1.Study on the distribution of FMR1 CGG repeat numbers among 16 610 women of childbearing age in China
Yahui SHEN ; Wei HOU ; Xiaolin FU ; Manli ZHANG ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Rui XIAO ; Yanping LU
Chinese Journal of Reproduction and Contraception 2025;45(4):398-402
Objective:To investigate the distribution of CGG repeat numbers in the FMR1 gene among reproductive-age women in China, providing data reference for carrier screening and genetic counseling of Fragile X syndrome. Methods:This cross-sectional study recruited 16 610 reproductive-age women from 12 medical institutions between July 2022 and October 2023. Peripheral venous blood samples (3 mL) were collected, and genomic DNA was extracted. The number of CGG repeats in the FMR1 gene was determined using the triplet-primed polymerase chain reaction (TP-PCR) combined with capillary electrophoresis technology. Statistical analyses were performed to assess the prevalence and distribution of CGG repeat expansions. Results:Among 16 610 women of childbearing age, 5 684 (34.220%) women had the same number of CGG repeats in the two alleles of FMR1 gene, and 10 926 (65.780%) women had different numbers of repeats in the two alleles. Among the 33 220 FMR1 alleles in 16 610 women of reproductive age, the most common CGG repeat numbers were 29 [48.645% (16 160/33 220)] and 30 [26.276% (8 729/33 220)], while the most frequent CGG genotype was CGG 29/29 [24.726% (4 107/16 610)]. The CGG repeat numbers of FMR1 gene were normal in 16 498 women (99.326%). Among the 112 women (0.674%) with CGG repeat abnormities, 96 (0.578%) women were classified as intermediate carriers, 15 (0.090%) as premutation carriers, and 1 (0.006%) as a full mutation carrier, whose CGG genotype was (36, >200). Conclusion:In the general reproductive-age female population in China, the normal CGG repeat numbers of the FMR1 gene account for 99.326%, while the intermediate carrier rate is 0.578%, and the combined carrier rate of the premutation and full mutation types is 0.096%.
2.Study on the distribution of FMR1 CGG repeat numbers among 16 610 women of childbearing age in China
Yahui SHEN ; Wei HOU ; Xiaolin FU ; Manli ZHANG ; Xiaoxiao XIE ; Chunyan ZHANG ; Jiaxin BIAN ; Xiao MAO ; Juan WEN ; Chunyu LUO ; Hua JIN ; Qian ZHU ; Qingwei QI ; Yeqing QIAN ; Jing YUAN ; Yanyan ZHAO ; Ailan YIN ; Shutie LI ; Yulin JIANG ; Rui XIAO ; Yanping LU
Chinese Journal of Reproduction and Contraception 2025;45(4):398-402
Objective:To investigate the distribution of CGG repeat numbers in the FMR1 gene among reproductive-age women in China, providing data reference for carrier screening and genetic counseling of Fragile X syndrome. Methods:This cross-sectional study recruited 16 610 reproductive-age women from 12 medical institutions between July 2022 and October 2023. Peripheral venous blood samples (3 mL) were collected, and genomic DNA was extracted. The number of CGG repeats in the FMR1 gene was determined using the triplet-primed polymerase chain reaction (TP-PCR) combined with capillary electrophoresis technology. Statistical analyses were performed to assess the prevalence and distribution of CGG repeat expansions. Results:Among 16 610 women of childbearing age, 5 684 (34.220%) women had the same number of CGG repeats in the two alleles of FMR1 gene, and 10 926 (65.780%) women had different numbers of repeats in the two alleles. Among the 33 220 FMR1 alleles in 16 610 women of reproductive age, the most common CGG repeat numbers were 29 [48.645% (16 160/33 220)] and 30 [26.276% (8 729/33 220)], while the most frequent CGG genotype was CGG 29/29 [24.726% (4 107/16 610)]. The CGG repeat numbers of FMR1 gene were normal in 16 498 women (99.326%). Among the 112 women (0.674%) with CGG repeat abnormities, 96 (0.578%) women were classified as intermediate carriers, 15 (0.090%) as premutation carriers, and 1 (0.006%) as a full mutation carrier, whose CGG genotype was (36, >200). Conclusion:In the general reproductive-age female population in China, the normal CGG repeat numbers of the FMR1 gene account for 99.326%, while the intermediate carrier rate is 0.578%, and the combined carrier rate of the premutation and full mutation types is 0.096%.
3.Genome-wide investigation of transcription factor footprints and dynamics using cFOOT-seq.
Heng WANG ; Ang WU ; Meng-Chen YANG ; Di ZHOU ; Xiyang CHEN ; Zhifei SHI ; Yiqun ZHANG ; Yu-Xin LIU ; Kai CHEN ; Xiaosong WANG ; Xiao-Fang CHENG ; Baodan HE ; Yutao FU ; Lan KANG ; Yujun HOU ; Kun CHEN ; Shan BIAN ; Juan TANG ; Jianhuang XUE ; Chenfei WANG ; Xiaoyu LIU ; Jiejun SHI ; Shaorong GAO ; Jia-Min ZHANG
Protein & Cell 2025;16(11):932-952
Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics*
;
Humans
;
Chromatin/genetics*
;
Animals
;
Binding Sites
;
Mice
;
DNA Footprinting/methods*
5.Application of 3D-printed auxiliary guides in adolescent scoliosis surgery.
Dong HOU ; Jian-Tao WEN ; Chen ZHANG ; Jin HUANG ; Chang-Quan DAI ; Kai LI ; Han LENG ; Jing ZHANG ; Shao-Bo YANG ; Xiao-Juan CUI ; Juan WANG ; Xiao-Yun YUAN
China Journal of Orthopaedics and Traumatology 2025;38(11):1119-1125
OBJECTIVE:
To investigate the accuracy and safety of pedicle screw placement using 3D-printed auxiliary guides in scoliosis correction surgery for adolescents.
METHODS:
A retrospective analysis was conducted on the clinical data of 51 patients who underwent posterior scoliosis correction surgery from January 2020 to March 2023. Among them, there were 35 cases of adolescent idiopathic scoliosis and 16 cases of congenital scoliosis. The patients were divided into two groups based on the auxiliary tool used:the 3D-printed auxiliary guide screw placement group (3D printing group) and the free-hand screw placement group (free-hand group, without auxiliary tools). The 3D printing group included 32 patients (12 males and 20 females) with an average age of (12.59±2.60) years;the free-hand group included 19 patients (7 males and 12 females) with an average age of (14.58±3.53) years. The two groups were compared in terms of screw placement accuracy and safety, spinal correction rate, intraoperative blood loss, number of intraoperative fluoroscopies, operation time, hospital stay, and preoperative and last follow-up scores of the Scoliosis Research Society-22 (SRS-22) questionnaire.
RESULTS:
A total of 707 pedicle screws were placed in the two groups, with 441 screws in the 3D printing group and 266 screws in the free-hand group. All patients in both groups successfully completed the surgery. There was a statistically significant difference in operation time between the two groups (P<0.05). The screw placement accuracy rate of the 3D printing group was 95.46% (421/441), among which the Grade A placement rate was 89.34% (394/441);the screw placement accuracy rate of the free-hand group was 86.47% (230/266), with a Grade A placement rate of 73.31% (195/266). There were statistically significant differences in the accuracy of Grade A, B, and C screw placements between the two groups (P<0.05), while no statistically significant differences were observed in intraoperative blood loss, number of fluoroscopies, correction rate, or hospital stay (P>0.05). In the SRS-22 questionnaire scores, the scores of functional status and activity ability, self-image, mental status, and pain of patients in each group at the last follow-up were significantly improved compared with those before surgery (P<0.05), but there were no statistically significant differences in all scores between the two groups (P>0.05).
CONCLUSION
In scoliosis correction surgery, compared with traditional free-hand screw placement, the use of 3D-printed auxiliary guides for screw placement significantly improves the accuracy and safety of screw placement and shortens the operation time.
Humans
;
Male
;
Scoliosis/surgery*
;
Female
;
Adolescent
;
Printing, Three-Dimensional
;
Retrospective Studies
;
Pedicle Screws
;
Child
6.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
7.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
8.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies
9.Adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E gene polymorphisms for Alzheimer′s disease
Huiwang ZHANG ; Juan JIANG ; Huixian XIONG ; Qinchuan HOU ; Yongli LAN ; Mo ZHANG ; Peiyuan HE ; Wei PU ; Huili LIU ; Xiao XIAO ; Jun XIAO ; Yuping LIU ; Ping SHUAI
Chinese Journal of Health Management 2025;19(8):590-596
Objective:To investigate the adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E (ApoE) gene polymorphisms for Alzheimer′s disease (AD).Methods:It was a case-control study, 71 confirmed AD patients who attended the Department of Neurology in Sichuan Provincial People′s Hospital from May 2023 to June 2024 and 156 healthy medical checkups who participated in medical checkups in the Health Management Center were continuously with convenience sampling method; the subjects were included as the AD case group and healthy control group, respectively. Optical coherence tomography (OCT) was used to measure the structural parameters of retinal imaging such as the thickness of the retinal nerve fiber layer (RNFL) and the retinal nerve fiber layer-inner plexiform layer (RNFL-IPL) in the study subjects. Information on demographic characteristics and disease history of the study participants were collected through a questionnaire, and venous blood was collected to test for ApoE gene polymorphisms. The retinal imaging structural parameters, ApoE gene polymorphisms and other related indicators were included in a multifactorial logistic regression model to analyze the main factors affecting the risk of AD. Based on the results of the multifactorial analysis, the receiver operating characteristic (ROC) curves were plotted and the areas under the curve (AUC) were calculated to evaluate the efficacy of different models in the adjunctive diagnosis of AD.Results:Of the 227 study subjects included in the analysis, 153 were females and 74 were males; there were 71 cases in the AD case group with a mean age of (66.73±8.83) years, and there were 156 subjects in the healthy control group with an average age of (61.95±8.21) years. Educational attainment of elementary school and below ( OR=4.683, 95% CI: 2.133-10.282), living visual acuity<0.5 ( OR=2.716, 95% CI: 1.12-6.583), and carrying ≥1 ApoE ε4 genes ( OR=5.331, 95% CI: 2.309-11.891) were positively correlated with the risk of AD. RNFL thickening ( OR=0.923, 95% CI: 0.854-0.998) was negatively associated with the risk of AD (all P<0.05). The AD risk assessment model (Model 4), which included fundus imaging features and ApoE gene polymorphisms, had the highest predictive efficacy (AUC=0.857, P<0.001). Conclusion:Retinal imaging structural parameters differ significantly between AD patients and healthy examinees, and a risk assessment model combining retinal imaging structural parameters and ApoE gene polymorphisms has high predictive value and is expected to serve as an auxiliary diagnostic tool for AD.
10.Adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E gene polymorphisms for Alzheimer′s disease
Huiwang ZHANG ; Juan JIANG ; Huixian XIONG ; Qinchuan HOU ; Yongli LAN ; Mo ZHANG ; Peiyuan HE ; Wei PU ; Huili LIU ; Xiao XIAO ; Jun XIAO ; Yuping LIU ; Ping SHUAI
Chinese Journal of Health Management 2025;19(8):590-596
Objective:To investigate the adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E (ApoE) gene polymorphisms for Alzheimer′s disease (AD).Methods:It was a case-control study, 71 confirmed AD patients who attended the Department of Neurology in Sichuan Provincial People′s Hospital from May 2023 to June 2024 and 156 healthy medical checkups who participated in medical checkups in the Health Management Center were continuously with convenience sampling method; the subjects were included as the AD case group and healthy control group, respectively. Optical coherence tomography (OCT) was used to measure the structural parameters of retinal imaging such as the thickness of the retinal nerve fiber layer (RNFL) and the retinal nerve fiber layer-inner plexiform layer (RNFL-IPL) in the study subjects. Information on demographic characteristics and disease history of the study participants were collected through a questionnaire, and venous blood was collected to test for ApoE gene polymorphisms. The retinal imaging structural parameters, ApoE gene polymorphisms and other related indicators were included in a multifactorial logistic regression model to analyze the main factors affecting the risk of AD. Based on the results of the multifactorial analysis, the receiver operating characteristic (ROC) curves were plotted and the areas under the curve (AUC) were calculated to evaluate the efficacy of different models in the adjunctive diagnosis of AD.Results:Of the 227 study subjects included in the analysis, 153 were females and 74 were males; there were 71 cases in the AD case group with a mean age of (66.73±8.83) years, and there were 156 subjects in the healthy control group with an average age of (61.95±8.21) years. Educational attainment of elementary school and below ( OR=4.683, 95% CI: 2.133-10.282), living visual acuity<0.5 ( OR=2.716, 95% CI: 1.12-6.583), and carrying ≥1 ApoE ε4 genes ( OR=5.331, 95% CI: 2.309-11.891) were positively correlated with the risk of AD. RNFL thickening ( OR=0.923, 95% CI: 0.854-0.998) was negatively associated with the risk of AD (all P<0.05). The AD risk assessment model (Model 4), which included fundus imaging features and ApoE gene polymorphisms, had the highest predictive efficacy (AUC=0.857, P<0.001). Conclusion:Retinal imaging structural parameters differ significantly between AD patients and healthy examinees, and a risk assessment model combining retinal imaging structural parameters and ApoE gene polymorphisms has high predictive value and is expected to serve as an auxiliary diagnostic tool for AD.

Result Analysis
Print
Save
E-mail