1.Studies on pharmacological effects and chemical components of different extracts from Bawei Chenxiang Pills.
Jia-Tong WANG ; Lu-Lu KANG ; Feng ZHOU ; Luo-Bu GESANG ; Ya-Na LIANG ; Guo-Dong YANG ; Xiao-Li GAO ; Hui-Chao WU ; Xing-Yun CHAI
China Journal of Chinese Materia Medica 2025;50(11):3035-3042
The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals
;
Drugs, Chinese Herbal/isolation & purification*
;
Mice
;
Male
;
Sleep Initiation and Maintenance Disorders/physiopathology*
;
Humans
;
Myocardial Infarction/drug therapy*
;
Myocardial Ischemia/drug therapy*
2.Clinical correlation study between bone metabolism level and knee osteoarthritis pain.
Yong-Qi SUN ; Ke-Chun GUO ; Ze-Zhong LIU ; Jin-Shuai DUAN ; Bing XU ; Guo-Gang LUO ; Xian-Liang LAI ; Xiao-Feng WANG
China Journal of Orthopaedics and Traumatology 2025;38(5):482-486
OBJECTIVE:
To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain.
METHODS:
A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC.
RESULTS:
The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r2=0.045, P<0.01).
CONCLUSION
Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans
;
Female
;
Male
;
Middle Aged
;
Osteoarthritis, Knee/metabolism*
;
Aged
;
Adult
;
Bone and Bones/metabolism*
;
Pain/etiology*
;
Biomarkers/metabolism*
3.Effectiveness and safety of augmentative plating technique in managing nonunion following intramedullary nailing of long bones in the lower extremity: A systematic review and meta-analysis.
Cong-Xiao FU ; Hao GAO ; Jun REN ; Hu WANG ; Shuai-Kun LU ; Guo-Liang WANG ; Zhen-Feng ZHU ; Yun-Yan LIU ; Wen LUO ; Yong ZHANG ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(3):164-174
PURPOSE:
To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity.
METHODS:
PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3.
RESULTS:
This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002).
CONCLUSION
In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans
;
Bone Nails/adverse effects*
;
Bone Plates/adverse effects*
;
Femoral Fractures/surgery*
;
Fracture Fixation, Intramedullary/methods*
;
Fractures, Ununited/surgery*
;
Lower Extremity/injuries*
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Laboratory Diagnosis and Molecular Epidemiological Characterization of the First Imported Case of Lassa Fever in China.
Yu Liang FENG ; Wei LI ; Ming Feng JIANG ; Hong Rong ZHONG ; Wei WU ; Lyu Bo TIAN ; Guo CHEN ; Zhen Hua CHEN ; Can LUO ; Rong Mei YUAN ; Xing Yu ZHOU ; Jian Dong LI ; Xiao Rong YANG ; Ming PAN
Biomedical and Environmental Sciences 2025;38(3):279-289
OBJECTIVE:
This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF.
METHODS:
Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus.
RESULTS:
LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response.
CONCLUSION
The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans
;
China/epidemiology*
;
Genome, Viral
;
Lassa Fever/virology*
;
Lassa virus/classification*
;
Molecular Epidemiology
;
Phylogeny
6.Exploration of New Susceptible Genes associated with Non-Alcoholic Fatty Liver Disease among Children with Obesity Using Whole Exome Sequencing.
Xiong Feng PAN ; Cai Lian WEI ; Jia You LUO ; Jun Xia YAN ; Xiang XIAO ; Jie WANG ; Yan ZHONG ; Mi Yang LUO
Biomedical and Environmental Sciences 2025;38(6):727-739
OBJECTIVE:
This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity.
METHODS:
We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set).
RESULTS:
In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes.
CONCLUSION
In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans
;
Non-alcoholic Fatty Liver Disease/genetics*
;
Child
;
Male
;
Female
;
Genetic Predisposition to Disease
;
Case-Control Studies
;
Exome Sequencing
;
Adolescent
;
Polymorphism, Single Nucleotide
;
Obesity/complications*
;
Pediatric Obesity/complications*
;
China
7.Nodal Marginal Zone B-Cell Lymphoma of a Single Lymph Node in the Adult Neck:Report of One Case.
Pan-Pan LI ; Ya-Ping LUO ; Xiao-Hua SHI ; Yu CHEN ; Feng-Dan WANG ; Tong SU ; Zhu-Hua ZHANG ; Feng FENG ; Zheng-Yu JIN
Acta Academiae Medicinae Sinicae 2025;47(4):651-659
Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans
;
Lymphoma, B-Cell, Marginal Zone/pathology*
;
Lymph Nodes/pathology*
;
Neck/pathology*
;
Male
8.Correlation of corneal α angle and κ angle with lens tilt angle using swept-source optical biometry
Zi-Suo LI ; Zi-Han HE ; Jie ZHOU ; Jian-Feng ZHAO ; Xiao-Ling LUO ; Ya-Li FENG ; Chen YANG ; Yu GENG
Medical Journal of Chinese People's Liberation Army 2025;50(9):1083-1088
Objective To investigate the correlation of corneal α angle and κ angle with lens tilt in normal human eyes using a new swept-source optical biometer.Methods A cross-sectional study was conducted,involving 303 healthy eyes(148 right eyes and 155 left eyes)of patients who visited the First Affiliated Hospital of Kunming Medical University from June to August 2024.ZW-30 swept-source optical biometer was used to collect the lens tilt angle,κ angle(distance from the corneal light reflex to the pupil center),and α angle(distance from corneal light reflex to the corneal geometric center,which is the midpoint of the horizontal white to white(WTW)diameter).The degrees(°)and directions of κ angle and α angle were calculated by the ratio of the above measurements to the anterior chamber depth(ACD)respectively.Spearman correlation analysis and linear regression analysis were employed to evaluate the correlations between the magnitude and direction of corneal α angle,κ angle and lens tilt angle.Results The magnitude and direction of corneal α angle,κ angle,and lens tilt angle in the right eye were as follows respectively:(0.54±0.19)mm(7.81°±3.88°),194.43°±39.75°;(0.27±0.23)mm(4.72°±3.90°),181.07°±79.59°;5.52°±1.67°,188.21°±25.73°.For the left eye,the corresponding values were:(0.47±0.27)mm(8.12°±5.26°),336.04°±46.64°;(0.26±0.27)mm(4.45°±4.80°),322.86°±107.79°;5.50°±1.61°,340.65°±32.84°.Spearman's correlation analysis showed that the correlation coefficients between corneal α angle and lens tilt angle in the right eye were 0.609(distance correlation)and 0.625(angle correlation),while those for κ angle were 0.559(distance correlation)and 0.578(angle correlation).In the left eye,the correlation coefficients between corneal α angle and lens tilt angle were 0.545(distance correlation)and 0.552(angle correlation),and those for κ angle were 0.377(distance correlation)and 0.395(angle correlation).In addition,the correlation coefficient between the direction of corneal α angle and the direction of lens tilt angle in the right eye was 0.343,and that for κ angle direction was 0.284;in the left eye,the correlation coefficients were 0.216(α angle direction)and 0.198(κ angle direction),all with statistical significance(P<0.05).Univariate linear regression analysis showed that lens tilt was positively correlated with both corneal α angle and Kappa angle(P<0.05).Conclusions Corneal α angle and κ angle are highly correlated with lens tilt angle in both eyes,and the correlation of corneal α angle is stronger than that of κ angle in both left and right eyes.The correlation expressed by degree(°)is better than that by distance(mm).It is recommended to refer to the corneal α angle and κ angle expressed in degrees during preoperative evaluation.
9.Research progress on the role of macrophage polarization in drug-induced liver injury
Guo-Jing XING ; Li-Fei WANG ; Long-Long LUO ; Yuan DENG ; Zhen WANG ; Xiao-Feng ZHENG ; Xiao-Hui YU ; Jiu-Cong ZHANG
Medical Journal of Chinese People's Liberation Army 2025;50(11):1478-1484
Drug-induced liver injury(DILI)is a common adverse drug reaction in clinical practice,which can lead to acute liver failure and even death in severe cases.In recent years,with the continuous introduction of new drugs and the expansion of their usage,the incidence and mortality rates of DILI have shown an upward trend,posing significant challenges to public health and clinical treatment.Macrophages,as a crucial component of the innate immune system,exhibit high plasticity and heterogeneity.They can polarize into pro-inflammatory M1 type or anti-inflammatory M2 type in response to microenvironmental signals.Research has demonstrated that macrophage polarization plays a central regulatory role in the occurrence and progression of DILI by influencing various processes such as inflammatory responses,cell apoptosis,and tissue repair.This review focuses on elucidating the regulatory mechanisms and roles of macrophage polarization in DILI,providing a theoretical framework for developing precise immunotherapeutic strategies.
10.Effects of template and pore-forming agent method on the structure and drug delivery of porous maltodextrin
Zhe LI ; Xiao-sui LUO ; Wei-feng ZHU ; Qiong LI ; Yong-mei GUAN ; Zheng-ji JIN ; Li-hua CHEN ; Liang-shan MING
Acta Pharmaceutica Sinica 2024;59(8):2381-2395
This study using maltodextrin as raw material, 1%-5% polyvinylpyrrolidone K30 as template agent, 1%-5% ammonium bicarbonate as pore-forming agent, curcumin and ibuprofen as model drugs. Porous maltodextrin was prepared by template and pore-forming agent methods, respectively. The structure and drug delivery behavior of porous maltodextrin prepared by different technologies were comprehensively characterized. The results showed that the porous maltodextrin prepared by pore-forming agent method had larger specific surface area (6.449 4 m2·g-1) and pore size (32.804 2 nm), which was significantly better than that by template agent method (3.670 2 m2·g-1, 15.278 5 nm). The adsorption kinetics between porous maltodextrin prepared by pore-forming agent method and curcumin were suitable for quasi-first order adsorption kinetic model, and that between porous maltodextrin and ibuprofen were suitable for quasi-second order adsorption kinetic model. While the adsorption kinetics between porous maltodextrin prepared by template agent method and two model drugs were both suitable for the quasi-first order adsorption kinetic model. In addition, the dissolution behavior analysis showed that the porous maltodextrin prepared by the two technologies can significantly improve the dissolution behavior of insoluble drugs, and the drug release was both carried out by diffusion mechanism, which suitable for the Peppas kinetic release model, but the porous maltodextrin prepared by template agent method had a faster release rate. The change of nozzle diameter had no significant effect on the adsorption process and drug release behavior of porous maltodextrin. In conclusion, the porous maltodextrins prepared by two different technologies were both beneficial to the delivery of insoluble drugs, and the template agent method was the best for delivery of insoluble drugs. This study can provide theoretical basis for the preparation of porous particles, promote the application of porous particles in insoluble drugs, and improve the bioavailability of insoluble drugs.

Result Analysis
Print
Save
E-mail