Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

Ureaplasma urealyticum (UU) is one of the most commonly occurring pathogens associated with genital tract infections in infertile males, but the impact of seminal UU infection in semen on intrauterine insemination (IUI) outcomes is poorly understood. We collected data from 245 infertile couples who underwent IUI at The First Affiliated Hospital of USTC (Hefei, China) between January 2021 and January 2023. The subjects were classified into two groups according to their UU infection status: the UU-positive group and the UU-negative group. We compared semen parameters, pregnancy outcomes, and neonatal birth outcomes to investigate the impact of UU infection on IUI outcomes. There were no significantly statistical differences in various semen parameters, including semen volume, sperm concentration, total and progressive motility, sperm morphology, leukocyte count, the presence of anti-sperm antibody, and sperm DNA fragmentation index (DFI), between the UU-positive and UU-negative groups of male infertile patients (all P > 0.05). However, the high DNA stainability (HDS) status of sperm differed between the UU-positive and UU-negative groups, suggesting that seminal UU infection may affect sperm nuclear maturation ( P = 0.04). Additionally, there were no significant differences in pregnancy or neonatal birth outcomes between the two groups (all P > 0.05). These results suggest that IUI remains a viable and cost-effective option for infertile couples with UU infection who are facing infertility issues.
Humans ; Male ; Ureaplasma Infections/complications* ; Female ; Infertility, Male/therapy* ; Ureaplasma urealyticum/isolation & purification* ; Pregnancy ; Adult ; Pregnancy Outcome ; Semen Analysis ; Insemination, Artificial ; Semen/microbiology* ; China

OBJECTIVES: To investigate the expression of soluble factor-related apoptosis ligand (sFasL) in peripheral blood and microRNA-147b (miR-147b) in monocytes in children with sepsis and their value in assessing prognosis. METHODS: A prospective study was conducted on 124 children with sepsis (sepsis group), 60 children with common infections (infection group), and 60 healthy children undergoing physical examinations (healthy control group). The independent risk factors for poor prognosis in children with sepsis were analyzed, and the value of serum sFasL and monocyte miR-147b in predicting poor prognosis in children with sepsis was assessed. RESULTS: The serum level of sFasL and the relative expression of miR-147b in monocytes were highest in the sepsis group, followed by the infection group and the healthy control group (P<0.05). The multivariate logistic regression analysis showed that the serum level of sFasL and the relative expression of miR-147b in monocytes were closely associated with the poor prognosis of children with sepsis (P<0.05). The receiver operating characteristic curve analysis showed that the combination of serum sFasL level and relative expression of miR-147b in monocytes had a larger area under the curve compared to each indicator alone in predicting the prognosis of children with sepsis (P<0.05). CONCLUSIONS There are significant increases in the level of sFasL in peripheral blood and the relative expression of miR-147b in monocytes in children with sepsis. The combined use of these two indicators has relatively high clinical value in assessing the prognosis of children with sepsis.
Humans ; Sepsis/diagnosis* ; MicroRNAs/blood* ; Male ; Female ; Monocytes/metabolism* ; Prognosis ; Child, Preschool ; Prospective Studies ; Child ; Infant ; TNF-Related Apoptosis-Inducing Ligand/blood* ; Logistic Models

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate platelet count trajectories after induction therapy with venetoclax combined with azacitidine (VA regimen) in newly diagnosed AML patients and further analyze its clinical significance. METHODS: Clinical date of 50 newly diagnosed AML patients who received VA treatment from March 2020 to July 2023 in Department of Hematology of the First Hospital of Lanzhou University were retrospectively collected. The platelet trajectories after induction chemotherapy were constructed by using group-based trajectory modeling. To study the association between diverse trajectories of platelet counts and compound complete remission (cCR) rate, overall response rate (ORR), minimal residual disease (MRD) negative rate and overall survival (OS) rate. The Cox proportional hazard model was used to evaluate the relationship between platelet trajectory and OS. The logistic regression was used to analyze the influence of individual characteristics on platelet trajectory. RESULTS: Two platelet trajectories were identified based on the model, including platelet slowly increased group (n=31, 62.0%) and platelet rapidly increased group (n=19, 38.0%). There were statistically significant differences in cCR rate, ORR and OS rate between platelet slowly increased group and platelet rapidly increased group (all P < 0.05). The Cox regression analysis showed that platelet rapidly increased group was associated with a decreased risk of mortality compared with platelet slowly increased group (HR=0.153, 95%CI : 0.045-0.527, P =0.003). Logistic regression analysis showed that IDH1/2 mutation (OR =3.908, 95%CI : 1.023-14.923, P =0.046) and platelet transfusion (OR =0.771, 95%CI : 0.620-0.959, P =0.020) were independent influencing factors of platelet trajectory. CONCLUSION The dynamic trajectory of platelet counts in newly diagnosed AML patients who received VA treatment can serve as a significant indicator to observe the efficacy and prognosis. The platelet rapidly increased is an independent protective factor for good prognosis. TheIDH1 /2 mutation and platelet transfusion are independent influencing factors of platelet trajectory.
Humans ; Leukemia, Myeloid, Acute/blood* ; Sulfonamides/administration & dosage* ; Azacitidine/therapeutic use* ; Platelet Count ; Retrospective Studies ; Bridged Bicyclo Compounds, Heterocyclic/administration & dosage* ; Male ; Female ; Antineoplastic Combined Chemotherapy Protocols/therapeutic use* ; Induction Chemotherapy ; Survival Rate

OBJECTIVE: To analyze the gene mutation characteristics and survival time of patients with newly diagnosed acute myeloid leukemia (AML) based on next-generation sequencing(NGS) gene detection. METHODS: A retrospective analysis was conducted on the clinical data of 92 patients with AML (non APL) admitted to our hospital from January 2018 to May 2022. AML related genes tested were using NGS, the mutation characteristics and survival time of AML patients were analyzed. RESULTS: Among the 92 patients, 41 were males and 51 were females. A total of 38 types of gene mutations were detected. Six-two patients carried at least one gere mutation, while no gene mutations were detected in 30 patients. In the group with favourable prognosis (n =14), the frequencies of higher gene mutations were NRAS, KIT (21.43%, n =3), KRAS (14.29%, n =2). In the group with intermediate prognosis (n =64), the gene mutation frequencies from high to low were DNMT3A (18.75%, n =12), NPM1 (17.19%, n =11), IDH2, FLT3-ITD, CEBPA (12.50%, n =8), TET2 (10.94%, n =7). In the poor prognosis group (n =14), ASXL1, TP53, EZH2, NRAS had higher gene mutation frequency than others(14.29 %, n =2 ). Statistical analysis revealed that KIT had a relative hotspot of mutations in the intermediate-risk group, and DNMT3A had a relative hotspot of mutations in the high-risk group (P < 0.05). The correlation analysis of genes with high mutation rates in different prognostic groups, such as NRAS, KIT, IDH2, DNMT3A, NPM1, and FLT3-ITD, with prognosis found that KIT was a factor affecting OS (P < 0.05), while no significant differences were observed for the others(P >0.05). CONCLUSION The frequency of gene mutations is high in AML patients, 67.4% of the patients carried at least one gene mutation. The mutation frequency varies among different genes in patients with different karyotypes, and there are obvious dominant mutations. KIT and DNMT3A can be used as factors for evaluating the prognosis of AML.
Humans ; Leukemia, Myeloid, Acute/genetics* ; Nucleophosmin ; Mutation ; Prognosis ; Retrospective Studies ; Male ; Female ; High-Throughput Nucleotide Sequencing ; Middle Aged ; DNA Methyltransferase 3A ; Adult ; Aged ; Survival Analysis ; Proto-Oncogene Proteins c-kit/genetics*

OBJECTIVE: To investigate the clinical characteristics, treatment and prognosis of adult AML patients with NUP98::HOXA9 fusion gene. METHODS: From May 2017 to October 2023， among 2 113 AML patients who visited the Hematology Department of our hospital, patients with NUP98 rearrangements were screened. The clinical characteristics, chromosome karyotypes, immunophenotypes, gene mutations, treatment efficacy and prognosis of the patients with NUP98::HOXA9 positive were analyzed. RESULTS: Among the 2 113 AML patients, there were 18 cases with NUP98 rearrangement, including 14 NUP98::HOXA9 positive cases, with a detection rate of 0.66% (14/2 113). The median age of the NUP98::HOXA9 positive patients was 42.5 (23-64) years old. The most common chromosome karyotype was t(7; 11)(p15; p15). The immunophenotypes of all patients expressed CD13, CD33, CD117 and CD38, and most patients expressed CD34 and cMPO, while only a few expressed HLA-DR. Second-generation sequencing (NGS) was performed to detect genetic mutations associated with leukemia in all 14 patients, and the genes exhibiting a high frequency of mutation were WT1 (10/14), TET2 (7/14), and FLT3-ITD (6/14). Additionally, mutations were also observed in KRAS/NRAS, IDH1, and KIT. Of the 13 patients who received treatment, 9 achieved complete remission (CR), and all 3 patients who received azacytidine(AZA)+ venetoclax (VEN) regimen achieved CR after the first course of treatment. Within this cohort, 6 patients were classified as relapsed/refractory (6/13). 4 patients underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT), of which two achieved long-term survival. The median follow-up time was 12 (2.1-65.0) months, while the median overall survival (OS) and relapse-free survival (RFS) were recorded as 11.4 months and 9.6 months, respectively. CONCLUSION The most common type of NUP98 rearrangement in adults AML patients is NUP98::HOXA9 , which is often accompanied by somatic mutations in WT1, TET2, and FLT3-ITD. These patients are prone to relapse, have short survival time, and generally face poor prognoses. Hopefully, utilization of the AZA+VEN regimen is anticipated to enhance the rate of induced remission in the patients, and some patients may prolong their survival through allo-HSCT. However, more effective treatment methods are still needed to improve the overall prognosis of these patients.
Humans ; Adult ; Leukemia, Myeloid, Acute/genetics* ; Middle Aged ; Prognosis ; Nuclear Pore Complex Proteins/genetics* ; Oncogene Proteins, Fusion/genetics* ; Mutation ; Male ; Female ; Young Adult ; Homeodomain Proteins/genetics*

OBJECTIVE: To explore the preventive and therapeutic effects of Dahuang Zhechong Pill (DZP) on pulmonary fibrosis and the underlying mechanisms. METHODS: The first key rate-limiting enzyme hexokinase 2 (HK2) of glycolysis was silenced and over-expressed through small interfering RNA and lentivirus using lung fibroblast MRC-5 cell line, respectively. The cell viability, migration, invasion and proliferation were detected by cell counting kit-8, wound healing assay, transwell assay, and flow cytometry. The mRNA and protein expression levels of HK2 were detected by RT-PCR and Western blotting, respectively. The contents of glucose, adenosine triphosphate (ATP) and lactate in MRC-5 cells were determined by enzyme-linked immunosorbnent assay (ELISA). Then, the relationship between miR-29b-2-5p and HK2 was explored by luciferase reporter gene assay. Pulmonary fibrosis cell model was induced by transforming growth factor-β 1 (TGF-β 1) in MRC-5 cells, and the medicated serum of DZP (DMS) was prepared in rats. MRC-5 cells were divided into control, TGF-β 1, TGF-β 1+10% DMS, TGF-β 1+10% DMS+miR-29b-2-5p inhibitor, TGF-β 1+10% DMS+inhibitor negative control, TGF-β 1+10% DMS+miR-29b-2-5p mimic and TGF-β 1+10% DMS+mimic negative control groups. After miR-29b-2-5p mimics and inhibitors were transfected into MRC-5 cells, all groups except control and model group were treated with DMS. The effect of DMS on MRC-5 cells were detected using aforementioned methods and immunofluorescence. Similarly, the contents of glucose, ATP and lactate in each group were measured by ELISA. RESULTS: The mRNA and protein expressions of HK2 in MRC-5 cells were successfully silenced and overexpressed through si-HK2-3 and lentiviral transfection, respectively. After silencing HK2, the mRNA and protein expressions of HK2 were significantly decreased (P<0.01), and the concentrations of glucose, ATP and lactate were also significantly decreased (P<0.05). The proliferation, migration and invasion of MRC-5 cells were significantly declined (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly increased (P<0.01). After overexpressing HK2, the mRNA and protein expressions of HK2 were significantly increased (P<0.05), and the concentrations of glucose, ATP and lactate were also significantly increased (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were significantly increased (P<0.05 or P<0.01), while the apoptosis of MRC-5 cells was significantly decreased (P<0.05). The relative luciferase activity of 3'UTR-WT+hsa-miR-29b-2-5p transfected with HK2 was significantly decreased (P<0.01). After miR-29b-2-5p mimic and inhibitor were transfected into the MRC-5 cells, DMS intervention could significantly reduce the concentration of glucose, ATP and lactate, and the mRNA and proteins expressions of HK2, phosphofructokinase and pyruvate kinase isoform M2 (P<0.05 or P<0.01). The proliferation, migration and invasion of MRC-5 cells were alleviated (P<0.05 or P<0.01), and the deposition of fibronectin, α-smooth muscle actin, and collagen I were significantly decreased (P<0.05 or P<0.01). CONCLUSIONS Glycolysis is closely related to pulmonary fibrosis. DZP reduced glycolysis and inhibited fibroblasts' excessive differentiation and abnormal collagen deposition through the miR-29b-2-5p/HK2 pathway, which played a role in delaying the process of pulmonary fibrosis.
MicroRNAs/genetics* ; Glycolysis/genetics* ; Animals ; Pulmonary Fibrosis/metabolism* ; Humans ; Drugs, Chinese Herbal/therapeutic use* ; Hexokinase/genetics* ; Cell Line ; Cell Proliferation/drug effects* ; Rats, Sprague-Dawley ; Rats ; Cell Movement/drug effects* ; Male ; Cell Survival/drug effects* ; Signal Transduction/drug effects*

OBJECTIVE: To identify the underlying mechanism by which quercetin (Que) alleviates sepsis-related acute respiratory distress syndrome (ARDS). METHODS: In vivo, C57BL/6 mice were assigned to sham, cecal ligation and puncture (CLP), and CLP+Que (50 mg/kg) groups (n=15 per group) by using a random number table. The sepsisrelated ARDS mouse model was established using the CLP method. In vitro, the murine alveolar macrophages (MH-S) cells were classified into control, lipopolysaccharide (LPS), LPS+Que (10 μmol/L), and LPS+Que+acetylcysteine (NAC, 5 mmol/L) groups. The effect of Que on oxidative stress, inflammation, and apoptosis in mice lungs and MH-S cells was determined, and the mechanism with reactive oxygen species (ROS)/p38 mitogen-activated protein kinase (MAPK) pathway was also explored both in vivo and in vitro. RESULTS: Que alleviated lung injury in mice, as reflected by a reversal of pulmonary histopathologic changes as well as a reduction in lung wet/dry weight ratio and neutrophil infiltration (P<0.05 or P<0.01). Additionally, Que improved the survival rate and relieved gas exchange impairment in mice (P<0.01). Que treatment also remarkedly reduced malondialdehyde formation, superoxide dismutase and catalase depletion, and cell apoptosis both in vivo and in vitro (P<0.05 or P<0.01). Moreover, Que treatment diminished the release of inflammatory factors interleukin (IL)-1β, tumor necrosis factor-α, and IL-6 both in vivo and in vitro (P<0.05 or P<0.01). Mechanistic investigation clarifified that Que administration led to a decline in the phosphorylation of p38 MAPK in addition to the suppression of ROS expression (P<0.01). Furthermore, in LPS-induced MH-S cells, ROS inhibitor NAC further inhibited ROS/p38 MAPK pathway, as well as oxidative stress, inflammation, and cell apoptosis on the basis of Que treatment (P<0.05 or P<0.01). CONCLUSION Que was found to exert anti-oxidative, anti-inflammatory, and anti-apoptotic effects by suppressing the ROS/p38 MAPK pathway, thereby conferring protection for mice against sepsis-related ARDS.
Animals ; Sepsis/drug therapy* ; Quercetin/therapeutic use* ; Respiratory Distress Syndrome/enzymology* ; p38 Mitogen-Activated Protein Kinases/metabolism* ; Mice, Inbred C57BL ; Reactive Oxygen Species/metabolism* ; Apoptosis/drug effects* ; Male ; Oxidative Stress/drug effects* ; MAP Kinase Signaling System/drug effects* ; Lung/drug effects* ; Mice ; Lipopolysaccharides ; Macrophages, Alveolar/pathology* ; Inflammation/pathology* ; Protective Agents/therapeutic use*

Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics* ; Humans ; Chromatin/genetics* ; Animals ; Binding Sites ; Mice ; DNA Footprinting/methods*