Despite of the widespread use of hydrogen and methane breath test, the variability in testing protocols, gas measurement techniques, and interpretation criteria continues to challenge the reproducibility and comparability across centers, especially in the Asia-Pacific region. The Asian Neurogastroenterology and Motility Association hence presents the first Asian monograph guiding application and interpretation of breath test. The monograph was formulated according to the framework of indications, preparatory process, performance, and interpretation of results, as well as future direction for research.

Background/Aims: Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care. Methods: The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations. Results: Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing. Conclusions The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C₀), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug‍-‍drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage* ; Drug Monitoring/methods* ; Humans ; Organ Transplantation ; Immunosuppressive Agents/administration & dosage* ; Delphi Technique

Postoperative infection of internal fixation of closed fractures the lower limbs in adults represents a devastating complication, characterized by diagnostic challenges, prolonged treatment duration and high disability rates. Current management of these infections faces multiple challenges, such as difficulties in early accurate diagnosis, and various controversies about the treatment plan, leading to poor overall diagnosis and treatment results. To address these issues, based on evidence-based medicine and principles with emphasis on scientific rigor, clinical applicability and innovation, the Trauma Branch of the Chinese Medical Association, Orthopedic Branch of the Chinese Medical Doctor Association, Orthopedics Branch of the Chinese Medical Association, and Trauma Orthopedics and Polytrauma Group of the Resuscitation and Emergency Committee of the Chinese Medical Doctor Association have collaboratively organized a panel of relevant experts to develop the Guideline for diagnosis and treatment of infection after internal fixation of closed lower limb fractures in adults ( version 2025). The guideline proposed 10 recommendations, aiming to provide a foundation for standardized diagnosis and treatment of postoperative infection in adults with closed lower limb fractures.

Gene regulation relies on the precise binding of transcription factors (TFs) at regulatory elements, but simultaneously detecting hundreds of TFs on chromatin is challenging. We developed cFOOT-seq, a cytosine deaminase-based TF footprinting assay, for high-resolution, quantitative genome-wide assessment of TF binding in both open and closed chromatin regions, even with small cell numbers. By utilizing the dsDNA deaminase SsdAtox, cFOOT-seq converts accessible cytosines to uracil while preserving genomic integrity, making it compatible with techniques like ATAC-seq for sensitive and cost-effective detection of TF occupancy at the single-molecule and single-cell level. Our approach enables the delineation of TF footprints, quantification of occupancy, and examination of chromatin influences on TF binding. Notably, cFOOT-seq, combined with FootTrack analysis, enables de novo prediction of TF binding sites and tracking of TF occupancy dynamics. We demonstrate its application in capturing cell type-specific TFs, analyzing TF dynamics during reprogramming, and revealing TF dependencies on chromatin remodelers. Overall, cFOOT-seq represents a robust approach for investigating the genome-wide dynamics of TF occupancy and elucidating the cis-regulatory architecture underlying gene regulation.
Transcription Factors/genetics* ; Humans ; Chromatin/genetics* ; Animals ; Binding Sites ; Mice ; DNA Footprinting/methods*

OBJECTIVE: To investigate hypertension (HTN) trends, key risk factors, and gender disparities in rural China, and to propose targeted strategies for improving HTN control in resource-limited settings. METHODS: This longitudinal study used data from the Henan Rural Cohort Study, including baseline (2015-2017; n = 39,224) and follow-up (2018-2022; n = 28,621) participants. HTN was defined as systolic/diastolic blood pressure ≥ 140/90 mmHg, self-reported diagnosis, or use of antihypertensive medication. Severity was classified using a 7-tier blood pressure (BP) staging system (optimal, normal, high normal, and HTN stages 1-4). A generalized linear mixed-effects model (GLMM) identified associated risk factors. RESULTS: HTN prevalence increased modestly from 32.7% (95% CI: 32.2-33.2) to 33.9% (95% CI: 33.3%-34.4%). Awareness and treatment improved from 20.1% to 25.3%, and from 18.8% to 24.4%, respectively, but control rates remained low (6.2% to 12.3%). After adjustment, women had a 1.53-fold higher HTN risk than men ( OR = 1.53, 95% CI: 1.43-1.63), revealing gender-specific trends. Key risk factors included alcohol use ( OR = 1.37, 95% CI: 1.27-1.47) and overweight status ( OR = 1.76, 95% CI: 1.66-1.86). BP staging showed an increase in optimal BP (42.3% to 45.8%), but stagnant management of advanced HTN stages. CONCLUSION Hypertension in rural China is shaped by behavioral risk factors and healthcare access gaps. Gender-sensitive, community-based interventions, including task-shifting models, are necessary to mitigate the growing burden of hypertension.
Humans ; Hypertension/etiology* ; China/epidemiology* ; Female ; Male ; Rural Population/statistics & numerical data* ; Prevalence ; Risk Factors ; Middle Aged ; Adult ; Aged ; Longitudinal Studies ; Sex Factors ; Cohort Studies ; East Asian People

Chagas disease(American trypanosomiasis)is a zoonosis caused by Trypanosoma cruzi,which severely affects public health.Recently,with changes in economic globalization and increased population mobility,this disease has gradually spread from the original Latin American epidemic areas to non-epidemic areas,such as Europe,thus showing a trend of globalization.The main trans-mission routes have changed from transmission via the Triatomine vector to blood transfusion transmission,mother-to-child transmis-sion,oral transmission,and other routes.Consequently,Chagas disease is spreading globally,and more people are increasingly vul-nerable to infection.This article retrospectively reviews research on the transmission routes of Chagas disease,analyzes the changing trends in transmission routes,and provides a scientific basis for the formulation and optimization of Chagas disease prevention and con-trol strategies from a One Health perspective.

Objective::This study aimed to assess the impact of proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitor treatment immediately after percutaneous coronary intervention (PCI) on the myocardial salvage index (MSI) in patients with anterior ST-segment elevation myocardial infarction (STEMI) 5-10 d after the procedure.Methods::The early PCSK9 inhibitor thERapy Following pErcutaneous Coronary inTervention (PERFECT) trial is a prospective randomized controlled trial. From January 2021 to December 2023, 32 patients with anterior STEMI from Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Songjiang Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, and Shanghai Tenth People’s Hospital were enrolled in the PERFECT trial. Patients were randomly assigned in a 1∶1 ratio to the PCSK9 inhibitor group ( n = 16) or the control group ( n = 16), and their baseline data were collected. Patients in the PCSK9 inhibitor group (ie, alirocumab group) received a subcutaneous injection of PCSK9 inhibitor (alirocumab, 75 mg) immediately after PCI based on conventional treatment. In the control group, patients received only conventional treatment. The primary endpoint was the MSI measured by cardiovascular magnetic resonance 5-10 d after PCI. The secondary endpoints included the left ventricular ejection fraction measured by cardiovascular magnetic resonance 5-10 d after PCI and the time to peak of creatine kinase isoenzyme-MB and high-sensitivity cardiac troponin T. Safety endpoints included any clinical adverse events that occurred during the 6-month follow-up period. Results::Baseline data during admission showed no intergroup significance. No significant difference in MSI (55.54% ± 14.80% vs. 44.72% ± 15.42%, P = 0.056) and left ventricular ejection fraction (51.24% ± 8.91% vs. 44.99% ± 8.84%, P = 0.060) was observed. Additional, there was no significant difference in the time to peak of creatine kinase isoenzyme-MB ((12.97 ± 5.67) h vs. (14.31 ± 7.04) h, P = 0.557) and high-sensitivity cardiac troponin T ((21.03 ± 12.46) h vs. (21.44 ± 9.99) h, P = 0.920) between the 2 groups. During the 6-month follow-up period, only 1 patient in the PCSK9 inhibitor group developed cerebral hemorrhage 6 months after PCI. Conclusions::Early treatment with alirocumab did not exhibit a significant increase in MSI at 5-10 d in patients with anterior STEMI. Larger trials are necessary to evaluate the impact of early administration of PCSK9 inhibitors after myocardial infarction.

Designation of ideological and political teaching of Medical Immunology courses focuses on"cultivate talent for Party and the State",and adheres to goal of"build morality and cultivate people".From perspective of big ideology and politics,with basic foundation of"major guiding,disciplines supporting and curriculum shaping",principle of"six combinations"is applied to con-struct ideological and political cases of Medical Immunology courses,to create an infiltrating teaching pattern,which simultaneously cultivate talent for the Party and the State,and forms a synergistic effect of professional course learning and ideological and political learning.