Buyang Huanwu Decoction(BYHWD), as one of the classic formulas in traditional Chinese medicine(TCM) for the treatment of cerebral ischemic stroke(CIS), has demonstrated definite effects in clinical practice. However, the material basis and mechanism of treatment have not been systematically elucidated. This study employed network pharmacology and molecular docking to analyze the potential targets and mechanisms of blood-and brain-penetrating active components of BYHWD in reducing cell apoptosis in CIS. Cell experiments were then carried out to validate the prediction results. In the experiments, five active components including hydroxysafflor yellow A( HSYA), tetramethylpyrazine( TMP), astragaloside Ⅳ( AS-Ⅳ), amygdalin( AMY), and paeoniflorin(PF) were selected to explore the pharmacological effects of BYHWD. HT22 cells were treated with BYHWD, and the cell counting kit-8(CCK-8) method was employed to examine the toxic and side effects of BYHWD. A cell model of oxygen-glucose deprivation/reoxygenation( OGD/R) was constructed, with apoptosis and pyroptosis as the main screening indicators. The levels of lactate dehydrogenase(LDH) and glutathione(GSH) were measured to assess the cell membrane integrity. Flow cytometry was employed to detect apoptosis, and the activities of caspase-3 and caspase-1 were measured to clarify the status of apoptosis and pyroptosis. ELISA was employed to determine the levels of interleukin(IL)-1β and IL-18 to confirm pyroptosis. HSYA and AMY were identified in this study as the active components regulating apoptosis and pyroptosis. TUNEL was employed to detect the apoptosis rate, and Western blot was employed to determine the expression levels of apoptosis-related proteins B-cell lymphoma-2(Bcl-2), Bcl-2-associated X protein(Bax), and caspase-3, which confirmed that the anti-apoptotic effect of the combined component group was superior to that of the single component groups. The molecular docking results revealed strong binding affinity of HSYA and AMY with SDF-1α and CXCR4.AMD3100, a selective antagonist of CXCR4, was then used for intervention. The results of Western blot showed alterations in the expression levels of apoptosis-associated proteins, SDF-1α, and CXCR4. In conclusion, HSYA and AMY influence cellular apoptosis by modulating the SDF-1α/CXCR4 signaling cascade.
Drugs, Chinese Herbal/chemistry* ; Apoptosis/drug effects* ; Animals ; Neurons/cytology* ; Mice ; Molecular Docking Simulation ; Cell Line ; Glucose/metabolism* ; Humans ; Neuroprotective Agents/pharmacology*

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

This study aims to explore the effects and action mechanisms of the active ingredients in Buyang Huanwu Decoction(BYHWD), namely tetramethylpyrazine(TMP) and hydroxy-safflor yellow A(HSYA), on oxygen-glucose deprivation/reglucose-reoxygenation(OGD/R)-induced inflammation and oxidative stress of microglia(MG). Network pharmacology was used to screen the effective monomer ingredients of BYHWD and determine the safe concentration range for each component. Inflammation and oxidative stress models were established to further screen the best ingredient combination and optimal concentration ratio with the most effective anti-inflammatory and antioxidant effects. OGD/R BV2 cell models were constructed, and BV2 cells in the logarithmic growth phase were divided into a normal group, a model group, an HSYA group, a TMP group, and an HSYA + TMP group. Enzyme-linked immunosorbent assay(ELISA) was used to detect the levels of inflammatory cytokines such as interleukin-1β(IL-1β), tumor necrosis factor-α(TNF-α), and interleukin-6(IL-6). Oxidative stress markers, including superoxide dismutase(SOD), nitric oxide(NO), and malondialdehyde(MDA), were also measured. Western blot was used to analyze the protein expression of both inflammation-related pathway [Toll-like receptor 4(TLR4)/nuclear factor-kappa B(NF-κB)] and oxidative stress-related pathway [nuclear factor erythroid 2-related factor 2(Nrf2)/heme oxygenase-1(HO-1)]. Immunofluorescence was used to assess the expression of proteins such as inducible nitric oxide synthase(iNOS) and arginase-1(Arg-1). The most effective ingredients for anti-inflammatory and antioxidant effects in BYHWD were TMP and HSYA. Compared to the normal group, the model group showed significantly increased levels of IL-1β, TNF-α, IL-6, NO, and MDA, along with significantly higher protein expression of NF-κB, TLR4, Nrf2, and HO-1 and significantly lower SOD levels. The differences between the two groups were statistically significant. Compared to the model group, both the HSYA group and the TMP group showed significantly reduced levels of IL-1β, TNF-α, IL-6, NO, and MDA, lower expression of NF-κB and TLR4 proteins, higher levels of SOD, and significantly increased protein expression of Nrf2 and HO-1. Additionally, the expression of the M1-type MG marker iNOS was significantly reduced, while the expression of the M2-type MG marker Arg-1 was significantly increased. The results of the HSYA group and the TMP group had statistically significant differences from those of the model group. Compared to the HSYA group and the TMP group, the HSYA + TMP group showed further significant reductions in IL-1β, TNF-α, IL-6, NO, and MDA levels, along with significant reductions in NF-κB and TLR4 protein expression, an increase in SOD levels, and elevated Nrf2 and HO-1 protein expression. Additionally, the expression of the M1-type MG marker iNOS was reduced, while the M2-type MG marker Arg-1 expression increased significantly in the HSYA + TMP group compared to the TMP or HSYA group. The differences in the results were statistically significant between the HSYA + TMP group and the TMP or HSYA group. The findings indicated that the combined use of HSYA and TMP, the active ingredients of BYHWD, can effectively inhibit OGD/R-induced inflammation and oxidative stress of MG, showing superior effects compared to the individual use of either component.
Oxidative Stress/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Mice ; Glucose/metabolism* ; Cell Line ; Inflammation/genetics* ; Oxygen/metabolism* ; Pyrazines/pharmacology* ; Microglia/metabolism* ; NF-E2-Related Factor 2/immunology* ; NF-kappa B/immunology* ; Toll-Like Receptor 4/immunology* ; Anti-Inflammatory Agents/pharmacology* ; Humans

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon gene (STING) signaling pathway is a crucial component of the immune system. It detects abnormal cytosolic double-stranded DNA and promotes the expression of type I interferons and other inflammatory factors, thereby protecting the body from pathogenic infections. In children, an immature immune system or genetic mutations can lead to immune dysregulation, increasing the risk of autoimmune diseases (AID) and autoinflammatory diseases. Recent studies have shown that aberrant activation of the cGAS-STING signaling pathway is associated with the development of AID and autoinflammatory diseases in children. This review summarizes the research progress on the cGAS-STING signaling pathway in childhood AID and autoinflammatory diseases, aiming to provide new directions for clinical diagnosis and treatment.
Humans ; Nucleotidyltransferases/physiology* ; Membrane Proteins/physiology* ; Signal Transduction/physiology* ; Child ; Autoimmune Diseases/immunology* ; Inflammation/etiology*

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

OBJECTIVE: To explore the significance of the plasma cell percentage and immature plasma cells in the prognosis of patients with multiple myeloma (MM). METHODS: The clinical data of 126 newly diagnosed MM patients in Gansu Provincial Hospital from June 2017 to November 2022 were retrospectively analyzed. The enrolled patients were divided into a higher plasma cell percentage group (group A) and a lower plasma cell percentage group (group B) according to the median plasma cell percentage (33.5%). The clinicopathological data of the two groups were compared, and the effect of plasma cell percentage on the prognosis of MM patients was analyzed using survival curves. On this basis, group A and group B were divided into subgroups with immature plasma cells (A1 group, B1 group) and subgroups without immature plasma cells (A2 group, B2 group), respectively, then the survival curves were used to analyze the effect of immature plasma cells on the prognosis of MM patients. RESULTS: Among the 126 patients with MM, the proportions of patients with ISS stage III, elevated β₂-microglobulin(β₂-MG) level, and immature plasma cells in Group A were significantly higher compared those in Group B ( P =0.015, P =0.028, P =0.010). The median overall survival(OS) and progression-free survival(PFS) of group A were 32 months and 10 months, respectively. The median OS of group B was not reached, and the median PFS was 32 months. The 3-year OS rates of patients in group A and group B were 46.7% and 62.2%, respectively ( P =0.021), and the 3-year PFS were 29.2% and 42.5%, respectively ( P =0.033). There were no significant differences in OS and PFS between group A1 and group A2, or between group B1 and group B2 ( P >0.05). Multivariate COX survival analysis showed that the plasma cell percentage ≥33.5%（HR=1.253, 95%CI : 0.580-2.889, P =0.018）, age ≥65 years (HR=2.206, 95%CI : 1.170-3.510, P =0.012), lactate dehydrogenase(LDH) ≥250 U/L (HR=1.180, 95%CI : 0.621-2.398, P =0.048) and β₂-MG ≥3.5 mg/L (HR=1.507, 95%CI : 0.823-3.657, P =0.036) were independent risk factors affecting OS in MM patients. CONCLUSION MM patients with a higher plasma cell percentage (≥33.5%) at the initial diagnosis have a later disease stage, poorer OS and PFS, compared to the patients with a lower percentage(<33.5%) of plasma cells. The presence or absence of immature plasma cells has no significant impact on the survival of MM patients.
Humans ; Multiple Myeloma/pathology* ; Prognosis ; Plasma Cells/cytology* ; Retrospective Studies ; Male ; Female ; Middle Aged ; Aged ; Bone Marrow

OBJECTIVE: To analyze the RHD genotyping and sequencing results of RhD serology negative samples in the clinic, and to further explore the laboratory methods for RhD detection, in order to provide a basis for clinical precision blood transfusion. METHODS: A total of 27 200 whole blood samples were screened for RhD blood group antigen using microcolumn gel card method.Serologic RhD-negative confirmation tests were performed on blood samples that were negative for RhD on initial screening using three different clonal strains of IgG anti-D reagents. The 10 exons of the RHD gene on chromosome 1 were also analyzed by PCR-SSP to determine RHD genotyping.When the PCR-SSP method did not yield definitive results, the RHD gene of the sample was analyzed by the third-generation sequencing. RESULTS: The results of the initial screening test by the microcolumn gel card method showed that 136 of the 27 200 samples were RhD-negative, of which 86 underwent RhD-negative confirmation testing and RHD genotyping, 88.37% (76/86 cases) of the RhD-negative confirmation test results were negative for the three anti-D reagents, and the results of RHD genotyping showed that 67.44% (58/86 cases) of the cases had a complete deletion of 10 exons, and the remaining 28 cases were RHD*711delC (1 case), RHD*D-CE(1-9)-D (1 case), RHD*D-CE(2-9-)D (2 cases), RHD*D-CE(3-9)-D (4 cases), RHD*DEL1 (c.1227G >A) mutation (16 cases), RHD*weak partial 15(845G >A) mutation (3 cases), and a mutation of c.165C >T base was found in 1 sample by three-generation sequencing. CONCLUSION RHD genotype testing of samples that are serologically negative for RhD antigen shows that some of the samples have RHD gene variants, not all of which are total deletions of RHD, suggesting that there are some limitations of the serologic method for RhD detection. Due to the polymorphism of the RHD gene structure, different RhD variants present different serologic features, which need to be further detected in combination with molecular biology testing, especially for the identification of Asian-type DELs, which is important for clinical precision blood transfusion.
Humans ; Rh-Hr Blood-Group System/genetics* ; Genotype ; Polymerase Chain Reaction ; Exons ; Blood Grouping and Crossmatching