Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe₃O₄ loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4⁺/CD8⁺ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.

Buyang Huanwu Decoction(BYHWD), as one of the classic formulas in traditional Chinese medicine(TCM) for the treatment of cerebral ischemic stroke(CIS), has demonstrated definite effects in clinical practice. However, the material basis and mechanism of treatment have not been systematically elucidated. This study employed network pharmacology and molecular docking to analyze the potential targets and mechanisms of blood-and brain-penetrating active components of BYHWD in reducing cell apoptosis in CIS. Cell experiments were then carried out to validate the prediction results. In the experiments, five active components including hydroxysafflor yellow A( HSYA), tetramethylpyrazine( TMP), astragaloside Ⅳ( AS-Ⅳ), amygdalin( AMY), and paeoniflorin(PF) were selected to explore the pharmacological effects of BYHWD. HT22 cells were treated with BYHWD, and the cell counting kit-8(CCK-8) method was employed to examine the toxic and side effects of BYHWD. A cell model of oxygen-glucose deprivation/reoxygenation( OGD/R) was constructed, with apoptosis and pyroptosis as the main screening indicators. The levels of lactate dehydrogenase(LDH) and glutathione(GSH) were measured to assess the cell membrane integrity. Flow cytometry was employed to detect apoptosis, and the activities of caspase-3 and caspase-1 were measured to clarify the status of apoptosis and pyroptosis. ELISA was employed to determine the levels of interleukin(IL)-1β and IL-18 to confirm pyroptosis. HSYA and AMY were identified in this study as the active components regulating apoptosis and pyroptosis. TUNEL was employed to detect the apoptosis rate, and Western blot was employed to determine the expression levels of apoptosis-related proteins B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), and caspase-3, which confirmed that the anti-apoptotic effect of the combined component group was superior to that of the single component groups. The molecular docking results revealed strong binding affinity of HSYA and AMY with SDF-1α and CXCR4.AMD3100, a selective antagonist of CXCR4, was then used for intervention. The results of Western blot showed alterations in the expression levels of apoptosis-associated proteins, SDF-1α, and CXCR4. In conclusion, HSYA and AMY influence cellular apoptosis by modulating the SDF-1α/CXCR4 signaling cascade.
Drugs, Chinese Herbal/chemistry* ; Apoptosis/drug effects* ; Animals ; Neurons/cytology* ; Mice ; Molecular Docking Simulation ; Cell Line ; Glucose/metabolism* ; Humans ; Neuroprotective Agents/pharmacology*

Haematitum and Limonitum are two iron-containing mineral medicines included in the 2020 edition of the Chinese Pharmacopoeia. They have similar main components and major differences in their property, flavor, channel tropism, and clinical uses. In this study, we investigated the surface properties, mineral composition, mineral dissociation, elemental composition, and iron state of Haematitum and Limonitum to explore their mineralogical differences. Scanning electron microscopy(SEM), specific surface and porosity analyzer, X-ray diffractometer(XRD), X-ray photoelectron spectrometer(XPS), and advanced mineral identification and characterization system(AMICS) were used to analyze the mineralogy of Haematitum and Limonitum. The results showed that Haematitum had an angular surface with granular attachments and a specific surface area of 17.04 m~2·g~(-1). In comparison, Limonitum had a smooth and flat surface with a bundled acicular crystal structure and a specific surface area of 46.29 m~2·g~(-1). Haematitum consists of 31 detectable minerals containing 18 elements, with the major element, iron(44.5% Fe~(2+) and 55.5% Fe~(3+)) distributed in 17 minerals, including hematite, iron oxide, knebelite, siderite, and magnesioferrite. Limonitum consists of 32 detectable minerals containing 17 elements, with the major element, iron(14.5% Fe~(2+) and 85.5% Fe~(3+)) distributed in 19 minerals, including limonite, iron oxide, chlorite, and knebelite. In summary, the elemental composition of Haematitum and Limonitum does not differ greatly, but there are large differences in the mineral composition and iron state. The large specific surface area and strong adsorption capacity of Limonitum may be one of the mechanisms of its anti-diarrheal action. The Fe_2O_3 and illite contained in Haematitum and Limonitum may be the key substances for their hemostasis effects. The mineralogical differences are expected to provide a reference for explaining the scientific connotation of mineral medicine and laying a material foundation for studying its mechanism of action.
Iron/analysis* ; Minerals/chemistry* ; Drugs, Chinese Herbal/chemistry* ; X-Ray Diffraction ; Microscopy, Electron, Scanning ; Photoelectron Spectroscopy

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

This study aims to explore the effects and action mechanisms of the active ingredients in Buyang Huanwu Decoction(BYHWD), namely tetramethylpyrazine(TMP) and hydroxy-safflor yellow A(HSYA), on oxygen-glucose deprivation/reglucose-reoxygenation(OGD/R)-induced inflammation and oxidative stress of microglia(MG). Network pharmacology was used to screen the effective monomer ingredients of BYHWD and determine the safe concentration range for each component. Inflammation and oxidative stress models were established to further screen the best ingredient combination and optimal concentration ratio with the most effective anti-inflammatory and antioxidant effects. OGD/R BV2 cell models were constructed, and BV2 cells in the logarithmic growth phase were divided into a normal group, a model group, an HSYA group, a TMP group, and an HSYA + TMP group. Enzyme-linked immunosorbent assay(ELISA) was used to detect the levels of inflammatory cytokines such as interleukin-1β(IL-1β), tumor necrosis factor-α(TNF-α), and interleukin-6(IL-6). Oxidative stress markers, including superoxide dismutase(SOD), nitric oxide(NO), and malondialdehyde(MDA), were also measured. Western blot was used to analyze the protein expression of both inflammation-related pathway [Toll-like receptor 4(TLR4)/nuclear factor-kappa B(NF-κB)] and oxidative stress-related pathway [nuclear factor erythroid 2-related factor 2(Nrf2)/heme oxygenase-1(HO-1)]. Immunofluorescence was used to assess the expression of proteins such as inducible nitric oxide synthase(iNOS) and arginase-1(Arg-1). The most effective ingredients for anti-inflammatory and antioxidant effects in BYHWD were TMP and HSYA. Compared to the normal group, the model group showed significantly increased levels of IL-1β, TNF-α, IL-6, NO, and MDA, along with significantly higher protein expression of NF-κB, TLR4, Nrf2, and HO-1 and significantly lower SOD levels. The differences between the two groups were statistically significant. Compared to the model group, both the HSYA group and the TMP group showed significantly reduced levels of IL-1β, TNF-α, IL-6, NO, and MDA, lower expression of NF-κB and TLR4 proteins, higher levels of SOD, and significantly increased protein expression of Nrf2 and HO-1. Additionally, the expression of the M1-type MG marker iNOS was significantly reduced, while the expression of the M2-type MG marker Arg-1 was significantly increased. The results of the HSYA group and the TMP group had statistically significant differences from those of the model group. Compared to the HSYA group and the TMP group, the HSYA + TMP group showed further significant reductions in IL-1β, TNF-α, IL-6, NO, and MDA levels, along with significant reductions in NF-κB and TLR4 protein expression, an increase in SOD levels, and elevated Nrf2 and HO-1 protein expression. Additionally, the expression of the M1-type MG marker iNOS was reduced, while the M2-type MG marker Arg-1 expression increased significantly in the HSYA + TMP group compared to the TMP or HSYA group. The differences in the results were statistically significant between the HSYA + TMP group and the TMP or HSYA group. The findings indicated that the combined use of HSYA and TMP, the active ingredients of BYHWD, can effectively inhibit OGD/R-induced inflammation and oxidative stress of MG, showing superior effects compared to the individual use of either component.
Oxidative Stress/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Mice ; Glucose/metabolism* ; Cell Line ; Inflammation/genetics* ; Oxygen/metabolism* ; Pyrazines/pharmacology* ; Microglia/metabolism* ; NF-E2-Related Factor 2/immunology* ; NF-kappa B/immunology* ; Toll-Like Receptor 4/immunology* ; Anti-Inflammatory Agents/pharmacology* ; Humans

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the therapeutic effects and mechanisms of 2,6-dimethoxy-1,4-benzoquinone (2,6-DMBQ) in a mouse model of asthma. METHODS: SPF-grade BALB/c mice were randomly divided into 7 groups (n=8 each group): normal control group, ovalbumin (OVA) group, dimethyl sulfoxide+corn oil group, budesonide (BUD) group, and low, medium, and high dose 2,6-DMBQ groups. An asthma mouse model was established by OVA induction, followed by corresponding drug interventions. Non-invasive lung function tests were performed to measure airway hyperresponsiveness, and enzyme-linked immunosorbent assay was used to determine levels of interleukin (IL)-17, IL-10, and serum immunoglobulin E in bronchoalveolar lavage fluid. A cell counter was employed to detect eosinophil counts in bronchoalveolar lavage fluid, while hematoxylin-eosin staining and periodic acid-Schiff staining were used to assess lung tissue pathological changes. Western blot was conducted to examine the expression of proteins related to the mammalian target of rapamycin pathway (p-AKT/AKT and p-p70S6K/p70S6K), and a fully automated biochemical analyzer was used to evaluate liver and kidney functions. RESULTS: Compared with the normal control group, the OVA group showed increased enhanced pause values, inflammation scores from hematoxylin-eosin staining, positive area from periodic acid-Schiff staining, percentage of eosinophils, IL-17/IL-10 ratio, serum immunoglobulin E levels, and relative expression levels of p-AKT/AKT and p-p70S6K/p70S6K (P<0.05). The BUD group and the medium and high dose 2,6-DMBQ groups exhibited decreased values for these indicators compared to the OVA group (P<0.05). CONCLUSIONS 2,6-DMBQ can inhibit the mTOR pathway to alleviate airway inflammation in asthmatic mice, possibly by mitigating the imbalance between Th17 and regulatory T cells.
Animals ; Asthma/pathology* ; Mice, Inbred BALB C ; Signal Transduction/drug effects* ; Mice ; TOR Serine-Threonine Kinases/physiology* ; Female ; Benzoquinones/pharmacology* ; Immunoglobulin E/blood* ; Interleukin-10/analysis* ; Interleukin-17/analysis* ; Bronchoalveolar Lavage Fluid ; Lung/pathology*

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation