Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

OBJECTIVE: This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity. METHODS: We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set). RESULTS: In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes. CONCLUSION In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans ; Non-alcoholic Fatty Liver Disease/genetics* ; Child ; Male ; Female ; Genetic Predisposition to Disease ; Case-Control Studies ; Exome Sequencing ; Adolescent ; Polymorphism, Single Nucleotide ; Obesity/complications* ; Pediatric Obesity/complications* ; China

Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans ; Lymphoma, B-Cell, Marginal Zone/pathology* ; Lymph Nodes/pathology* ; Neck/pathology* ; Male

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain. METHODS: A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC. RESULTS: The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml^-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r²=0.045, P<0.01). CONCLUSION Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans ; Female ; Male ; Middle Aged ; Osteoarthritis, Knee/metabolism* ; Aged ; Adult ; Bone and Bones/metabolism* ; Pain/etiology* ; Biomarkers/metabolism*

Drug-induced liver injury(DILI)is a common adverse drug reaction in clinical practice,which can lead to acute liver failure and even death in severe cases.In recent years,with the continuous introduction of new drugs and the expansion of their usage,the incidence and mortality rates of DILI have shown an upward trend,posing significant challenges to public health and clinical treatment.Macrophages,as a crucial component of the innate immune system,exhibit high plasticity and heterogeneity.They can polarize into pro-inflammatory M1 type or anti-inflammatory M2 type in response to microenvironmental signals.Research has demonstrated that macrophage polarization plays a central regulatory role in the occurrence and progression of DILI by influencing various processes such as inflammatory responses,cell apoptosis,and tissue repair.This review focuses on elucidating the regulatory mechanisms and roles of macrophage polarization in DILI,providing a theoretical framework for developing precise immunotherapeutic strategies.

BACKGROUND:Iron overload is an independent factor inducing osteoporosis,but the action mechanism is currently unclear.Therefore,exploring the effects of iron overload on osteoblast-related cells will help to deeply understand the pathogenesis of osteoporosis and provide potential strategies for osteoporosis treatment.OBJECTIVE:To explore the effects of iron overload environment on osteoblast precursor cell activity,ferroptosis,and osteogenic differentiation.METHODS:Osteoblast precursor cells(MC3T3-E1 cells)were divided into blank group,iron overload group,fer-1 group,and deferoxamine group.The iron overload group was treated with 300 μmol/L ammonium ferric citrate in the culture medium for 48 hours to simulate the iron overload microenvironment.The cells in fer-1 group and deferoxamine group were pretreated with 5 μmol/L antioxidant fer-1 and 5 μmol/L deferoxamine for 8 hours,respectively,and then added with 300 μmol/L ammonium ferric citrate for 48 hours.CCK-8 assay was used to determine the cell viability.Intracellular reactive oxygen species levels were detected employing a reactive oxygen species fluorescent probe.Changes in mitochondrial membrane potential were monitored with a mitochondrial membrane potential fluorescent probe.Mitochondrial morphology was observed employing transmission electron microscopy.Cellular glutathione levels were measured with a reduced glutathione colorimetric assay kit.Lipid peroxidation levels were assessed with a malondialdehyde colorimetric assay kit.Cellular ferrous ion levels were determined with a ferrous ion colorimetric assay kit.The osteogenic and mineralization capabilities of the cells were verified by alkaline phosphatase staining and alizarin red staining.Collagen secretion ability was detected using Sirius Red staining.The expression of osteogenic/ferroptosis-related genes and proteins was examined through reverse transcription quantitative polymerase chain reaction and western blot analysis.RESULTS AND CONCLUSION:(1)In an iron-overload environment,the mitochondrial membrane potential of cells decreased and their structure was compromised,with an elevation in intracellular lipid peroxidation levels and a downregulation of genes and proteins associated with ferroptosis resistance.However,pretreatment with fer-1 and deferoxamine led to an increase in mitochondrial membrane potential and partial restoration of morphology,a reduction in intracellular lipid peroxidation levels,and an upregulation of genes and proteins related to ferroptosis resistance.(2)In an iron-overload environment,the levels of cellular alkaline phosphatase,the formation of mineralized nodules,and the synthesis of collagen fibers were all found to be decreased.Pretreatment with fer-1 and deferoxamine was observed to upregulate the expression of osteogenic differentiation in cells.(3)In summary,iron overload could increase intracellular oxidative stress levels,mediate ferroptosis in MC3T3-E1 cells and inhibit osteogenic differentiation,thereby inducing osteoporosis.Therefore,maintaining iron homeostasis and inhibiting osteogenesis-related ferroptosis may be potential strategies to prevent or treat osteoporosis.