1.Dingchan Granule (定颤颗粒) for Paroxysmal Atrial Fibrillation with Syndrome of Qi Stagnation and Blood Stasis:A Randomized,Double-Blinded,Placebo-Controlled Clinical Trial
Xiaozhen CHENG ; Xingjuan CHEN ; Weina LI ; Lu XIAO ; Yunhan WANG ; Yun XU ; Yueyue NIU ; Ling FENG
Journal of Traditional Chinese Medicine 2025;66(12):1233-1240
ObjectiveTo observe the clinical effectiveness and safety of Dingchan Granule (定颤颗粒) for paroxysmal atrial fibrillation with syndrome of qi stagnation and blood stasis. MethodsUsing a randomised, double-blind, placebo controlled study method, 90 patients with paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome were divided into 45 cases each in the treatment group and the control group. Both groups were given conventional western medicine treatment, and the treatment group was additionally treated with Dingchan Granule, while the control group was treated with Dingchan Granule placebo, both of which were taken orally for 8 g each time twice a day. Both groups were treated for 8 weeks. We compared the clinical effectiveness, the improvement of traditional Chinese medicine (TCM) symptoms and the recovery rate of atrial fibrillation between the two groups. We compared the number and duration of atrial fibrillation episodes, TCM symptoms score, atrial fibrillation symptom classification, 24-hour average ventricular rate, Pittsburgh Sleep Quality Index (PSQI), anxiety index, depression index before and after treatment, and evaluated the safety of the two groups. ResultsThe total clinical effectiveness rate in the treatment group was 82.22% (37/45), which was better than 60.00% (27/45) in the control group (P<0.05). The total effective rate of TCM syndrome effectiveness in the treatment group was 88.89% (40/45), which was better than 66.67% (30/45) in the control group (P<0.05); and the rate of atrial fibrillation regression in the treatment group was 26.67% (12/45), better than 6.67% (3/45) in the control group (P<0.05). The number and duration of atrial fibrillation episodes in both groups were significantly decreased (P<0.01), and the number and duration of atrial fibrillation episodes in the treatment group were lower than those in the control group (P<0.01). The TCM syndrome scores of both groups after treatment were significantly lower than before treatment (P<0.01), and the scores of the treatment group was lower than those of the control group (P<0.05). The severity of atrial fibrillation symptoms and the grading of atrial fibrillation symptoms in both groups after treatment were improved (P<0.01), and the degree of symptom improvement in the treatment group was better than that in the control group (P<0.01). The 24-hour average ventricular rate of both groups after treatment was significantly lower (P<0.01). The PSQI, anxiety index and depression index of the treatment group were all lower than before treatment (P<0.01), while the PSQI and anxiety index of the control group were both lower than before treatment (P<0.01 or P<0.05), the PSQI, anxiety index and depression index of the treatment group being lower than those of the control group (P<0.05 or P<0.01). No adverse events occurred in both groups, and no abnormalities were observed in blood, urine, stool routine, liver and kidney function, and coagulation function indexes. ConclusionDingchan Granule for paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome can alleviate clinical symptom, improve TCM symptom scores, increase atrial fibrillation recovery rate, stabilise the average ventricular rate, and significantly improve the quality of sleep, alleviate the anxiety and depression, with a good safety profile.
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Epidemiological characteristics of respiratory syncytial virus infection in children in Hebei Province.
Xuan WANG ; Su-Kun LU ; Jian-Hua LIU ; Jin-Feng SHUAI ; Kun-Ling HUANG ; Bo NIU ; Li-Jie CAO ; Xiao-Wei CUI
Chinese Journal of Contemporary Pediatrics 2025;27(10):1199-1204
OBJECTIVES:
To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province.
METHODS:
Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics.
RESULTS:
The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection.
CONCLUSIONS
The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans
;
Respiratory Syncytial Virus Infections/epidemiology*
;
Female
;
Male
;
Infant
;
Child, Preschool
;
Seasons
;
China/epidemiology*
;
Infant, Newborn
;
Community-Acquired Infections/epidemiology*
;
Child
4.Research progress in chemical constituents and pharmacological activities of Abelmoschi Corolla and prediction of its quality markers.
Shi-Han GUAN ; Chang LIU ; Xiao-Tong YAN ; Jin-Wei HAN ; Feng-Ting YIN ; Hui SUN ; Guang-Li YAN ; Ling KONG ; Ying HAN ; Xi-Jun WANG
China Journal of Chinese Materia Medica 2025;50(4):908-921
Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry*
;
Drugs, Chinese Herbal/pharmacology*
;
Flowers/chemistry*
;
Humans
;
Animals
;
Quality Control
;
Flavonoids/chemistry*
5.Effects of total extract of Anthriscus sylvestris on immune inflammation and thrombosis in rats with pulmonary arterial hypertension based on TGF-β1/Smad3 signaling pathway.
Ya-Juan ZHENG ; Pei-Pei YUAN ; Zhen-Kai ZHANG ; Yan-Ling LIU ; Sai-Fei LI ; Yuan RUAN ; Yi CHEN ; Yang FU ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(9):2472-2483
This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals
;
Male
;
Smad3 Protein/metabolism*
;
Transforming Growth Factor beta1/metabolism*
;
Rats, Sprague-Dawley
;
Rats
;
Signal Transduction/drug effects*
;
Hypertension, Pulmonary/genetics*
;
Thrombosis/immunology*
;
Drugs, Chinese Herbal/administration & dosage*
;
Humans
;
Apoptosis/drug effects*
6.Expert consensus on evaluation index system construction for new traditional Chinese medicine(TCM) from TCM clinical practice in medical institutions.
Li LIU ; Lei ZHANG ; Wei-An YUAN ; Zhong-Qi YANG ; Jun-Hua ZHANG ; Bao-He WANG ; Si-Yuan HU ; Zu-Guang YE ; Ling HAN ; Yue-Hua ZHOU ; Zi-Feng YANG ; Rui GAO ; Ming YANG ; Ting WANG ; Jie-Lai XIA ; Shi-Shan YU ; Xiao-Hui FAN ; Hua HUA ; Jia HE ; Yin LU ; Zhong WANG ; Jin-Hui DOU ; Geng LI ; Yu DONG ; Hao YU ; Li-Ping QU ; Jian-Yuan TANG
China Journal of Chinese Materia Medica 2025;50(12):3474-3482
Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards*
;
Humans
;
Consensus
;
Drugs, Chinese Herbal/therapeutic use*
;
Surveys and Questionnaires
7.Mechanistic of Yueju Wan volatile oil in inhibiting inflammation for antidepressant effects by regulating AGE/PI3K/Akt pathway.
Tan-Lu CHU ; Ze-Jun GUO ; Wei ZHANG ; Ling-Feng WANG ; Shu-Rui LYU ; Wan-Yu GUO ; Xiao-Ming ZHONG ; Feng-Mei QIU ; Zhen HUANG
China Journal of Chinese Materia Medica 2025;50(11):3147-3158
The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals
;
Antidepressive Agents/chemistry*
;
Mice
;
Proto-Oncogene Proteins c-akt/immunology*
;
Phosphatidylinositol 3-Kinases/immunology*
;
Oils, Volatile/chemistry*
;
Male
;
Drugs, Chinese Herbal/chemistry*
;
Signal Transduction/drug effects*
;
Depression/metabolism*
;
Glycation End Products, Advanced/immunology*
;
Humans
8.Biomechanical finite element analysis of American Chiropractic intervention on the third lumbar transverse process syndrome based on imaging.
Ling-Feng ZHU ; Hai-Jie YU ; Hai-Fen YING ; Ben-Bao CHEN ; Xiao-Chun XIONG ; Li-Jiang LYU
China Journal of Orthopaedics and Traumatology 2025;38(4):403-410
OBJECTIVE:
To explore the displacement and pressure distribution of American Chiropractic in a model of third lumbar syndrome based on finite element analysis.
METHODS:
On March 2021, CT and MRI images of a 23-year-old male patient with right third lumbar syndrome were selected. A 3D stl model was established using Mimics and CATIA, and the data was imported into Hypermesh, Abaqus & ANSYS. The elastic modulus and Poisson's ratio of the affected side material were adjusted to establish its finite element model. Based on the comparison of the operating positions and routines of the American Chiropractic and the lumbar spine oblique pull method, but with differences in the focus and direction of force, the experimental group simulated the American Chiropractic with the healthy side (left side) lying position of the model. The upper endplate of L3 and the lower part below L3 twisted accordingly with the body position, we applied a vertical forward thrust of 246 N to the plane formed by the L4, L5 spinous processes and L4 upper articular processes;The control group simulates the oblique pull method of the lumbar spine, requiring the model to lie on the healthy side (left side), fix the upper endplate of L4, and perform a horizontal rotation along the longitudinal axis of L3 vertebral body. At this time, the contact force in the upward direction is also set to 246 N. Compare the displacement and stress differences between the L1-L5 intervertebral bodies, intervertebral discs, articular processes, and transverse process muscles in two intervention models.
RESULTS:
① Under safe load conditions, a test force of 246 N was applied to the model, and the maximum vertebral displacement occurred on the right side of the L3 vertebral body (1.197 mm) after manual intervention in the control group. The vertebral displacement between L1-L5 induced by manual intervention in the experimental group was smaller than that of the control group's manual intervention (P<0.05). ② The maximum vertebral body stress occurred on the right side of the L3 vertebral body after manual intervention in the control group (98.425 MPa). The stress on each vertebral body formed by the experimental group's manual intervention was lower than that of the control group's manual intervention (P<0.05). ③The maximum intervertebral disc stress occurred on the right side of the L2,3 intervertebral disc (6.282 MPa) after manual intervention in the control group. ④ The maximum joint process stress occurred on the right side of the L4 upper joint process after manual intervention in the experimental group (1.587 MPa). The joint process stress on the left side below L1 and the left side above and below L2 induced by manual intervention in the experimental group was lower than that of the control group (P<0.05). ⑤The maximum stress on the intertransverse process muscle was observed at the right lateral L3 process end (31.960 MPa) of L3,4 in the control group after manual intervention. The stress on the L2,3 and L4,5 segments of the intertransverse process muscle induced by manual intervention in the experimental group was lower than that of the control group's manual intervention (P<0.05).
CONCLUSION
The mechanical feedback of the L1-L5 vertebral body, the lower left side of the articular process L1, the upper and lower left side of the articular process L2, and the L2,3 and L4,5 segments of the transverse process muscle in the model indicates that performing American Chiropractic for the treatment of third lumbar transverse process syndrome can accurately hit the target pain point and allow the patient's tissue to form a low stress and low tension state after manual operation, thereby reducing the possibility of tissue damage caused by hypertonia after intervertebral joint movement, making it relatively safe. The application of American Chiropractic will be a new supplement to the traditional treatment plan for third lumbar transverse process syndrome.
Humans
;
Finite Element Analysis
;
Male
;
Lumbar Vertebrae/physiopathology*
;
Biomechanical Phenomena
;
Young Adult
;
Manipulation, Chiropractic
;
Adult
;
Tomography, X-Ray Computed
;
Magnetic Resonance Imaging
9.Analysis of clinical characteristics and influencing factors of patients with postmenopausal osteoporosis combined with dyslipidemia.
Rong XIE ; Li-Guo ZHU ; Zi-Kai JIN ; Tian-Xiao FENG ; Ke ZHAO ; Da WANG ; Ling-Hui LI ; Xu WEI
China Journal of Orthopaedics and Traumatology 2025;38(5):487-493
OBJECTIVE:
To explore the co-morbid influencing factors of postmenopausal osteoporosis(PMOP) and dyslipidemia, and to provide evidence-based basis for clinical co-morbidity management.
METHODS:
Based on the 2017 to 2018 Beijing community cross-sectional survey data, PMOP patients were included and divided into the dyslipidemia group and the uncomplicated dyslipidemia group according to whether they were comorbid with dyslipidemia. Demographic characteristics, living habits and disease history were collected through questionnaires, and bone mineral density and bone metabolism biomarkers (osteocalcin, blood calcium, serum typeⅠprocollagen N-terminal prepeptide, etc.) were detected on site. Co-morbidity risk factors were analyzed using binary logistic regression.
RESULTS:
Three hundred and twenty patients with PMOP were included, including the comorbid group (75 patients) and the uncomplicated group (245 patients). The results showed that history of cardiovascular disease [OR=1.801, 95%CI(1.003, 3.236), P=0.049], history of cerebrovascular disease [OR=2.923, 95%CI(1.460, 5.854), P=0.002], frying and cooking methods[OR=5.388, 95%CI(1.632, 17.793), P=0.006], OST results[OR=0.910, 95%CI(0.843, 0.983), P=0.016], and blood Ca results [OR=60.249, 95%CI(1.862, 1 949.926), P=0.021] were the influencing factors of PMOP complicated with dyslipidemia.
CONCLUSION
Focus should be placed on the influencing factors of PMOP and dyslipidemia co-morbidities, with emphasis on multidimensional assessment, combining lifestyle interventions with bone metabolism marker monitoring to optimize co-morbidity management.
Humans
;
Dyslipidemias/epidemiology*
;
Female
;
Middle Aged
;
Osteoporosis, Postmenopausal/metabolism*
;
Aged
;
Cross-Sectional Studies
;
Risk Factors
;
Bone Density
10.Erratum: Author Correction: Targeting of AUF1 to vascular endothelial cells as a novel anti-aging therapy.
Jian HE ; Ya-Feng JIANG ; Liu LIANG ; Du-Jin WANG ; Wen-Xin WEI ; Pan-Pan JI ; Yao-Chan HUANG ; Hui SONG ; Xiao-Ling LU ; Yong-Xiang ZHAO
Journal of Geriatric Cardiology 2025;22(9):834-834
[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

Result Analysis
Print
Save
E-mail