU ; Ping-Bo XU ; Yu-Jian LIU ; Xiao-Yan ZHU
Journal of Pharmaceutical Analysis 2025;15(4):101153-101153
Image 1.
4.Effect and mechanism of combined use of active components of Buyang Huanwu Decoction in ameliorating neuronal injury induced by OGD/R.
Cun-Yan DAN ; Meng-Wei RONG ; Xiu LOU ; Tian-Qing XIA ; Bao-Guo XIAO ; Hong GUO ; Cun-Gen MA ; Li-Juan SONG
China Journal of Chinese Materia Medica 2025;50(4):1098-1110
Buyang Huanwu Decoction(BYHWD), as one of the classic formulas in traditional Chinese medicine(TCM) for the treatment of cerebral ischemic stroke(CIS), has demonstrated definite effects in clinical practice. However, the material basis and mechanism of treatment have not been systematically elucidated. This study employed network pharmacology and molecular docking to analyze the potential targets and mechanisms of blood-and brain-penetrating active components of BYHWD in reducing cell apoptosis in CIS. Cell experiments were then carried out to validate the prediction results. In the experiments, five active components including hydroxysafflor yellow A( HSYA), tetramethylpyrazine( TMP), astragaloside Ⅳ( AS-Ⅳ), amygdalin( AMY), and paeoniflorin(PF) were selected to explore the pharmacological effects of BYHWD. HT22 cells were treated with BYHWD, and the cell counting kit-8(CCK-8) method was employed to examine the toxic and side effects of BYHWD. A cell model of oxygen-glucose deprivation/reoxygenation( OGD/R) was constructed, with apoptosis and pyroptosis as the main screening indicators. The levels of lactate dehydrogenase(LDH) and glutathione(GSH) were measured to assess the cell membrane integrity. Flow cytometry was employed to detect apoptosis, and the activities of caspase-3 and caspase-1 were measured to clarify the status of apoptosis and pyroptosis. ELISA was employed to determine the levels of interleukin(IL)-1β and IL-18 to confirm pyroptosis. HSYA and AMY were identified in this study as the active components regulating apoptosis and pyroptosis. TUNEL was employed to detect the apoptosis rate, and Western blot was employed to determine the expression levels of apoptosis-related proteins B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), and caspase-3, which confirmed that the anti-apoptotic effect of the combined component group was superior to that of the single component groups. The molecular docking results revealed strong binding affinity of HSYA and AMY with SDF-1α and CXCR4.AMD3100, a selective antagonist of CXCR4, was then used for intervention. The results of Western blot showed alterations in the expression levels of apoptosis-associated proteins, SDF-1α, and CXCR4. In conclusion, HSYA and AMY influence cellular apoptosis by modulating the SDF-1α/CXCR4 signaling cascade.
Drugs, Chinese Herbal/chemistry*
;
Apoptosis/drug effects*
;
Animals
;
Neurons/cytology*
;
Mice
;
Molecular Docking Simulation
;
Cell Line
;
Glucose/metabolism*
;
Humans
;
Neuroprotective Agents/pharmacology*
5.Mineralogical studies on iron-containing mineral medicines, Haematitum and Limonitum.
Min LU ; Xiao-Fei WANG ; Cheng-Cheng WANG ; Jing-Xu CHEN ; Hang-Jie ZHU ; Juan LI ; Yan CAO
China Journal of Chinese Materia Medica 2025;50(5):1179-1186
Haematitum and Limonitum are two iron-containing mineral medicines included in the 2020 edition of the Chinese Pharmacopoeia. They have similar main components and major differences in their property, flavor, channel tropism, and clinical uses. In this study, we investigated the surface properties, mineral composition, mineral dissociation, elemental composition, and iron state of Haematitum and Limonitum to explore their mineralogical differences. Scanning electron microscopy(SEM), specific surface and porosity analyzer, X-ray diffractometer(XRD), X-ray photoelectron spectrometer(XPS), and advanced mineral identification and characterization system(AMICS) were used to analyze the mineralogy of Haematitum and Limonitum. The results showed that Haematitum had an angular surface with granular attachments and a specific surface area of 17.04 m~2·g~(-1). In comparison, Limonitum had a smooth and flat surface with a bundled acicular crystal structure and a specific surface area of 46.29 m~2·g~(-1). Haematitum consists of 31 detectable minerals containing 18 elements, with the major element, iron(44.5% Fe~(2+) and 55.5% Fe~(3+)) distributed in 17 minerals, including hematite, iron oxide, knebelite, siderite, and magnesioferrite. Limonitum consists of 32 detectable minerals containing 17 elements, with the major element, iron(14.5% Fe~(2+) and 85.5% Fe~(3+)) distributed in 19 minerals, including limonite, iron oxide, chlorite, and knebelite. In summary, the elemental composition of Haematitum and Limonitum does not differ greatly, but there are large differences in the mineral composition and iron state. The large specific surface area and strong adsorption capacity of Limonitum may be one of the mechanisms of its anti-diarrheal action. The Fe_2O_3 and illite contained in Haematitum and Limonitum may be the key substances for their hemostasis effects. The mineralogical differences are expected to provide a reference for explaining the scientific connotation of mineral medicine and laying a material foundation for studying its mechanism of action.
Iron/analysis*
;
Minerals/chemistry*
;
Drugs, Chinese Herbal/chemistry*
;
X-Ray Diffraction
;
Microscopy, Electron, Scanning
;
Photoelectron Spectroscopy
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Mechanism of 2,6-DMBQ attenuates airway inflammatory responses in asthmatic mice via the mTOR signaling pathway.
Juan LI ; Shu-Fang LI ; Xiao-Man XIONG ; Qiu-Yan YANG ; Xue-Li XIE ; Yan-Li ZHANG
Chinese Journal of Contemporary Pediatrics 2025;27(4):472-479
OBJECTIVES:
To investigate the therapeutic effects and mechanisms of 2,6-dimethoxy-1,4-benzoquinone (2,6-DMBQ) in a mouse model of asthma.
METHODS:
SPF-grade BALB/c mice were randomly divided into 7 groups (n=8 each group): normal control group, ovalbumin (OVA) group, dimethyl sulfoxide+corn oil group, budesonide (BUD) group, and low, medium, and high dose 2,6-DMBQ groups. An asthma mouse model was established by OVA induction, followed by corresponding drug interventions. Non-invasive lung function tests were performed to measure airway hyperresponsiveness, and enzyme-linked immunosorbent assay was used to determine levels of interleukin (IL)-17, IL-10, and serum immunoglobulin E in bronchoalveolar lavage fluid. A cell counter was employed to detect eosinophil counts in bronchoalveolar lavage fluid, while hematoxylin-eosin staining and periodic acid-Schiff staining were used to assess lung tissue pathological changes. Western blot was conducted to examine the expression of proteins related to the mammalian target of rapamycin pathway (p-AKT/AKT and p-p70S6K/p70S6K), and a fully automated biochemical analyzer was used to evaluate liver and kidney functions.
RESULTS:
Compared with the normal control group, the OVA group showed increased enhanced pause values, inflammation scores from hematoxylin-eosin staining, positive area from periodic acid-Schiff staining, percentage of eosinophils, IL-17/IL-10 ratio, serum immunoglobulin E levels, and relative expression levels of p-AKT/AKT and p-p70S6K/p70S6K (P<0.05). The BUD group and the medium and high dose 2,6-DMBQ groups exhibited decreased values for these indicators compared to the OVA group (P<0.05).
CONCLUSIONS
2,6-DMBQ can inhibit the mTOR pathway to alleviate airway inflammation in asthmatic mice, possibly by mitigating the imbalance between Th17 and regulatory T cells.
Animals
;
Asthma/pathology*
;
Mice, Inbred BALB C
;
Signal Transduction/drug effects*
;
Mice
;
TOR Serine-Threonine Kinases/physiology*
;
Female
;
Benzoquinones/pharmacology*
;
Immunoglobulin E/blood*
;
Interleukin-10/analysis*
;
Interleukin-17/analysis*
;
Bronchoalveolar Lavage Fluid
;
Lung/pathology*
8.Avatrombopag for platelet engraftment after allogeneic hematopoietic stem cell transplantation in children: a retrospective clinical study.
Xin WANG ; Yuan-Yuan REN ; Xia CHEN ; Chao-Qian JIANG ; Ran-Ran ZHANG ; Xiao-Yan ZHANG ; Li-Peng LIU ; Yu-Mei CHEN ; Li ZHANG ; Yao ZOU ; Fang LIU ; Xiao-Juan CHEN ; Wen-Yu YANG ; Xiao-Fan ZHU ; Ye GUO
Chinese Journal of Contemporary Pediatrics 2025;27(10):1233-1239
OBJECTIVES:
To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO).
METHODS:
A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38).
RESULTS:
At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043).
CONCLUSIONS
In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans
;
Retrospective Studies
;
Hematopoietic Stem Cell Transplantation/adverse effects*
;
Male
;
Female
;
Child
;
Child, Preschool
;
Infant
;
Adolescent
;
Transplantation, Homologous
;
Blood Platelets/drug effects*
;
Thiazoles/therapeutic use*
;
Thrombopoietin/therapeutic use*
;
Thiophenes
9.Clinical and Laboratory Characteristics of Streptococcus mitis Causing Bloodstream Infection in Children with Hematological Disease.
Yu-Long FAN ; Guo-Qing ZHU ; Zhi-Ying TIAN ; Yan-Xia LYU ; Zhao WANG ; Ye GUO ; Wen-Yu YANG ; Qing-Song LIN ; Xiao-Juan CHEN
Journal of Experimental Hematology 2025;33(1):286-291
OBJECTIVE:
To investigate the risk factors, clinical characteristics, and bacterial resistance of bloodstream infections caused by Streptococcus mitis in children with hematological disease, so as to provide a reference for infection control.
METHODS:
The clinical information and laboratory findings of pediatric patients complicated with blood cultures positive for Streptococcus mitis from January 2018 to December 2020 in the Institute of Hematology & Blood Diseases Hospital were searched and collected. The clinical characteristics, susceptibility factors, and antibiotic resistance of the children were retrospectively analyzed.
RESULTS:
Data analysis from 2018 to 2020 showed that the proportion of Streptococcus mitis isolated from bloodstream infections in children (≤14 years old) with hematological diseases was the highest (19.91%) and significantly higher than other bacteria, accounting for 38.64% of Gram-positive cocci, and presented as an increasing trend year by year. A total of 427 children tested positive blood cultures, including 85 children with bloodstream infections caused by Streptococcus mitis who tested after fever. Most children experienced a recurrent high fever in the early and middle stages (≤6 d) of neutropenia and persistent fever for more than 3 days. After adjusting the antibiotics according to the preliminary drug susceptibility results, the body temperature of most children (63.5%) returned to normal within 4 days. The 85 children were mainly diagnosed with acute myeloid leukemia (AML), accounting for 84.7%. The proportion of children in the neutropenia stage was 97.7%. The incidence of oral mucosal damage, lung infection, and gastrointestinal injury symptoms was 40%, 31.8%, and 27.1%, respectively. The ratio of elevated C-reactive protein (CRP) and procalcitonin was 65.9% and 9.4%, respectively. All isolated strains of Streptococcus mitis were not resistant to vancomycin and linezolid, and the resistance rate to penicillin, cefotaxime, levofloxacin, and quinupristin-dalfopristin was 10.6%, 8.2%, 9.4%, and 14.1%, respectively. None of children died due to bloodstream infection caused by Streptococcus mitis.
CONCLUSION
The infection rate of Streptococcus mitis is increasing year by year in children with hematological diseases, especially in children with AML. Among them, neutropenia and oral mucosal damage after chemotherapy are high-risk infection factors. The common clinical symptoms include persistent high fever, oral mucosal damage, and elevated CRP. Penicillin and cephalosporins have good sensitivity. Linezolid, as a highly sensitive antibiotic, can effectively control infection and shorten the course of disease.
Humans
;
Child
;
Streptococcal Infections/microbiology*
;
Retrospective Studies
;
Hematologic Diseases/complications*
;
Streptococcus mitis
;
Drug Resistance, Bacterial
;
Risk Factors
;
Microbial Sensitivity Tests
;
Anti-Bacterial Agents
;
Female
;
Male
;
Bacteremia/microbiology*
;
Child, Preschool
;
Adolescent
10.Clinical Applications of Circulating Tumor DNA in Response Evaluation and Relapse Monitoring of Primary Mediastinal Large B-Cell Lymphoma.
Lu PAN ; Xin-Miao JIANG ; Yan TENG ; Ning WANG ; Ling HUANG ; Han-Guo GUO ; Si-Chu LIU ; Xiao-Juan WEI ; Fei-Li CHEN ; Zhan-Li LIANG ; Wen-Yu LI
Journal of Experimental Hematology 2025;33(2):407-415
OBJECTIVE:
To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL).
METHODS:
The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS).
RESULTS:
Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy.
CONCLUSION
CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans
;
Circulating Tumor DNA/blood*
;
Female
;
Mediastinal Neoplasms
;
Male
;
Retrospective Studies
;
High-Throughput Nucleotide Sequencing
;
Prognosis
;
Lymphoma, Large B-Cell, Diffuse/genetics*
;
Middle Aged
;
Adult
;
Aged
;
Neoplasm Recurrence, Local
;
Mutation

Result Analysis
Print
Save
E-mail