This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

Varicocele (VC) is a common cause of male infertility, yet there is a lack of molecular information for VC-associated male infertility. This study investigated alterations in the seminal plasma metabolomic and lipidomic profiles of infertile male VC patients. Twenty infertile males with VC and twenty-three age-matched healthy controls (HCs) were recruited from Peking Union Medical College Hospital (Beijing, China) between October 2019 and April 2021. Untargeted metabolite and lipid profiles from seminal plasma were analyzed using mass spectrometry. Four hundred and seventy-six metabolites and seventeen lipids were significantly different in infertile male VC patients compared to HCs. The top enriched pathways among these significantly different metabolites are protein digestion and absorption, aminoacyl-transfer RNA (tRNA) biosynthesis, and biosynthesis of amino acids. Different key lipid species, including triglyceride (TG), diacylglycerol (DG), ceramides (Cer), and phosphatidylserine (PS), varied between VC and HC groups. The distinct metabolites and lipids were moderately correlated. DL-3-phenyllactic acid is a potential diagnostic biomarker for VC-related male infertility (area under the curve [AUC] = 0.893), positively correlating with sperm count, concentration, and motility. Furthermore, DL-3-phenyllactic acid is the only metabolite shared by all four comparisons (VC vs HC, VC-induced oligoasthenospermia [OAS] vs VC-induced asthenospermia [AS], OAS vs HC, and AS vs HC). DL-3-phenyllactic acid significantly decreased in OAS than AS. Metabolite-targeting gene analysis revealed carbonic anhydrase 9 (CA9) might be the strongest candidate associated with the onset and severity of VC. The seminal plasma metabolite and lipid profiles of infertile males with VC differ significantly from those of HCs. DL-3-phenyllactic acid could be a promising biomarker.
Humans ; Male ; Varicocele/complications* ; Infertility, Male/etiology* ; Semen/metabolism* ; Lipidomics ; Adult ; Metabolomics ; Case-Control Studies ; Biomarkers/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Iron overload is strongly associated with heart disease. Ferroptosis is a new form of regulated cell death indicated in cardiac ischemia-reperfusion (I/R) injury. However, the specific molecular mechanism of myocardial injury caused by iron overload in the heart is still unclear, and the involvement of ferroptosis in iron overload-induced myocardial injury is not fully understood. In this study, we observed that ferroptosis participated in developing of iron overload and I/R-induced cardiomyopathy. Mechanistically, we discovered that Parkin inhibited iron overload-induced ferroptosis in cardiomyocytes by promoting the ubiquitination of long-chain acyl-CoA synthetase 4 (ACSL4), a crucial protein involved in ferroptosis-related lipid metabolism pathways. Additionally, we identified p53 as a transcription factor that transcriptionally suppressed Parkin expression in iron-overloaded cardiomyocytes, thereby regulating iron overload-induced ferroptosis. In animal studies, cardiac-specific Parkin knockout mice (Myh6-CreER ^T2 /Parkin ^fl/fl ) fed a high-iron diet presented more severe myocardial damage, and the high iron levels exacerbated myocardial I/R injury. However, the ferroptosis inhibitor Fer-1 significantly suppressed iron overload-induced ferroptosis and myocardial I/R injury. Moreover, Parkin effectively protected against impaired mitochondrial function and prevented iron overload-induced mitochondrial lipid peroxidation. These findings unveil a novel regulatory pathway involving p53-Parkin-ACSL4 in heart disease by inhibiting of ferroptosis.

Objective To develop a deep learning model based on fundus retinal images to improve the detection rate of mild cognitive impairment(MCI)in patients with coronary heart disease,achieve early intervention and improve prognosis.Methods The study was a single-center cross-sectional study that retrospectively included patients diagnosed with coronary heart disease(CHD)by coronary angiography(≥50％ stenosis of at least one coronary vessel)from Beijing Anzhen Hospital between November 2021 and December 2022.The whole data set was randomly divided into the training set and the testing set according to the ratio of 8∶2 for model development.After that,the patient data of the same center from January 2023 to April 2023 were included in the time verification method to verify the model.The diagnostic criteria for MCI were MMSE＜27 or MoCA＜26.Four kinds of convolutional neural network(CNN)architectures were used to train fundus images,and a comprehensive vision model of MCI detection was established through model integration.The area under the curve(AUC),sensitivity and specificity of the receiver operating curve(ROC)were used to evaluate the performance of the AI model.Results We collected 5 880 eligible fundus images from 3 368 CHD patients.Based on the results of the MMSE scale,the algorithm was labeled,including 2 898 males and 527 MCI patients.The AUC of the deep learning model in the test group is 0.733(95％CI 0.688-0.778),and the sensitivity of the algorithm in the test group is 0.577(95％CI 0.528-0.625)by using the operating point with the maximum sum of sensitivity and specificity.With a specificity of 0.758(95％CI 0.714-0.802),corresponding to a validated AUC of 0.710(95％CI 0.601-0.818).Based on the results of the MoCA scale,the algorithm labels 2 437 males and 1 626 MCI patients.The AUC of the deep learning model in the test group was 0.702(95％CI 0.671-0.733).The operating point with the maximum sum of sensitivity and specificity was selected,and the sensitivity of the algorithm was 0.749(95％CI 0.719-0.778)and the specificity was 0.561(95％CI 0.527-0.595),corresponding to the AUC value of the verification group was 0.674(95％CI 0.622-0.726).Conclusions The deep learning algorithm model based on fundus images has good diagnostic performance,and may be used as a new non-invasive,convenient and rapid screening method for MCI in CHD population.

Objective To investigate the clinical characteristics of preoperative intestinal symptoms in patients with bowel endometriosis and to compare the effects of shaving versus segmental bowel resection on postoperative intestinal function.Methods A total of 105 patients diagnosed with bowel endometriosis and treated by the same surgical team at the Obstetrics and Gynecology Hospital,Fudan University between Aug 1,2013 and Dec 30,2017 were prospectively enrolled in this study.Clinical data were collected via outpatient visits and telephone follow-ups at four time points:preoperative(T0)and postoperative(T1:Nov 2018;T2:Nov 2020;T3:Apr 2024).The primary outcome was bowel symptoms and gastrointestinal function scores;secondary outcome was pain scores.A generalized estimating equation(GEE)model was used to analyze the interaction effect of surgical approach and follow-up time on outcomes.Results Ultimately,a total of 89 patients were included(15.24%loss to follow-up),among whom 79 patients(88.76%)underwent shaving excision.Preoperatively,46 patients(51.68%)presented with bowel symptoms,primarily anus bulge(21 cases,46.65%)and diarrhea(15 cases,32.61%)during menstruation.Postoperatively,there was a significant increase in constipation rates(T1:71.43%;T2:50.00%;T3:72.00%).Both surgical groups exhibited significant improvements in dysmenorrhea,gastrointestinal discomfort scores as well as gastrointestinal quality of life index(P<0.000 5).However,the segmental resection group had significantly higher scores for low anterior resection syndrome,constipation compared with the shaving excision group(P=0.02 and P=0.05).Conclusion Approximately half of the patients with bowel endometriosis exhibit typical bowel symptoms preoperatively,such as anus bulge and diarrhea.Both shaving excision and segmental resection effectively alleviate pain;however,shaving excision demonstrates an advantage regarding preservation of bowel function,whereas segmental resection may elevate risks associated with postoperative constipation or altered defecation patterns due to structural changes.The selection of surgical approach should carefully balance lesion removal and functional preservation,moreover,be sure that potential risks are thoroughly informed to patients prior to surgery.