1.Effects of total extract of Anthriscus sylvestris on immune inflammation and thrombosis in rats with pulmonary arterial hypertension based on TGF-β1/Smad3 signaling pathway.
Ya-Juan ZHENG ; Pei-Pei YUAN ; Zhen-Kai ZHANG ; Yan-Ling LIU ; Sai-Fei LI ; Yuan RUAN ; Yi CHEN ; Yang FU ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(9):2472-2483
This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals
;
Male
;
Smad3 Protein/metabolism*
;
Transforming Growth Factor beta1/metabolism*
;
Rats, Sprague-Dawley
;
Rats
;
Signal Transduction/drug effects*
;
Hypertension, Pulmonary/genetics*
;
Thrombosis/immunology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Humans
;
Apoptosis/drug effects*
2.Chemical and pharmacological research progress on Mongolian folk medicine Syringa pinnatifolia.
Kun GAO ; Chang-Xin LIU ; Jia-Qi CHEN ; Jing-Jing SUN ; Xiao-Juan LI ; Zhi-Qiang HUANG ; Ye ZHANG ; Pei-Feng XUE ; Su-Yi-le CHEN ; Xin DONG ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(8):2080-2089
Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional
;
Humans
;
Drugs, Chinese Herbal/pharmacology*
;
Animals
;
Syringa/chemistry*
3.Advance on clinical and pharmacological research of Bawei Chenxiang Powder and related formulae.
Lu-Lu KANG ; Jia-Tong WANG ; Feng ZHOU ; Guo-Dong YANG ; Xiao-Juan LI ; Xiao-Li GAO ; Luobu GESANG ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(10):2875-2882
Bawei Chenxiang Powder(BCP), first documented in the Tibetan medical work Four Medical Classics, has been widely applied in clinical practices in Tibetan and Mongolian medicines since its development. It has the effect of clearing the heart heat, calming the mind, and inducing resuscitation. On the basis of BCP, multiple types of formulae have been developed, such as Bawei Yiheyi Chenxiang Powder, Bawei Rang Chenxiang Powder, and Bawei Pingchuan Chenxiang Powder, which are widely used for treating cardiovascular and respiratory diseases. Current pharmacological research has revealed the pharmacological effects of BCP and its related formulae against myocardial ischemia, cerebral ischemia, renal ischemia, and anti-hypoxia. BCP and its related formulae introduced more treatment options for related clinical diseases and provided insights for fully comprehending the essence and pharmacological components of the formulae. This paper systematically reviewed the clinical and pharmacological research on BCP and its related formulae, analyzing the formulation principles and potential key flavors and active ingredients. This lays a fundamental scientific basis for the clinical use, quality evaluation, and subsequent development and application of BCP and its related formulae, providing references for studying traditional Chinese medicine formulae in a thorough and systematic manner.
Drugs, Chinese Herbal/chemistry*
;
Humans
;
Powders/chemistry*
;
Animals
;
Medicine, Chinese Traditional
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Clinical Characteristics and Prognosis of Primary Pulmonary Lymphoma.
You-Fan FENG ; Yuan-Yuan ZHANG ; Xiao Fang WEI ; Qi-Ke ZHANG ; Li ZHAO ; Xiao-Qin LIANG ; Yuan FU ; Fei LIU ; Yang-Yang ZHAO ; Xiu-Juan HUANG ; Qing-Fen LI
Journal of Experimental Hematology 2025;33(2):387-392
OBJECTIVE:
To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL).
METHODS:
The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized.
RESULTS:
The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β2-microglobulin(β2-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months.
CONCLUSION
The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans
;
Middle Aged
;
Male
;
Female
;
Adult
;
Prognosis
;
Aged
;
Lung Neoplasms/therapy*
;
Retrospective Studies
;
Neoplasm Staging
;
Lymphoma/therapy*
;
Lymphoma, Large B-Cell, Diffuse
6.The Significance of Bone Marrow Plasma Cell Percentage and Immature Plasma Cells in the Prognosis of Newly Diagnosed Multiple Myeloma Patients.
Yuan-Yuan ZHANG ; Qi-Ke ZHANG ; Xiao-Fang WEI ; You-Fan FENG ; Yuan FU ; Fei LIU ; Qiao-Lin CHEN ; Yang-Yang ZHAO ; Xiu-Juan HUANG ; Yang CHEN
Journal of Experimental Hematology 2025;33(2):469-474
OBJECTIVE:
To explore the significance of the plasma cell percentage and immature plasma cells in the prognosis of patients with multiple myeloma (MM).
METHODS:
The clinical data of 126 newly diagnosed MM patients in Gansu Provincial Hospital from June 2017 to November 2022 were retrospectively analyzed. The enrolled patients were divided into a higher plasma cell percentage group (group A) and a lower plasma cell percentage group (group B) according to the median plasma cell percentage (33.5%). The clinicopathological data of the two groups were compared, and the effect of plasma cell percentage on the prognosis of MM patients was analyzed using survival curves. On this basis, group A and group B were divided into subgroups with immature plasma cells (A1 group, B1 group) and subgroups without immature plasma cells (A2 group, B2 group), respectively, then the survival curves were used to analyze the effect of immature plasma cells on the prognosis of MM patients.
RESULTS:
Among the 126 patients with MM, the proportions of patients with ISS stage III, elevated β2-microglobulin(β2-MG) level, and immature plasma cells in Group A were significantly higher compared those in Group B ( P =0.015, P =0.028, P =0.010). The median overall survival(OS) and progression-free survival(PFS) of group A were 32 months and 10 months, respectively. The median OS of group B was not reached, and the median PFS was 32 months. The 3-year OS rates of patients in group A and group B were 46.7% and 62.2%, respectively ( P =0.021), and the 3-year PFS were 29.2% and 42.5%, respectively ( P =0.033). There were no significant differences in OS and PFS between group A1 and group A2, or between group B1 and group B2 ( P >0.05). Multivariate COX survival analysis showed that the plasma cell percentage ≥33.5%(HR=1.253, 95%CI : 0.580-2.889, P =0.018), age ≥65 years (HR=2.206, 95%CI : 1.170-3.510, P =0.012), lactate dehydrogenase(LDH) ≥250 U/L (HR=1.180, 95%CI : 0.621-2.398, P =0.048) and β2-MG ≥3.5 mg/L (HR=1.507, 95%CI : 0.823-3.657, P =0.036) were independent risk factors affecting OS in MM patients.
CONCLUSION
MM patients with a higher plasma cell percentage (≥33.5%) at the initial diagnosis have a later disease stage, poorer OS and PFS, compared to the patients with a lower percentage(<33.5%) of plasma cells. The presence or absence of immature plasma cells has no significant impact on the survival of MM patients.
Humans
;
Multiple Myeloma/pathology*
;
Prognosis
;
Plasma Cells/cytology*
;
Retrospective Studies
;
Male
;
Female
;
Middle Aged
;
Aged
;
Bone Marrow
7.Gene Mutation Characteristics, Prognosis and Survival Analysis of Patients with Acute Myeloid Leukemia.
Miao HE ; Hong-Juan TIAN ; Dong-Feng MAO ; Xiao-Chen ZHAO ; Shu-Ting ZHANG ; Fang-Qing ZHAO ; Tao WU
Journal of Experimental Hematology 2025;33(3):691-697
OBJECTIVE:
To analyze the gene mutation characteristics and survival time of patients with newly diagnosed acute myeloid leukemia (AML) based on next-generation sequencing(NGS) gene detection.
METHODS:
A retrospective analysis was conducted on the clinical data of 92 patients with AML (non APL) admitted to our hospital from January 2018 to May 2022. AML related genes tested were using NGS, the mutation characteristics and survival time of AML patients were analyzed.
RESULTS:
Among the 92 patients, 41 were males and 51 were females. A total of 38 types of gene mutations were detected. Six-two patients carried at least one gere mutation, while no gene mutations were detected in 30 patients. In the group with favourable prognosis (n =14), the frequencies of higher gene mutations were NRAS, KIT (21.43%, n =3), KRAS (14.29%, n =2). In the group with intermediate prognosis (n =64), the gene mutation frequencies from high to low were DNMT3A (18.75%, n =12), NPM1 (17.19%, n =11), IDH2, FLT3-ITD, CEBPA (12.50%, n =8), TET2 (10.94%, n =7). In the poor prognosis group (n =14), ASXL1, TP53, EZH2, NRAS had higher gene mutation frequency than others(14.29 %, n =2 ). Statistical analysis revealed that KIT had a relative hotspot of mutations in the intermediate-risk group, and DNMT3A had a relative hotspot of mutations in the high-risk group (P < 0.05). The correlation analysis of genes with high mutation rates in different prognostic groups, such as NRAS, KIT, IDH2, DNMT3A, NPM1, and FLT3-ITD, with prognosis found that KIT was a factor affecting OS (P < 0.05), while no significant differences were observed for the others(P >0.05).
CONCLUSION
The frequency of gene mutations is high in AML patients, 67.4% of the patients carried at least one gene mutation. The mutation frequency varies among different genes in patients with different karyotypes, and there are obvious dominant mutations. KIT and DNMT3A can be used as factors for evaluating the prognosis of AML.
Humans
;
Leukemia, Myeloid, Acute/genetics*
;
Nucleophosmin
;
Mutation
;
Prognosis
;
Retrospective Studies
;
Male
;
Female
;
High-Throughput Nucleotide Sequencing
;
Middle Aged
;
DNA Methyltransferase 3A
;
Adult
;
Aged
;
Survival Analysis
;
Proto-Oncogene Proteins c-kit/genetics*
8.Multiple biomarkers risk score for accurately predicting the long-term prognosis of patients with acute coronary syndrome.
Zhi-Yong ZHANG ; Xin-Yu WANG ; Cong-Cong HOU ; Hong-Bin LIU ; Lyu LYU ; Mu-Lei CHEN ; Xiao-Rong XU ; Feng JIANG ; Long LI ; Wei-Ming LI ; Kui-Bao LI ; Juan WANG
Journal of Geriatric Cardiology 2025;22(7):656-667
BACKGROUND:
Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients.
METHODS:
We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables.
RESULTS:
During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively).
CONCLUSIONS
CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.
9.Liang-Ge-San Decoction Ameliorates Acute Respiratory Distress Syndrome via Suppressing p38MAPK-NF-κ B Signaling Pathway.
Quan LI ; Juan CHEN ; Meng-Meng WANG ; Li-Ping CAO ; Wei ZHANG ; Zhi-Zhou YANG ; Yi REN ; Jing FENG ; Xiao-Qin HAN ; Shi-Nan NIE ; Zhao-Rui SUN
Chinese journal of integrative medicine 2025;31(7):613-623
OBJECTIVE:
To explore the potential effects and mechanisms of Liang-Ge-San (LGS) for the treatment of acute respiratory distress syndrome (ARDS) through network pharmacology analysis and to verify LGS activity through biological experiments.
METHODS:
The key ingredients of LGS and related targets were obtained from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform. ARDS-related targets were selected from GeneCards and DisGeNET databases. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses were performed using the Metascape Database. Molecular docking analysis was used to confirm the binding affinity of the core compounds with key therapeutic targets. Finally, the effects of LGS on key signaling pathways and biological processes were determined by in vitro and in vivo experiments.
RESULTS:
A total of LGS-related targets and 496 ARDS-related targets were obtained from the databases. Network pharmacological analysis suggested that LGS could treat ARDS based on the following information: LGS ingredients luteolin, wogonin, and baicalein may be potential candidate agents. Mitogen-activated protein kinase 14 (MAPK14), recombinant V-Rel reticuloendotheliosis viral oncogene homolog A (RELA), and tumor necrosis factor alpha (TNF-α) may be potential therapeutic targets. Reactive oxygen species metabolic process and the apoptotic signaling pathway were the main biological processes. The p38MAPK/NF-κ B signaling pathway might be the key signaling pathway activated by LGS against ARDS. Moreover, molecular docking demonstrated that luteolin, wogonin, and baicalein had a good binding affinity with MAPK14, RELA, and TNF α. In vitro experiments, LGS inhibited the expression and entry of p38 and p65 into the nucleation in human bronchial epithelial cells (HBE) cells induced by LPS, inhibited the inflammatory response and oxidative stress response, and inhibited HBE cell apoptosis (P<0.05 or P<0.01). In vivo experiments, LGS improved lung injury caused by ligation and puncture, reduced inflammatory responses, and inhibited the activation of p38MAPK and p65 (P<0.05 or P<0.01).
CONCLUSION
LGS could reduce reactive oxygen species and inflammatory cytokine production by inhibiting p38MAPK/NF-κ B signaling pathway, thus reducing apoptosis and attenuating ARDS.
Drugs, Chinese Herbal/pharmacology*
;
Respiratory Distress Syndrome/enzymology*
;
p38 Mitogen-Activated Protein Kinases/metabolism*
;
NF-kappa B/metabolism*
;
Animals
;
Signal Transduction/drug effects*
;
Molecular Docking Simulation
;
Humans
;
Male
;
Network Pharmacology
;
Apoptosis/drug effects*
;
Mice
10.Shexiang Tongxin Dropping Pill Improves Stable Angina Patients with Phlegm-Heat and Blood-Stasis Syndrome: A Multicenter, Randomized, Double-Blind, Placebo-Controlled Trial.
Ying-Qiang ZHAO ; Yong-Fa XING ; Ke-Yong ZOU ; Wei-Dong JIANG ; Ting-Hai DU ; Bo CHEN ; Bao-Ping YANG ; Bai-Ming QU ; Li-Yue WANG ; Gui-Hong GONG ; Yan-Ling SUN ; Li-Qi WANG ; Gao-Feng ZHOU ; Yu-Gang DONG ; Min CHEN ; Xue-Juan ZHANG ; Tian-Lun YANG ; Min-Zhou ZHANG ; Ming-Jun ZHAO ; Yue DENG ; Chang-Jiang XIAO ; Lin WANG ; Bao-He WANG
Chinese journal of integrative medicine 2025;31(8):685-693
OBJECTIVE:
To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents.
METHODS:
This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs).
RESULTS:
This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed.
CONCLUSION
STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans
;
Double-Blind Method
;
Drugs, Chinese Herbal/adverse effects*
;
Male
;
Female
;
Middle Aged
;
Angina, Stable/physiopathology*
;
Aged
;
Syndrome
;
Treatment Outcome
;
Placebos
;
Tablets

Result Analysis
Print
Save
E-mail