Background: and Purpose Vertebrobasilar fusiform aneurysms (VBFAs) carry substantial morbidity and mortality, but optimal management for unruptured VBFAs remains unclear. We compared the safety and efficacy of conservative management (CM), stent-assisted coiling (SAC), and flow diverters (FDs) in patients with unruptured VBFAs, focusing on long-term prognosis. Methods: This study included data from a nationwide Chinese cohort of patients with vertebrobasilar dissecting aneurysms. Inverse probability of treatment weighting (IPTW) balanced confounders across groups. The primary outcome was poor prognosis (modified Rankin Scale score >2). Secondary outcomes included aneurysm rupture, ischemic stroke, compression symptoms, and VBFA-related deaths. Logistic regression estimated odds ratios (ORs) and 95% confidence intervals (CIs). Subgroup and sensitivity analyses were performed. Results: Among 1,115 patients with unruptured VBFAs, 838 (median age, 54 years; 655 men) were included. After IPTW, baseline characteristics were balanced. Median follow-up was 54 months. FD was associated with a lower risk of poor prognosis than CM (OR, 0.48 [95% CI, 0.30 to 0.77]; p=0.002), with no difference between CM and SAC. FD also reduced aneurysm rupture (OR, 0.20 [95% CI, 0.07 to 0.60]; p=0.004) and compression symptoms (OR, 0.30 [95% CI, 0.13 to 0.68]; p=0.004) versus CM. Time-to-event analyses further revealed significant differences in vertebral artery lesions and Type I–II VBFAs, whereas no significant differences were observed in basilar or vertebrobasilar junction lesions or in Type III–IV VBFAs. Conclusions Compared with CM, FD was associated with improved long-term outcomes in unruptured VBFAs, particularly in vertebral artery lesions and Type I–II VBFAs, although residual confounding cannot be excluded.

ObjectiveHepatocellular carcinoma (HCC) represents 90% of all primary liver cancers. The main risk factors associated with HCC include viral hepatitis (B and/or C), alcohol abuse, and metabolic dysfunction-associated steatotic liver disease (MASLD), which progressively advance to liver fibrosis, cirrhosis, and ultimately evolve into HCC. Surgical resection represents the most effective treatment for HCC, while recent advances in immunotherapy, including immune checkpoint inhibitors and adoptive cell therapies, have provided improved treatment prospects for patients with unresectable HCC. However, the complex metabolic heterogeneity of HCC limits the therapeutic efficacy. Metabolic intermediates acyl-CoA not only provide energy and substrates for numerous biochemical reactions but also serve as donors for protein lysine acylation, a major class of post-translational modification (PTM). Therefore, a deeper understanding of the molecular mechanisms underlying protein lysine acylation and hepatocarcinogenesis is urgently needed. MethodsThe levels of protein lysine acylation and silence information regulator 5 (SIRT5) expression levels in clinical HCC samples were analyzed by Western blot. Quantitative malonylome and succinylome of HCC samples were analyzed by antibody-based affinity enrichment coupled with tandem mass spectrometry. The proliferation of HCC cells was analyzed with Cell Counting Kit-8 (CCK-8) assays, the apoptosis was quantified by Annexin V-FITC/propidium iodide (PI) staining coupled with flow cytometry, and the ability of cells to migrate was assayed by Transwell assays. The enzymatic activity of glutathione S-transferase Mu 1 (GSTM1) was quantified. Transgenic mice with hepatic overexpression of SIRT5 were constructed using CRISPR-Cas9, and primary hepatocarcinogenesis was induced by administration of diethylnitrosamine. ResultsWestern blot analysis indicated that the expression level of SIRT5 was elevated in clinical samples from HCC patients, and the levels of lysine malonylation, glutarylation, and succinylation were significantly reduced in HCC tissues. Knockout of SIRT5 in MHCC-97H and MHCC-97L hepatoma cells suppressed cell proliferation, and increased the percentage of apoptotic cells significantly. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the differentially malonylome and succinylome of HCC samples revealed significant enrichment in two major classes of biological processes: core energy metabolism (e.g., glycolysis/gluconeogenesis, tricarboxylic acid metabolic process, fatty acid beta oxidation) and detoxification and oxidative stress response (e.g., response to toxic substance, chemical carcinogenesis, reactive oxygen species (ROS)). SIRT5 removes malonylation from lysine residues in GSTM1 and restores its detoxification activity, which is crucial for the survival of hepatocytes under stressed conditions. More importantly, in vivo experiment indicated that hepatic-specific overexpression of SIRT5 in mice accelerated diethylnitrosamine-induced liver fibrosis and hepatocarcinogenesis, indicating the critical role of SIRT5 in HCC progression. ConclusionThis study highlights the previously unrecognized SIRT5-GSTM1 axis as a key regulator in hepatocarcinogenesis, and suggests a potential target for the treatment of patients with HCC.

Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

Nine compounds were isolated and purified from 90% ethanol extract of Alstonia mairei Lévl by using various chromatographic methods, including silica gel, SephadexLH-20, MCI Gel and ODS column chromatography, combined with semi-preparative liquid phase separation methods. Modern spectroscopic methods (1D and 2D NMR, UV, IR, MS, etc.) were used to identify the structures of the isolated compounds. They were identified as mairoside A (1), 3′,6-di-O-sinaloylsucrose (2), myristic acid (3), methyl myristate (4), ethyl myristate (5), 3,4,5-trimethoxycinnamic acid (6), 3,4,5-trimethoxybenzoic acid (7), vinoline (8), kaempferol-3-O-rutinoside (9), among which compound 1 is a new glycoside, compounds 4 and 5 are new natural products, and the nuclear magnetic data of compound 4 were reported for the first time.

Eight compounds were isolated and purified from the ethyl acetate part of 70% acetone extract of Rehmannia glutinosa by various chromatographic techniques such as silica gel, MCI gel CHP-20, ODS, Toyopearl HW-40C, combined with TLC and semi-preparative HPLC. Their structures were elucidated by modern spectroscopy techniques (NMR, MS, UV, IR), and identified as neomartynoside A (1), osmanthuside B₆ (2), martynoside (3), isomartynoside (4), (E)-p-hydroxycinnamic acid (5), caffeic acid (6), ferulic acid (7), and methyl caffeate (8). Compound 1 is a new phenylethanol glycoside, which was identified as neomartynoside A. Compound 2 was isolated from Rehmannia glutinosa for the first time. In addition, compounds 2, 6 and 7 significantly increased relative glucose consumption, showing potential hypoglycemic activity.

In recent years, significant progress has been made in the field of liver transplantation in terms of donor expansion, technological innovation and perioperative management. Machine perfusion technology, through dynamic repair and assessment of donor liver quality, can effectively reduce postoperative complications and increase the utilization rate of marginal donor livers. The optimization of split liver transplantation technology combined with normothermic perfusion further alleviates the shortage of donors, but its promotion is still limited by technical barriers. Xenotransplantation has achieved preclinical breakthroughs in the field of genetically modified pig livers, but ethical and immune barrier issues need to be urgently resolved. In the field of liver cancer liver transplantation, the focus is on neoadjuvant treatment with immune checkpoint inhibitors and the development of recurrence prediction models, which promotes precise treatment. For perioperative management, the optimization of individualized immunosuppressive regimens, artificial liver support, and strategies for the prevention and control of vascular complications has significantly improved patients’ survival rates. Personalized treatment for children, elderly recipients, and recipients with multiple comorbidities provides new ideas for liver transplantation in special populations. In the future, liver transplantation research may focus on the integration of multidisciplinary approaches, individualized treatment and emerging technologies to advance the global liver transplantation cause to new heights.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

OBJECTIVES: To study the clinical characteristics of pediatric Behçet syndrome (BS). METHODS: A retrospective review was conducted on the medical records of children hospitalized in the Department of Pediatrics at the Second Hospital of Hebei Medical University between December 2014 and December 2024 who met diagnostic criteria for BS. RESULTS: Among 45 children with BS, 26 (58%) were male. Oral aphthous ulcers were the most common manifestation (43/45, 96%), followed by genital ulcers (23/45, 51%) and gastrointestinal involvement (18/45, 40%). Genital ulcers were more frequent in girls, whereas ocular involvement was more common in boys (P<0.05). The pathergy test was positive in 10 (22%), and HLA-B51 was positive in 13 (29%). Fecal calprotectin (FC) was elevated in 16 (36%); gastrointestinal involvement was more frequent in children with elevated FC than in those with normal FC (P<0.05). According to the respective criteria, 17 (38%) patients met the International Study Group criteria (1990), 33 (73%) met the International Criteria for Behçet Disease (2014), and 13 (29%) met the Pediatric Behçet Disease criteria (2015). CONCLUSIONS Pediatric BS shows marked clinical heterogeneity. HLA-B51 is associated with disease susceptibility.
Humans ; Behcet Syndrome/genetics* ; Male ; Female ; Child ; Retrospective Studies ; Adolescent ; Child, Preschool ; Leukocyte L1 Antigen Complex/analysis* ; HLA-B51 Antigen

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse