The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

OBJECTIVE: To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain. METHODS: A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC. RESULTS: The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml^-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r²=0.045, P<0.01). CONCLUSION Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans ; Female ; Male ; Middle Aged ; Osteoarthritis, Knee/metabolism* ; Aged ; Adult ; Bone and Bones/metabolism* ; Pain/etiology* ; Biomarkers/metabolism*

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

OBJECTIVE: This study aimed to evaluate the association between susceptibility genes and non-alcoholic fatty liver disease (NAFLD) in children with obesity. METHODS: We conducted a two-step case-control study. Ninety-three participants were subjected to whole-exome sequencing (exploratory set). Differential genes identified in the small sample were validated in 1,022 participants using multiplex polymerase chain reaction and high-throughput sequencing (validation set). RESULTS: In the exploratory set, 14 genes from the NAFLD-associated pathways were identified. In the validation set, after adjusting for sex, age, and body mass index, ECI2 rs2326408 (dominant model: OR = 1.33, 95% CI: 1.02-1.72; additive model: OR = 1.22, 95% CI: 1.01-1.47), C6orf201 rs659305 (dominant model: OR = 1.30, 95% CI: 1.01-1.69; additive model: OR = 1.21, 95% CI: 1.00-1.45), CALML5 rs10904516 (pre-ad dominant model: OR = 1.36, 95% CI: 1.01-1.83; adjusted dominant model: OR = 1.40, 95% CI: 1.03-1.91; and pre-ad additive model: OR = 1.26, 95% CI: 1.04-1.66) polymorphisms were significantly associated with NAFLD in children with obesity ( P < 0.05). Interaction analysis revealed that the gene-gene interaction model of CALML5 rs10904516, COX11 rs17209882, and SCD5 rs3733228 was optional ( P < 0.05), demonstrating a negative interaction between the three genes. CONCLUSION In the Chinese population, the CALML5 rs10904516, C6orf201 rs659305, and ECI2 rs2326408 variants could be genetic markers for NAFLD susceptibility.
Humans ; Non-alcoholic Fatty Liver Disease/genetics* ; Child ; Male ; Female ; Genetic Predisposition to Disease ; Case-Control Studies ; Exome Sequencing ; Adolescent ; Polymorphism, Single Nucleotide ; Obesity/complications* ; Pediatric Obesity/complications* ; China

Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans ; Lymphoma, B-Cell, Marginal Zone/pathology* ; Lymph Nodes/pathology* ; Neck/pathology* ; Male

The statement of"qi transformation leading to the removal of pathogenic dampness"was recorded in Wen Bing Tiao Bian(Analysis on Epidemic Febrile Diseases)written by the Qing Dynasty physician WU Ju-Tong.Dampness in the triple energizer is caused by the dysfunction of qi transformation,and the treatment of dampness must be based on the activation of qi movement and focused on the promotion of qi movement and the restoration of the qi transformation in the triple energizer.For the treatment of dampness attack in the upper energizer,therapies of dispersing lung to smooth qi and resolving dampness to relieve the obstruction are recommended.For the treatment of dampness obstruction in the middle energizer,therapy of activating spleen qi by strengthening spleen and moving qi is stressed for helping the removal of dampness and for the eradication of the source of dampness.For the treatment of dampness stagnation in the lower energizer,therapy of draining dampness with sweet-light medicines and activating yang can be used according to the illness status.The three methods of treating dampness,namely dispersing the upper energizer,activating the middle energizer and draining the lower energizer,all embody the mechanism of"qi transformation leading to the removal of pathogenic dampness",and the therapies of dispersing lung with light medicines,inducing perspiration by opening striated layer,eliminating dampness with aromatics and draining dampness with sweet-light medicines should be used in accordance with the syndromes.The elucidation of the academic thoughts of"qi transformation leading to the removal of pathogenic dampness"can provide theoretical reference for the fundamental research of dampness syndrome and clinical application of therapies for resolving dampness in Chinese medicine.

AIM To investigate the variation rules of main secondary metabolites in Hedysari Radix before and after rubbing strip.METHODS UPLC-MS/MS was adopted in the content determination of formononetin,ononin,calycosin,calycosin-7-glucoside,medicarpin,genistein,luteolin,liquiritigenin,isoliquiritigenin,vanillic acid,ferulic acid,γ-aminobutyric acid,adenosine and betaine,after which cluster analysis,principal component analysis and orthogonal partial least squares discriminant analysis were used for chemical pattern recognition to explore differential components.RESULTS After rubbing strip,formononetin,calycosin,liquiritigenin and γ-aminobutynic acid demonstrated increased contents,along with decreased contents of ononin,calycosin-7-glucoside and vanillic acid.The samples with and without rubbing strip were clustered into two types,calycosin-7-glucoside,formononetin,γ-aminobutynic acid,vanillic acid,calycosin-7-glucoside and formononetin were differential components.CONCLUSION This experiment clarifies the differences of chemical constituents in Hedysari Radix before and after rubbing strip,which can provide a reference for the research on rubbing strip mechanism of other medicinal materials.

Objective:To investigate the safety and therapeutic effect of split liver transplantation (SLT) in clinical application.Methods:This is a retrospective case-series study. The clinical data of 203 consecutive SLT, 79 living donor liver transplantation (LDLT) and 1 298 whole liver transplantation (WLT) performed at the Third Affiliated Hospital of Sun Yat-sen University from July 2014 to July 2023 were retrospectively analyzed. Two hundred and three SLT liver grafts were obtained from 109 donors. One hundred and twenty-seven grafts were generated by in vitro splitting and 76 grafts were generated by in vivo splitting. There were 90 adult recipients and 113 pediatric recipients. According to time, SLT patients were divided into two groups: the early SLT group (40 cases, from July 2014 to December 2017) and the mature SLT technology group (163 cases, from January 2018 to July 2023). The survival of each group was analyzed and the main factors affecting the survival rate of SLT were analyzed. The Kaplan-Meier method and Log-rank test were used for survival analysis.Results:The cumulative survival rates at 1-, 3-, and 5-year were 74.58%, 71.47%, and 71.47% in the early SLT group, and 88.03%, 87.23%, and 87.23% in the mature SLT group, respectively. Survival rates in the mature SLT group were significantly higher than those in the early SLT group ( χ2=5.560, P=0.018). The cumulative survival rates at 1-, 3- and 5-year were 93.41%, 93.41%, 89.95% in the LDLT group and 87.38%, 81.98%, 77.04% in the WLT group, respectively. There was no significant difference among the mature SLT group, the LDLT group and the WLT group ( χ2=4.016, P=0.134). Abdominal hemorrhage, infection, primary liver graft nonfunction,and portal vein thrombosis were the main causes of early postoperative death. Conclusion:SLT can achieve results comparable to those of WLT and LDLT in mature technology liver transplant centers, but it needs to go through a certain time learning curve.