1.Application of 3D-printed auxiliary guides in adolescent scoliosis surgery.
Dong HOU ; Jian-Tao WEN ; Chen ZHANG ; Jin HUANG ; Chang-Quan DAI ; Kai LI ; Han LENG ; Jing ZHANG ; Shao-Bo YANG ; Xiao-Juan CUI ; Juan WANG ; Xiao-Yun YUAN
China Journal of Orthopaedics and Traumatology 2025;38(11):1119-1125
OBJECTIVE:
To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents.
METHODS:
A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire.
RESULTS:
A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05).
CONCLUSION
In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans
;
Male
;
Scoliosis/surgery*
;
Female
;
Adolescent
;
Printing, Three-Dimensional
;
Retrospective Studies
;
Pedicle Screws
;
Child
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
4.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies
5.Genome-wide investigation of transcription factor footprints and dynamics using cFOOT-seq.
Heng WANG ; Ang WU ; Meng-Chen YANG ; Di ZHOU ; Xiyang CHEN ; Zhifei SHI ; Yiqun ZHANG ; Yu-Xin LIU ; Kai CHEN ; Xiaosong WANG ; Xiao-Fang CHENG ; Baodan HE ; Yutao FU ; Lan KANG ; Yujun HOU ; Kun CHEN ; Shan BIAN ; Juan TANG ; Jianhuang XUE ; Chenfei WANG ; Xiaoyu LIU ; Jiejun SHI ; Shaorong GAO ; Jia-Min ZHANG
Protein & Cell 2025;16(11):932-952
Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics*
;
Humans
;
Chromatin/genetics*
;
Animals
;
Binding Sites
;
Mice
;
DNA Footprinting/methods*
7.A Meta-Analysis of Efficacy of Traditional Chinese Medicine in Treating Recurrent Spontaneous Abortion and Regulation of Th17 and Treg Cell Levels in Peripheral Blood
Zitong HOU ; Juan SUI ; Yanhong LI ; Lu XIAO ; Mengxue REN ; Yuling QIN ; Ruixue CHEN
Traditional Chinese Drug Research & Clinical Pharmacology 2024;35(5):741-748
Objective To systematically evaluate the efficacy of traditional Chinese medicine(TCM)in the treatment of recurrent spontaneous abortion and their regulatory effects of levels of peripheral blood Th17 cells and Treg cells.Methods Computer retrieval of CNKI,WanFang,VIP,SinoMed,FMRS,PubMed,Cochrane Library,Embase,Web of science and other databases were carried out.RCTS related to the regulation of Th17 and Treg cells by TCM in the treatment of recurrent spontaneous abortion,published from the establishment of the database to June 2023 were screened.Two reviewers evaluated the quality of the literature according to the Cochrane handbook.RevMan5.4 software was used for Meta-Analysis.Results A total of 10 studies that involved 1 052 patients were included.The Meta-Analysis results showed that compared to the control group,the effective rate[RR=1.20,95%CI(1.11,1.30),P<0.000 01],live birth rate[RR=1.32,95%CI(1.16,1.50),P<0.000 01]and the reduction of adverse drug reactions[RR=0.34,95%CI(0.14,0.83),P=0.02]were significantly improved by the intervention of TCM.After treatment with TCM,the expression of Th17 cells was decreased[MD=-0.71,95%CI(-1.01,-0.41),P<0.000 01],and the expression of Treg cells was increased[SMD=1.21,95%CI(0.80,1.62),P<0.000 01].The ratio of Th17/Treg cells was decreased[SMD=-2.62,95%CI(-4.09,-1.14),P=0.000 5].Conclusion TCM used for post-pregnancy or before and after pregnancy can significantly improve the clinical symptoms and live birth rate of patients with recurrent spontaneous abortion,wihch showed high safety.Moreover,TCM can reduce the expression of Th17 cells,up-regulate the expression of Treg cells and regulate the immune balance of Th17/Treg cells,which is conducive to embryonic development after pregnancy.
8.Carrier screening for 223 monogenic diseases in Chinese population:a multi-center study in 33 104 individuals
Wei HOU ; Xiaolin FU ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Manli ZHANG ; Rui XIAO ; Yanping LU
Journal of Southern Medical University 2024;44(6):1015-1023
Objective To investigate the epidemiological characteristics and mutation spectrum of monogenic diseases in Chinese population through a large-scale,multicenter carrier screening.Methods This study was conducted among a total of 33 104 participants(16 610 females)from 12 clinical centers across China.Carrier status for 223 genes was analyzed using high-throughput sequencing and different PCR methods.Results The overall combined carrier frequency was 55.58%for 197 autosomal genes and 1.84%for 26 X-linked genes in these participants.Among the 16 669 families,874 at-risk couples(5.24%)were identified.Specifically,584 couples(3.50%)were at risk for autosomal genes,306(1.84%)for X-linked genes,and 16 for both autosomal and X-linked genes.The most frequently detected autosomal at-risk genes included GJB2(autosomal recessive deafness type 1A,393 couples),HBA1/HBA2(α-thalassemia,36 couples),PAH(phenylketonuria,14 couples),and SMN1(spinal muscular atrophy,14 couples).The most frequently detected X-linked at-risk genes were G6PD(G6PD deficiency,236 couples),DMD(Duchenne muscular dystrophy,23 couples),and FMR1(fragile X syndrome,17 couples).After excluding GJB2 c.109G>A,the detection rate of at-risk couples was 3.91%(651/16 669),which was lowered to 1.72%(287/16 669)after further excluding G6PD.The theoretical incidence rate of severe monogenic birth defects was approximately 4.35‰(72.5/16 669).Screening for a battery of the top 22 most frequent genes in the at-risk couples could detect over 95%of at-risk couples,while screening for the top 54 genes further increased the detection rate to over 99%.Conclusion This study reveals the carrier frequencies of 223 monogenic genetic disorders in the Chinese population and provides evidence for carrier screening strategy development and panel design tailored to the Chinese population.In carrier testing,genetic counseling for specific genes or gene variants can be challenging,and the couples need to be informed of these difficulties before testing and provided with options for not screening these genes or gene variants.
9.Effects of compatibility ratio and processing method on contents of nine constituents in combination use of Toosendan Fructus and Foeniculi Fructus
Jian-Zhong HOU ; Shun-Juan ZHU ; Yao LI ; Xiao-Peng WANG ; Jian-Ming HAO ; Yun-Fei CAO
Chinese Traditional Patent Medicine 2024;46(1):156-161
AIM To investigate the effects of different compatibility ratios and processing method on the content of rutin,isoquercetin,ferulic acid,quercetin,isotoosendanin,kaempferol,toosendanin,α-pinene,trans-anethole in the combination use of Toosendan Fructus and Foeniculi Fructus,and to explore the optimal compatibility ratio for its use.METHODS The analysis of HPLC-DAD was performed on a 30℃thermostatic ZORBAX SB C18 column(4.6 mm×250 mm,5 μm),with the mobile phase comprising of acetonitrile-0.1%phosphoric acid flowing at 1.0 mL/min in a gradient elution manner,and the use of DAD detector.SPSS 24.0 software was used to analyze the data differences.RESULTS Nine constituents showed good linear relationships within their own ranges(r≥0.999 1),whose average recoveries were 96.19%-103.13%with the RSDs of 1.86%-2.67%.Generally higher total content of nine constituents were detected in the combination use groups when Toosendan Fructus-Foeniculi Fructus were at ratios of 1 ∶ 1,1 ∶ 2,and 2 ∶ 1 than those single uses(P<0.05),and among which the 1 ∶ 1 ratio contributed the highest total content.After salt processing,decreased content of toosendanin and isotoosendanin,α-pinene and trans-anethole(P<0.05,P<0.01)),increased isoquercetin content(P<0.01),and no significant content changes of other ingredients were detected.CONCLUSION Through this method of high accuracy and good reproducibility,we learn that the combination use of Toosendan Fructus and Foeniculi Fructus promotes the dissolution of the nine constituents,and the maximum content is achieved at ratio of 1 ∶ 1.
10.Carrier screening for 223 monogenic diseases in Chinese population:a multi-center study in 33 104 individuals
Wei HOU ; Xiaolin FU ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Manli ZHANG ; Rui XIAO ; Yanping LU
Journal of Southern Medical University 2024;44(6):1015-1023
Objective To investigate the epidemiological characteristics and mutation spectrum of monogenic diseases in Chinese population through a large-scale,multicenter carrier screening.Methods This study was conducted among a total of 33 104 participants(16 610 females)from 12 clinical centers across China.Carrier status for 223 genes was analyzed using high-throughput sequencing and different PCR methods.Results The overall combined carrier frequency was 55.58%for 197 autosomal genes and 1.84%for 26 X-linked genes in these participants.Among the 16 669 families,874 at-risk couples(5.24%)were identified.Specifically,584 couples(3.50%)were at risk for autosomal genes,306(1.84%)for X-linked genes,and 16 for both autosomal and X-linked genes.The most frequently detected autosomal at-risk genes included GJB2(autosomal recessive deafness type 1A,393 couples),HBA1/HBA2(α-thalassemia,36 couples),PAH(phenylketonuria,14 couples),and SMN1(spinal muscular atrophy,14 couples).The most frequently detected X-linked at-risk genes were G6PD(G6PD deficiency,236 couples),DMD(Duchenne muscular dystrophy,23 couples),and FMR1(fragile X syndrome,17 couples).After excluding GJB2 c.109G>A,the detection rate of at-risk couples was 3.91%(651/16 669),which was lowered to 1.72%(287/16 669)after further excluding G6PD.The theoretical incidence rate of severe monogenic birth defects was approximately 4.35‰(72.5/16 669).Screening for a battery of the top 22 most frequent genes in the at-risk couples could detect over 95%of at-risk couples,while screening for the top 54 genes further increased the detection rate to over 99%.Conclusion This study reveals the carrier frequencies of 223 monogenic genetic disorders in the Chinese population and provides evidence for carrier screening strategy development and panel design tailored to the Chinese population.In carrier testing,genetic counseling for specific genes or gene variants can be challenging,and the couples need to be informed of these difficulties before testing and provided with options for not screening these genes or gene variants.

Result Analysis
Print
Save
E-mail