Objective To investigate the association between gastroesophageal reflux disease(GERD)and the risk of incident chronic obstructive pulmonary disease(COPD)and explore potential effect modifiers influencing this association.Methods Clinical data from 476 175 participants in the UK Biobank(2006-2010)were collected.A Cox proportional hazards model was used to assess the relationship between GERD and the risk of incident COPD.Subgroup analyses were conducted to examine potential modifiers of the primary findings.Results A total of 11 587(2.43%)new COPD cases were diagnosed.The Cox proportional hazards model revealed that GERD was associated with an increased risk of incident COPD(HR=1.59,95%CI=1.46-1.74,P<0.001).GERD was linked to a higher risk of incident COPD in individuals aged<60 years(P<0.001)and non-smokers(P=0.011).No association was observed between GERD and the risk of incident COPD in current smokers with a daily cigarette consumption<10 cigarettes(P=0.261).Conclusion GERD may increase the risk of incident COPD.
Humans ; Pulmonary Disease, Chronic Obstructive/epidemiology* ; Gastroesophageal Reflux/epidemiology* ; Middle Aged ; Proportional Hazards Models ; Incidence ; Male ; Risk Factors ; Female ; Aged

Objective:This study aimed to investigate the association between anemia and hypothyroidism during early pregnancy.Methods:We conducted a retrospective analysis of 3,165 pregnant women who registered at Qingdao Women and Children's Hospital from April 2021 to March 2022.Participants were categorized into a hypothyroidism group(n=177)and a euthyroid control group(n=2 988).Maternal demographic data,anemia-related markers(hemoglobin,Hb),and thyroid function parameters(FT3,FT4,TSH)were collected.Statistical analyses included independent t-tests,chi-square tests,Spearman correlation,and multivariate logistic regression.Results:The hypothyroidism group exhibited a significantly higher anemia incidence(10.17%vs 5.02%,P<0.05)and lower mean Hb levels(122.70±10.19 g/L vs 124.60±9.19 g/L,P<0.05)compared to controls.Spearman analysis revealed positive correlations between Hb and FT3(r=0.176)and FT4(r=0.051)(both P<0.05).Multivariate logistic regression identified anemia as an independent risk factor for hypothyroidism(OR=2.038,95%CI:1.202～3.455,P=0.008).Conclusion:Anemia in early pregnancy is associated with the risk of hypothyroidism.We recommend enhanced thyroid function screening and early intervention for anemic pregnant women to mitigate potential complications.

Objective To construct an aptamer-functionalized carboxylated graphene oxide(CGO)fluo-rescent sensor to achieve highly sensitive and specific detection of ketamine(KET)and its metabolite norketamine(NK)using an aptamer capable of simultaneously recognizing KET and NK.Methods A specific aptamer for simultaneous recognition of KET and NK was screened using graphene oxide-sys-tematic evolution of ligand by exponential enrichment(GO-SELEX)and molecular docking tech-niques.The aptamer,labeled with Cy5 fluorescence,was chemically conjugated to CGO to construct an aptamer-functionalized CGO fluorescent sensor.By optimizing detection conditions,including the mass concentration of CGO,aptamer concentration,reaction temperature,and incubation time,quantita-tive analysis of the target analytes was achieved using the ratio of fluorescence intensity changes be-fore and after target addition.The stability of the sensor in biological matrices was evaluated by moni-toring fluorescence intensity changes over incubation time in blank blood and urine,in comparison with the traditional physical adsorption-based CGO fluorescent sensor.Spiked recovery experiments in blank blood and urine were conducted to compare performance with that of HPLC-MS/MS.Results A specific aptamer A5 was selected and chemically conjugated with CGO to construct the aptamer-functionalized CGO fluorescent sensor.Under optimized conditions,the proposed fluorescent sensor ex-hibited a linear detection range of 1.0-5.0 ng/mL for KET,with a limit of detection(LOD)of 0.86 ng/mL;while for NK,the linear detection range was 1.0-5.0 ng/mL,with an LOD of 0.70 ng/mL.Com-pared with the CGO fluorescent sensor constructed via physical adsorption,this sensor demonstrated greater stability in blood and urine.The spiked recovery rates of KET and NK in blank blood and urine ranged from 81.50%to 110.03%,exhibiting detection performance comparable to that of HPLC-MS/MS.Conclusion The aptamer screening method offers a novel approach for selecting aptamers tar-geting drugs and their metabolites.The constructed aptamer-functionalized CGO fluorescent sensor pro-vides an efficient and reliable strategy for the high-performance detection of KET and NK.

Good endometrial receptivity is an essential factor for embryo implantation,and gene expression in endometrial tissue during the window of implantation(WOI)is closely related to receptivity.Transcriptome sequencing technology enables the identification of gene expression profiles of endometrium during different menstrual phases,as well as microRNAs and long-chain non-coding RNA sequences involved in regulating gene expression.Combining this technology with bioinformatics analysis provides a better understanding of specific gene expression during the receptive period and offers technical support for studying its regulatory mechanism.Moreover,gene expression profiles of the endometrium during different menstrual phases hold significant clinical application value for accurately assessing endometrium receptivity in infertility patients and those with repeated implantation failure,thereby guiding individualized embryo transfer strategies.This review summarizes the progress of transcriptome sequencing in evaluating human endometrial receptivity and discusses future research directions.This review aims to understand the complex molecular mechanisms of endometrial receptivity formation and regulation from the transcriptional level,in order to improve the implantation rate of embryos in assisted reproductive technology and reduce the abortion rate.

Objective This study aimed to provide an effective scientific basis for prevention and control of cockroaches on aircrafts by identifying cockroach-carried pathogens,and assess the insecticidal efficacy of gel bait mediated cockroach control on aircrafts,to provide technical guidance for aircraft disinsection.Methods Cassette-trapping was used to trap cockroaches,and the carried pathogens were detected using bacterial cultivation techniques.The gel bait mediated killing rate was calculated after 1,7,and 30 d by field application of gel bait.Results A total of 411 cockroaches were captured,and all were identified as Blattella germanica.26 strains of pathogenic bacteria were isolated from the trapped cockroaches.The killing rates of cockroaches were 58.8％-96.3％with 1-30 day application of gel bait.Statistically significant differences were observed in cockroach killing rates on different days(χ2=58.95,P<0.01).Conclusions B.germanica carry a large variety of pathogenic bacteria and opportunistic pathogens and are thus important infectious disease carriers.Gel bait agents have proven to be very effective against cockroaches on aircrafts.

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

Bawei Chenxiang Powder(BCP), first documented in the Tibetan medical work Four Medical Classics, has been widely applied in clinical practices in Tibetan and Mongolian medicines since its development. It has the effect of clearing the heart heat, calming the mind, and inducing resuscitation. On the basis of BCP, multiple types of formulae have been developed, such as Bawei Yiheyi Chenxiang Powder, Bawei Rang Chenxiang Powder, and Bawei Pingchuan Chenxiang Powder, which are widely used for treating cardiovascular and respiratory diseases. Current pharmacological research has revealed the pharmacological effects of BCP and its related formulae against myocardial ischemia, cerebral ischemia, renal ischemia, and anti-hypoxia. BCP and its related formulae introduced more treatment options for related clinical diseases and provided insights for fully comprehending the essence and pharmacological components of the formulae. This paper systematically reviewed the clinical and pharmacological research on BCP and its related formulae, analyzing the formulation principles and potential key flavors and active ingredients. This lays a fundamental scientific basis for the clinical use, quality evaluation, and subsequent development and application of BCP and its related formulae, providing references for studying traditional Chinese medicine formulae in a thorough and systematic manner.
Drugs, Chinese Herbal/chemistry* ; Humans ; Powders/chemistry* ; Animals ; Medicine, Chinese Traditional

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse