Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

OBJECTIVE: To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain. METHODS: A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC. RESULTS: The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml^-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r²=0.045, P<0.01). CONCLUSION Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans ; Female ; Male ; Middle Aged ; Osteoarthritis, Knee/metabolism* ; Aged ; Adult ; Bone and Bones/metabolism* ; Pain/etiology* ; Biomarkers/metabolism*

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND:Iron overload is an independent factor inducing osteoporosis,but the action mechanism is currently unclear.Therefore,exploring the effects of iron overload on osteoblast-related cells will help to deeply understand the pathogenesis of osteoporosis and provide potential strategies for osteoporosis treatment.OBJECTIVE:To explore the effects of iron overload environment on osteoblast precursor cell activity,ferroptosis,and osteogenic differentiation.METHODS:Osteoblast precursor cells(MC3T3-E1 cells)were divided into blank group,iron overload group,fer-1 group,and deferoxamine group.The iron overload group was treated with 300 μmol/L ammonium ferric citrate in the culture medium for 48 hours to simulate the iron overload microenvironment.The cells in fer-1 group and deferoxamine group were pretreated with 5 μmol/L antioxidant fer-1 and 5 μmol/L deferoxamine for 8 hours,respectively,and then added with 300 μmol/L ammonium ferric citrate for 48 hours.CCK-8 assay was used to determine the cell viability.Intracellular reactive oxygen species levels were detected employing a reactive oxygen species fluorescent probe.Changes in mitochondrial membrane potential were monitored with a mitochondrial membrane potential fluorescent probe.Mitochondrial morphology was observed employing transmission electron microscopy.Cellular glutathione levels were measured with a reduced glutathione colorimetric assay kit.Lipid peroxidation levels were assessed with a malondialdehyde colorimetric assay kit.Cellular ferrous ion levels were determined with a ferrous ion colorimetric assay kit.The osteogenic and mineralization capabilities of the cells were verified by alkaline phosphatase staining and alizarin red staining.Collagen secretion ability was detected using Sirius Red staining.The expression of osteogenic/ferroptosis-related genes and proteins was examined through reverse transcription quantitative polymerase chain reaction and western blot analysis.RESULTS AND CONCLUSION:(1)In an iron-overload environment,the mitochondrial membrane potential of cells decreased and their structure was compromised,with an elevation in intracellular lipid peroxidation levels and a downregulation of genes and proteins associated with ferroptosis resistance.However,pretreatment with fer-1 and deferoxamine led to an increase in mitochondrial membrane potential and partial restoration of morphology,a reduction in intracellular lipid peroxidation levels,and an upregulation of genes and proteins related to ferroptosis resistance.(2)In an iron-overload environment,the levels of cellular alkaline phosphatase,the formation of mineralized nodules,and the synthesis of collagen fibers were all found to be decreased.Pretreatment with fer-1 and deferoxamine was observed to upregulate the expression of osteogenic differentiation in cells.(3)In summary,iron overload could increase intracellular oxidative stress levels,mediate ferroptosis in MC3T3-E1 cells and inhibit osteogenic differentiation,thereby inducing osteoporosis.Therefore,maintaining iron homeostasis and inhibiting osteogenesis-related ferroptosis may be potential strategies to prevent or treat osteoporosis.

Objective:To explore the therapeutic effect of Banxia Baizhu Tianma Decoction on phlegm-dampness-blocking cervical vertigo and its influence on neck hemodynamics.Methods:96 patients with phlegm-dampness block type cervical vertigo admitted to our hospital from January 2022 to January 2024 were divided into control group and observation group,48 cases in each group.The control group was treated with conventional Western medicine,and the observation group was treated with Banxia Baizhu Tianma Decoction.Both groups were treated for 4 weeks and followed up for 6 months.The reduction time and disappearance time of vertigo were recorded.The score of cervical vertigo Symptom and Function Assessment Scale(ESCV)was performed before treatment and 1 day after treatment.The average blood flow level of basilar artery,right vertebral artery and left vertebral artery was detected,and the total clinical effective rate,recurrence rate and adverse reaction rate of the two groups were compared.Results:The reduction time and disappearance time of vertigo in the observation group were shorter than those in the control group(P＜0.05).Post-treatment,the ESCV score of both groups was higher than that before treatment;compared with the control group,the ESCV score of the observation group was higher post-treatment(P＜0.05).The total clinical effective rate of observation group was higher than that of control group,and the recurrence rate was lower than that of control group(P＜0.05).The hemodynamic index were higher after treatment than in the control group(P＜0.05).There was no difference in the incidence of adverse reactions between the two groups(P＞0.05).Conclusion:Banxia Baizhu Tianma Decoction has certain curative effect on phlegm-dampness block type cervical vertigo,can effectively relieve vertigo symptoms,reduce recurrence,improve neck hemodynamics,and is safe,worthy of popularization and application.

The Animal Molecular Biology course is a crucial and foundational course for both Animal Medicine and Animal Science majors.Apart from teaching fundamental principles of molecular biology,the course provides updated applications of these principles in the field of animal science research.Im-portantly,it plays a fundamental role in cultivating students'research capabilities.With the rise of over-whelming information and their optimal utilization,the demand for integrating digital education with tradi-tional teaching methods is increasing.Based on the five years of teaching practice,this paper summarizes four highlights of the course:the construction of teaching resource,the restructuring of teaching syllabus,the adjustment of classroom teaching hours,and the improvement of assessment methodology.It focuses on Electronic-Learning"E(E-Learning)",offline classroom intensive teaching"C(Classroom)",and post-class extension to construct a blended teaching model that integrates Electronic-Learning and Class-room teaching,namely the"E+C"blended teaching model.Offline classroom teaching emphasizes the combination of theory and knowledge systems,while online Electronic-Learning mainly focuses on popular science and interesting aspects to stimulate students' interests and enthusiasm in learning.Over five years of practice,the"E+C"blended model has been proven to exert a good teaching effect.Students have reported significant gains from the course,with tightly connected and strongly complementary class-room teaching and E-Learning,which greatly aids in mastering professional knowledge.It also cultivates intrinsic motivation for learning and enhances the sense of accomplishment in acquiring knowledge,sig-nificantly improving teaching effectiveness.

AIM To investigate the effects of Shuyu Pills combined with evolimus on the epithelial mesenchymal transformation of triple negative breast cancer cells 4T1 and MDA-MB-231 induced by TGF-β1.METHODS The 4T1 and MDA-MB-231 cells were divided into the blank group and the induction group to induce the epithelial mesenchymal transformation with TGF-β1 cytokine treatment,followed by the assignment into the model group,the Shuyu Pills group,the everolimus group and the Shuyu Pills combined with everolimus group.CCK8 method,plate cloning method,cell scratch test and Transewll test were used to detect the proliferation,cloning formation,migration and invasion ability of the cells whose expressions of E-cadherin,N-cadherin,Vimentin,MMP9,MMP2 and pathway proteins PTEN,PI3K,Akt and mTOR were detected by Western blot.RESULTS Compared with the blank group,the induction group displayed a cell morphological change from epithelioid to stromal,decreased expression of E-cadherin protein(P＜0.01);and increased protein expressions of N-cadherin and Vimentin(P＜0.05).Compared with the model group,each group intervened with the medicine displayed decreased proliferation,clone formation,migration and invasion ability of both kinds of cells(P＜0.01);increased protein expressions of PTEN and E-cadherin(P＜0.05,P＜0.01);and decreased protein expressions of PI3K,Akt,mTOR,N-cadherin,Vimentin,MMP9 and MMP2(P＜0.05,P＜0.01);and more significantly in the Shuyu Pills combined with evolimus group(P＜0.05,P＜0.01).CONCLUSION With a more ideal effect than the single uses in inhibiting the TGF-β1-induced epithelial mesenchymal transformation of triple-negative breast cancer cells,the combination use of Shuyu Pills and everolimus may work through the regulation of PI3K/Akt/mTOR signaling pathway.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.