1.Association between nocturnal blood pressure decline rate and the risk of chronic heart failure
Ting BAI ; Juan XIAO ; Bei XING ; Xuan LUO ; Bin YAN
Journal of Xi'an Jiaotong University(Medical Sciences) 2025;46(1):144-148
Objective To explore the association between nocturnal blood pressure decline rate and chronic heart failure(CHF).Methods In this study,a total of 711 individuals who underwent 24-h ambulatory blood pressure monitoring were divided into control group(n=433)and CHF group(n=278).The characteristics of the study population and nocturnal blood pressure decline rate were compared between CHF group and control group.Restricted spline analysis was utilized to examine the linear or non-linear association between nocturnal blood pressure decline rate and the prevalence of CHF.The relationship between nocturnal blood pressure decline rate and CHF was further investigated based on multivariable Logistic regression model.Results Nocturnal systolic blood pressure decline rate was significantly different in CHF group and control group[(3.3±7.1)mmHg vs.(5.0+6.7)mmHg,P=0.001].No significant difference in nocturnal diastolic blood pressure was found between the two groups[(5.7±7.6)mmHg vs.(6.8±7.2)mmHg,P=0.061].Restricted spline analysis showed a significant linear association between nocturnal systolic blood pressure decline rate and CHF risk.After adjusting for age,sex,smoking,body mass index,24-hour systolic blood pressure,24-hour diastolic blood pressure,type 2 diabetes mellitus and hyperlipidemia,multivariate Logistic regression analysis revealed that nocturnal systolic blood pressure decline rate was negatively associated with the prevalence of CHF(OR=0.97,95%CI:0.95-0.99;P=0.010).However,no significant association was found between nocturnal diastolic blood pressure decline rate and CHF risk.Conclusion Nocturnal systolic blood pressure decline rate is associated with the prevalence of CHF.Individuals with decreased nocturnal systolic blood pressure decline have a significantly increased risk of CHF.
2.Oxymatrine, a novel TLR2 agonist, promotes megakaryopoiesis and thrombopoiesis through the STING/NF-κB pathway.
Chengyang NI ; Ling ZHOU ; Shuo YANG ; Mei RAN ; Jiesi LUO ; Kui CHENG ; Feihong HUANG ; Xiaoqin TANG ; Xiang XIE ; Dalian QIN ; Qibing MEI ; Long WANG ; Juan XIAO ; Jianming WU
Journal of Pharmaceutical Analysis 2025;15(1):101054-101054
Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Ferrum@albumin assembled nanoclusters inhibit NF-κB signaling pathway for NIR enhanced acute lung injury immunotherapy.
Xiaoxuan GUAN ; Binbin ZOU ; Weiqian JIN ; Yan LIU ; Yongfeng LAN ; Jing QIAN ; Juan LUO ; Yanjun LEI ; Xuzhi LIANG ; Shiyu ZHANG ; Yuting XIAO ; Yan LONG ; Chen QIAN ; Chaoyu HUANG ; Weili TIAN ; Jiahao HUANG ; Yongrong LAI ; Ming GAO ; Lin LIAO
Acta Pharmaceutica Sinica B 2025;15(11):5891-5907
Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe3O4 loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4+/CD8+ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.
5.Oxymatrine,a novel TLR2 agonist,promotes megakaryopoiesis and thrombopoiesis through the STING/NF-κB pathway
Chengyang NI ; Ling ZHOU ; Shuo YANG ; Mei RAN ; Jiesi LUO ; Kui CHENG ; Feihong HUANG ; Xiaoqin TANG ; Xiang XIE ; Dalian QIN ; Qibing MEI ; Long WANG ; Juan XIAO ; Jianming WU
Journal of Pharmaceutical Analysis 2025;15(1):208-229
Radiation-induced thrombocytopenia(RIT)faces a perplexing challenge in the clinical treatment of cancer patients,and current therapeutic approaches are inadequate in the clinical settings.In this research,oxy-matrine,a new molecule capable of healing RIT was screened out,and the underlying regulatory mecha-nism associated with magakaryocyte(MK)differentiation and thrombopoiesis was demonstrated.The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro.The ability to induce thrombopoiesis was subsequently demonstrated in Tg(cd41:enhanced green fluorescent protein(eGFP))zebrafish and RIT model mice.In addition,we carried out network pharmacological pre-diction,drug affinity responsive target stability assay(DARTS)and cellular thermal shift assay(CETSA)analyses to explore the potential targets of oxymatrine.Moreover,the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes(KEGG)enrichment analyses,Western blot(WB),and immunofluorescence.Oxymatrine markedly promoted MK differentiation and maturation in vitro.Moreover,oxymatrine induced thrombopoiesis in Tg(cd41:eGFP)zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice.Mechanistically,oxymatrine directly binds to toll-like receptor 2(TLR2)and further regulates the downstream pathway stimulator of interferon genes(STING)/nuclear factor-kappaB(NF-κB),which can be blocked by C29 and C-176,which are specific inhibitors of TLR2 and STING,respectively.Taken together,we demonstrated that oxymatrine,a novel TLR2 agonist,plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis,suggesting that oxymatrine is a promising candidate for RIT therapy.
6.Study on the distribution of FMR1 CGG repeat numbers among 16 610 women of childbearing age in China
Yahui SHEN ; Wei HOU ; Xiaolin FU ; Manli ZHANG ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Rui XIAO ; Yanping LU
Chinese Journal of Reproduction and Contraception 2025;45(4):398-402
Objective:To investigate the distribution of CGG repeat numbers in the FMR1 gene among reproductive-age women in China, providing data reference for carrier screening and genetic counseling of Fragile X syndrome. Methods:This cross-sectional study recruited 16 610 reproductive-age women from 12 medical institutions between July 2022 and October 2023. Peripheral venous blood samples (3 mL) were collected, and genomic DNA was extracted. The number of CGG repeats in the FMR1 gene was determined using the triplet-primed polymerase chain reaction (TP-PCR) combined with capillary electrophoresis technology. Statistical analyses were performed to assess the prevalence and distribution of CGG repeat expansions. Results:Among 16 610 women of childbearing age, 5 684 (34.220%) women had the same number of CGG repeats in the two alleles of FMR1 gene, and 10 926 (65.780%) women had different numbers of repeats in the two alleles. Among the 33 220 FMR1 alleles in 16 610 women of reproductive age, the most common CGG repeat numbers were 29 [48.645% (16 160/33 220)] and 30 [26.276% (8 729/33 220)], while the most frequent CGG genotype was CGG 29/29 [24.726% (4 107/16 610)]. The CGG repeat numbers of FMR1 gene were normal in 16 498 women (99.326%). Among the 112 women (0.674%) with CGG repeat abnormities, 96 (0.578%) women were classified as intermediate carriers, 15 (0.090%) as premutation carriers, and 1 (0.006%) as a full mutation carrier, whose CGG genotype was (36, >200). Conclusion:In the general reproductive-age female population in China, the normal CGG repeat numbers of the FMR1 gene account for 99.326%, while the intermediate carrier rate is 0.578%, and the combined carrier rate of the premutation and full mutation types is 0.096%.
7.Study on the distribution of FMR1 CGG repeat numbers among 16 610 women of childbearing age in China
Yahui SHEN ; Wei HOU ; Xiaolin FU ; Manli ZHANG ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Rui XIAO ; Yanping LU
Chinese Journal of Reproduction and Contraception 2025;45(4):398-402
Objective:To investigate the distribution of CGG repeat numbers in the FMR1 gene among reproductive-age women in China, providing data reference for carrier screening and genetic counseling of Fragile X syndrome. Methods:This cross-sectional study recruited 16 610 reproductive-age women from 12 medical institutions between July 2022 and October 2023. Peripheral venous blood samples (3 mL) were collected, and genomic DNA was extracted. The number of CGG repeats in the FMR1 gene was determined using the triplet-primed polymerase chain reaction (TP-PCR) combined with capillary electrophoresis technology. Statistical analyses were performed to assess the prevalence and distribution of CGG repeat expansions. Results:Among 16 610 women of childbearing age, 5 684 (34.220%) women had the same number of CGG repeats in the two alleles of FMR1 gene, and 10 926 (65.780%) women had different numbers of repeats in the two alleles. Among the 33 220 FMR1 alleles in 16 610 women of reproductive age, the most common CGG repeat numbers were 29 [48.645% (16 160/33 220)] and 30 [26.276% (8 729/33 220)], while the most frequent CGG genotype was CGG 29/29 [24.726% (4 107/16 610)]. The CGG repeat numbers of FMR1 gene were normal in 16 498 women (99.326%). Among the 112 women (0.674%) with CGG repeat abnormities, 96 (0.578%) women were classified as intermediate carriers, 15 (0.090%) as premutation carriers, and 1 (0.006%) as a full mutation carrier, whose CGG genotype was (36, >200). Conclusion:In the general reproductive-age female population in China, the normal CGG repeat numbers of the FMR1 gene account for 99.326%, while the intermediate carrier rate is 0.578%, and the combined carrier rate of the premutation and full mutation types is 0.096%.
8.A Novel Scorpion Toxin LmKTx13 Inhibits the Voltage-gated Potassium Channel Kv1.3
Jia-Xin QIN ; Xiao-Qing LUO ; Min-Juan LU ; Jun-Xian JU ; Qing ZHOU ; Wen-Xing WANG ; Zhong-Hua LIU ; Min-Zhi CHEN ; Xi ZHOU
Chinese Journal of Biochemistry and Molecular Biology 2025;41(10):1392-1401
Kv1.3,a voltage-gated potassium channel,is highly expressed in T lymphocytes,the nervous system,and vascular smooth muscle cells.It plays a critical role in membrane excitability and electrical signal transduction,serving as an important target for studying T-cell function and providing a promising direction for developing therapeutics against autoimmune and inflammatory diseases.Therefore,the de-velopment of specific inhibitors of Kv1.3 channel has emerged as a novel therapeutic strategy for these disorders.In this study,we isolated and purified a novel Kv1.3-inhibitory peptide toxin,LmKTx13,from the venom of the scorpion Lychas mucronatus using reversed-phase high-performance liquid chroma-tography(RP-HPLC).LmKTx13 consists of 38 amino acid residues,including six cysteines that form three disulfide bonds.Whole-cell patch-clamp recordings revealed that LmKTx13 potently inhibited Kv1.3 with an IC50 of 7.92±3.0 nmol/L.Selectivity analysis showed that 2 μmol/L LmKTx13 also in-hibited Kv1.2 and Kv1.7,but exhibited no significant effects on other potassium channel subtypes or voltage-gated sodium channels.Further investigation into the mechanism demonstrated that LmKTx13 acts as a pore-blocking inhibitor of Kv1.3.By analyzing the effects of LmKTx13 on Kv1.3 channel gating ki-netics and performing sequence alignment of the pore regions of Kv1.3 and Kv1.5,we constructed site-directed mutants and identified the pore region of Kv1.3 as the critical binding site for LmKTx13.Key residues involved in the interaction included T425,G427,and H451.In summary,we discovered a no-vel pore-blocking Kv1.3 inhibitor,LmKTx13,from L.mucronatus venom,which exhibits high affinity and selectivity for Kv1.3.These findings highlight its potential as a potential lead molecule for developing Kv1.3-targeted therapeutics.
9.A Novel Scorpion Toxin LmKTx13 Inhibits the Voltage-gated Potassium Channel Kv1.3
Jia-Xin QIN ; Xiao-Qing LUO ; Min-Juan LU ; Jun-Xian JU ; Qing ZHOU ; Wen-Xing WANG ; Zhong-Hua LIU ; Min-Zhi CHEN ; Xi ZHOU
Chinese Journal of Biochemistry and Molecular Biology 2025;41(10):1392-1401
Kv1.3,a voltage-gated potassium channel,is highly expressed in T lymphocytes,the nervous system,and vascular smooth muscle cells.It plays a critical role in membrane excitability and electrical signal transduction,serving as an important target for studying T-cell function and providing a promising direction for developing therapeutics against autoimmune and inflammatory diseases.Therefore,the de-velopment of specific inhibitors of Kv1.3 channel has emerged as a novel therapeutic strategy for these disorders.In this study,we isolated and purified a novel Kv1.3-inhibitory peptide toxin,LmKTx13,from the venom of the scorpion Lychas mucronatus using reversed-phase high-performance liquid chroma-tography(RP-HPLC).LmKTx13 consists of 38 amino acid residues,including six cysteines that form three disulfide bonds.Whole-cell patch-clamp recordings revealed that LmKTx13 potently inhibited Kv1.3 with an IC50 of 7.92±3.0 nmol/L.Selectivity analysis showed that 2 μmol/L LmKTx13 also in-hibited Kv1.2 and Kv1.7,but exhibited no significant effects on other potassium channel subtypes or voltage-gated sodium channels.Further investigation into the mechanism demonstrated that LmKTx13 acts as a pore-blocking inhibitor of Kv1.3.By analyzing the effects of LmKTx13 on Kv1.3 channel gating ki-netics and performing sequence alignment of the pore regions of Kv1.3 and Kv1.5,we constructed site-directed mutants and identified the pore region of Kv1.3 as the critical binding site for LmKTx13.Key residues involved in the interaction included T425,G427,and H451.In summary,we discovered a no-vel pore-blocking Kv1.3 inhibitor,LmKTx13,from L.mucronatus venom,which exhibits high affinity and selectivity for Kv1.3.These findings highlight its potential as a potential lead molecule for developing Kv1.3-targeted therapeutics.
10.Association between nocturnal blood pressure decline rate and the risk of chronic heart failure
Ting BAI ; Juan XIAO ; Bei XING ; Xuan LUO ; Bin YAN
Journal of Xi'an Jiaotong University(Medical Sciences) 2025;46(1):144-148
Objective To explore the association between nocturnal blood pressure decline rate and chronic heart failure(CHF).Methods In this study,a total of 711 individuals who underwent 24-h ambulatory blood pressure monitoring were divided into control group(n=433)and CHF group(n=278).The characteristics of the study population and nocturnal blood pressure decline rate were compared between CHF group and control group.Restricted spline analysis was utilized to examine the linear or non-linear association between nocturnal blood pressure decline rate and the prevalence of CHF.The relationship between nocturnal blood pressure decline rate and CHF was further investigated based on multivariable Logistic regression model.Results Nocturnal systolic blood pressure decline rate was significantly different in CHF group and control group[(3.3±7.1)mmHg vs.(5.0+6.7)mmHg,P=0.001].No significant difference in nocturnal diastolic blood pressure was found between the two groups[(5.7±7.6)mmHg vs.(6.8±7.2)mmHg,P=0.061].Restricted spline analysis showed a significant linear association between nocturnal systolic blood pressure decline rate and CHF risk.After adjusting for age,sex,smoking,body mass index,24-hour systolic blood pressure,24-hour diastolic blood pressure,type 2 diabetes mellitus and hyperlipidemia,multivariate Logistic regression analysis revealed that nocturnal systolic blood pressure decline rate was negatively associated with the prevalence of CHF(OR=0.97,95%CI:0.95-0.99;P=0.010).However,no significant association was found between nocturnal diastolic blood pressure decline rate and CHF risk.Conclusion Nocturnal systolic blood pressure decline rate is associated with the prevalence of CHF.Individuals with decreased nocturnal systolic blood pressure decline have a significantly increased risk of CHF.

Result Analysis
Print
Save
E-mail