Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

Objective: Huntington’s disease (HD) is characterized by motor, cognitive, and neuropsychiatric symptoms. Oculomotor impairments and gait variability have been independently considered as potential markers in HD. However, an integrated analysis of eye movement and gait is lacking. We performed multiple examinations of eye movement and gait variability in HTT mutation carriers, analyzed the consistency between these parameters and clinical severity, and then examined the associations between oculomotor impairments and gait deficits. Methods: We included 7 patients with pre-HD, 30 patients with HD and 30 age-matched controls. We collected demographic data and assessed the Unified Huntington’s Disease Rating Scale (UHDRS) score. Examinations, including saccades, smooth pursuit tests, and optokinetic (OPK) tests, were performed to evaluate eye movement function. The parameters of gait include stride length, walking velocity, step deviation, step length, and gait phase. Results: HD patients have significant impairments in the latency and velocity of saccades, the gain of smooth pursuit, and the gain and slow phase velocities of OPK tests. Only the speed of saccades significantly differed between pre-HD patients and controls. There are significant impairments in stride length, walking velocity, step length, and gait phase in HD patients. The parameters of eye movement and gait variability in HD patients were consistent with the UHDRS scores. There were significant correlations between eye movement and gait parameters. Conclusion Our results show that eye movement and gait are impaired in HD patients and that the speed of saccades is impaired early in pre-HD. Eye movement and gait abnormalities in HD patients are significantly correlated with clinical disease severity.

Objective To analyze the risk factors for prolonged length of hospital stay in patients with peritoneal dialysis associated peritonitis(PDAP)and construct a nomogram based on Logistic regression model.Methods A retrospective study was conducted on patients with PDAP who were hospitalized at the Affiliated Hospital of Jiangsu University from January 2013 to December 2023.Using the 75th percentile of hospitalization time as the cutoff(>21 days),the patients were divided into prolonged length of hospital stay group and normal length of hospital stay group.Clinical data were compared between the two groups.Logistic regression analysis was used to analyze the risk factors for prolonged hospital stay in PDAP patients and to construct a nomogram.Results A total of 131 PDAP patients were included in this study,including 40 cases in prolonged length of hospital stay group and 91 cases in normal length of hospital stay group.Multivariate Logistic regression analysis showed that Gram-negative bacteria detected in ascites(OR=6.012,95% CI=1.878-19.248,P=0.003)and elevated platelet count(OR=1.010,95% CI=1.005-1.015,P<0.001)were independent risk factors for prolonged length of hospital stay,while elevated serum chloride(OR=0.885,95% CI=0.802-0.978,P=0.016)was a protective factor.Based on the above three indicators,a nomogram was constructed.The multivariate Logistic regression model showed an area under the receiver operating characteristic curve(AUC)of 0.755,with an internal validation AUC of 0.727 using the Bootstrap method.The calibration curve indicated that the predicted probability was consistent with the actual probability.The decision curve showed that the model was clinically applicable when the threshold probabilities were 9%-10%,13% and 18%-92%.Conclusion A nomogram,based on the detection of gram-negative bacteria in ascites,platelet count and serum chloride,was helpful for clinical screening PADP patients at risk for prolonged length of hospital stay,and can provide a basis for optimizing clinical decision-making.
Humans ; Nomograms ; Risk Factors ; Peritoneal Dialysis/adverse effects* ; Retrospective Studies ; Length of Stay ; Peritonitis/etiology* ; Logistic Models ; Male ; Female ; Middle Aged ; Aged

ObjectiveTo understand the prevalence of tobacco use among residents aged 15 years old and above in Jiading District of Shanghai, and to provide a scientific basis for formulating effective regional tobacco control policies. MethodsThe Probability Proportional to Size (PPS) sampling method was employed to select one neighborhood committee (village) from each of Jiading District’s 11 subdistricts as survey monitoring sites. From the household registry of each selected neighborhood committee (village), 50 residential households were randomly sampled, resulting in a total of 550 households surveyed. Within each selected household, one permanent resident aged 15 years old or above was randomly chosen to complete the questionnaire. The content covered general information, exposure to secondhand smoke, awareness of tobacco related health hazards, etc. Statistical analyses were performed using SPSS 27.0 software. ResultsA total of 550 questionnaires were distributed, with 549 valid responses collected, and the effective response rate was 99.82%. The survey findings revealed that in 2023, the current smoking rate among individuals aged 15 years old and above in Jiading District of Shanghai was 18.76%, with males accounting for 38.93% and females accounting for 2.62%. Male gender was identified as a relative factor for smoking (OR=34.108, 95%CI: 14.440‒80.722), whereas higher education attainment emerged as a protective factor against smoking (OR=0.388, 95%CI: 0.184‒0.820). Among non-smokers aged 15 years old and above in Jiading District, the secondhand smoke exposure rate was 46.86%, with statistically significant differences observed across different age groups and occupations (P<0.001). Restaurants exhibited the highest secondhand smoke exposure rate of 42.14%, followed by households bearing (36.79%). The overall awareness rate among individuals aged 15 years old and above in Jiading District regarding four smoking-related diseases, namely stroke, heart disease, lung cancer, and impotence, was 48.45%, while the awareness rate for three secondhand smoke-induced diseases, namely adult heart disease, pediatric pulmonary disease, and adult lung cancer, was 64.29%. ConclusionThere is still room for reduction in the prevalence of tobacco use among individuals aged 15 yeas old and above in Jiading District. The exposure to secondhand smoke is severe, and residents have low awareness of the harm of tobacco. Tobacco control law enforcement should be strengthened, smoke-free-home health education should be included in tobacco control efforts, and targeted health education should be carried out.

Investigating the correlation between micronucleus formation and male infertility has the potential to improve clinical diagnosis and deepen our understanding of pathological progression. Our study enrolled 2252 male patients whose semen was analyzed from March 2023 to July 2023. Their clinical data, including semen parameters and age, were also collected. Genetic analysis was used to determine whether the sex chromosome involved in male infertility was abnormal (including the increase, deletion, and translocation of the X and Y chromosomes), and subsequent semen analysis was conducted for clinical grouping purposes. The participants were categorized into five groups: normozoospermia, asthenozoospermia, oligozoospermia, oligoasthenozoospermia, and azoospermia. Patients were randomly selected for further study; 41 patients with normozoospermia were included in the control group and 117 patients with non-normozoospermia were included in the study group according to the proportions of all enrolled patients. Cytokinesis-block micronucleus (CBMN) screening was conducted through peripheral blood. Statistical analysis was used to determine the differences in micronuclei (MNi) among the groups and the relationships between MNi and clinical data. There was a significant increase in MNi in infertile men, including those with azoospermia, compared with normozoospermic patients, but there was no significant difference between the genetic and nongenetic groups in azoospermic men. The presence of MNi was associated with sperm concentration, progressive sperm motility, immotile spermatozoa, malformed spermatozoa, total sperm count, and total sperm motility. This study underscores the potential utility of MNi as a diagnostic tool and highlights the need for further research to elucidate the underlying mechanisms of male infertility.
Humans ; Male ; Infertility, Male/genetics* ; Adult ; Micronucleus Tests ; Semen Analysis ; Oligospermia/genetics* ; Azoospermia/genetics* ; Chromosome Aberrations ; Sperm Count ; Micronuclei, Chromosome-Defective ; Middle Aged

OBJECTIVES: To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). METHODS: A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. RESULTS: A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (P>0.05). CONCLUSIONS The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.
Humans ; Male ; Female ; Infant ; Child, Preschool ; Craniocerebral Trauma/complications* ; Follow-Up Studies ; Retrospective Studies ; Basal Ganglia/pathology* ; Infant, Newborn

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the relationship between the polygenic risks for various psychiatric disorders and clinical and neuropsychological characteristics in children with attention-deficit/hyperactivity disorder (ADHD). METHODS: Using a cross-sectional design, 285 children with ADHD and 107 healthy controls were assessed using the Child Behavior Checklist, the Behavior Rating Inventory of Executive Function for parents, the Wechsler Intelligence Scale for Children, Fourth Edition, and the Cambridge Neuropsychological Test Automated Battery. Blood samples were collected for genetic data. Polygenic risk scores (PRSs) for various psychiatric disorders were calculated using the PRSice-2 software. RESULTS: Compared with the healthy controls, the children with ADHD displayed significantly higher PRSs for ADHD, major depressive disorder, anxiety disorder, and obsessive-compulsive disorder (P<0.05). In terms of daily-life executive function, ADHD-related PRS was significantly correlated with the working memory factor; panic disorder-related PRS was significantly correlated with the initiation factor; bipolar disorder-related PRS was significantly correlated with the shift factor; schizophrenia-related PRS was significantly correlated with the inhibition, emotional control, initiation, working memory, planning, organization, and monitoring factors (P<0.05). The PRS related to anxiety disorders was negatively correlated with total IQ and processing speed index (P<0.05). The PRS related to obsessive-compulsive disorder was negatively correlated with the processing speed index and positively correlated with the stop-signal reaction time index of the stop-signal task (P<0.05). CONCLUSIONS PRSs for various psychiatric disorders are closely correlated with the behavioral and cognitive characteristics in children with ADHD, which provides more insights into the heterogeneity of ADHD.
Humans ; Attention Deficit Disorder with Hyperactivity/genetics* ; Child ; Male ; Female ; Cross-Sectional Studies ; Neuropsychological Tests ; Multifactorial Inheritance ; Adolescent ; Mental Disorders/etiology* ; Executive Function ; Genetic Risk Score

OBJECTIVES: To investigate the causal relationship between Helicobacter pylori (Hp) infection and immune thrombocytopenia (ITP) using Mendelian randomization (MR), as well as the association between Hp infection and chronic ITP (cITP) through a clinical study. METHODS: The datasets from genome-wide association studies were used to select the single nucleotide polymorphism loci significantly associated with Hp infection as genetic instrumental variables. The MR analysis model was used to investigate the causal relationship between ITP and Hp infection. A retrospective analysis was conducted on the medical data of 316 children with newly diagnosed ITP at the First Affiliated Hospital of Xinjiang Medical University from January 2020 to December 2023. The children were followed up for 1 year, and a multivariate logistic regression analysis was used to investigate the risk factors for cITP. RESULTS: The inverse variance weighted analysis revealed that Hp infection was significantly associated with an increased risk of ITP (OR=1.280, 95%CI: 1.098-1.492, P=0.002). There was no heterogeneity or pleiotropy in this MR study (P>0.05), and the model was stable. The "leave-one-out" sensitivity analysis verified the reliability of the results. The multivariate logistic regression analysis demonstrated that Hp infection was an independent risk factor for progression to cITP (OR=7.916, 95%CI: 3.327-18.832, P<0.001). CONCLUSIONS Hp infection is a risk factor for the onset of ITP and is an independent risk factor for cITP in children.
Humans ; Helicobacter Infections/complications* ; Purpura, Thrombocytopenic, Idiopathic/etiology* ; Child ; Male ; Female ; Helicobacter pylori ; Prognosis ; Child, Preschool ; Logistic Models ; Retrospective Studies ; Risk Factors ; Polymorphism, Single Nucleotide ; Adolescent ; Infant