Objective To investigate the safety, economic benefits and psychological effects of day breast conserving surgery for breast cancer. Methods The demographic data and clinical data of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgeries in West China Hospital of Sichuan University from March 2020 to June 2021 were retrospectively collected; the demographic data, clinical data, medical and related transportation costs, and preoperative and postoperative BREAST-Q scores of breast cancer patients undergoing day (day surgery group) and ward (ward surgery group) breast conserving surgery in West China Hospital of Sichuan University from June 2021 to June 2022 were prospectively collected. The safety, economic benefit, and psychological satisfaction of day surgery was analyzed. Results A total of 42 women with breast cancer were included in the retrospective study and 39 women with breast cancer were included in the prospective study. In both prospective and retrospective studies, the mean age of patients in both groups were <50 years. There were only statistical differences between the two groups in the aspects of hypertension (P=0.022), neoadjuvant chemotherapy (P=0.037) and postoperative pathological estrogen receptor (P=0.033) in the prospective study. In postoperative complications, there were no statistical differences in the surgical-related complications or anesthesia-related complications between the two groups in either the prospective study or the retrospective study (P>0.05). In terms of the overall cost, we found that the day surgery group was more economical than the ward surgery group in the prospective study (P=0.002). There were no statistical differences in postoperative psychosocical well-being, sexual well-being, satisfaction with breasts or chest condition between the two groups (P>0.05). Conclusion It is safe and reliable to carry out breast conserving surgery in day surgery center under strict management standards, which can save medical costs and will not cause great psychological burden to patients.

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the early clinical efficacy and safety of trans-catheter aortic valve replacement (TAVR) for patients with severe pure native aortic regurgitation (PNAR) who are not suitable for conventional surgical aortic valve replace-ment. METHODS: A retrospective analysis was conducted on 48 patients with PNAR who underwent TAVR at the Department of Cardiac Surgery, the First Affiliated Hospital of Sun Yat-sen University between March 2019 and February 2025. These included 25 cases with transfemoral approach (TF-TAVR group) and 23 cases with transapical approach (TA-TAVR group). Efficacy and safety were assessed by analyzing baseline characteristics, all-cause mortality, and procedure-related complications. RESULTS: Compared with the TA-TAVR group, the TF-TAVR group exhibited significantly smaller aortic annulus circumference and diameter, left ventricular outflow tract circumference and diameter, diameters of the left, right, and non-coronary sinuses, and sinotubular junction (STJ) diameter, along with a shorter distance from the STJ to the aortic annular plane ring plane, a smaller annulus angle (all P<0.05). Additionally, the TF-TAVR group showed a deeper prosthesis implantation depth relative to the aortic annular plane (P<0.01). The overall technical success rate was 91.67%, and the device success rate was 83.33%. Post-TAVR, both groups demonstrated significant improvement in left ventricular end-diastolic diameter (both P<0.05), while only the TA-TAVR group showed significant reduction in left ventricular end-systolic diameter (P<0.05). For primary outcomes, in-hospital mortality occurred in 2 patients (4.17%). No additional deaths were reported at 60 or 90 d after surgery. During 90-180 d after surgery, one patient in the TF-TAVR group died of sudden cardiac death, and one in the TA-TAVR group died of gastroin-testinal bleeding. During 180 d-1 year after surgery, one patient in the TF-TAVR group died of low cardiac output syndrome. No statistically significant differences were observed in 1-year Kaplan-Meier survival curves between the two groups (P>0.05). No conduction block events occurred in TA-TAVR group during hospitalization or 1-year follow-up, while high-grade atrioventricular block, left bundle branch block, permanent pacemaker implantation occurred in TF-TAVR group during hospitalization (12.00%, 4.00%, and 12.00%, respectively). CONCLUSIONS TAVR demonstrates high feasibility and acceptable safety for severe PNAR patients who are not suitable for conventional SAVR. Both TF-TAVR and TA-TAVR show comparable early postoperative efficacy and safety profiles.
Humans ; Transcatheter Aortic Valve Replacement/adverse effects* ; Aortic Valve Insufficiency/surgery* ; Retrospective Studies ; Male ; Female ; Aged ; Treatment Outcome ; Aortic Valve/surgery* ; Aged, 80 and over ; Heart Valve Prosthesis

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

Objective: This study aimed to explore the correlation between balance function and core muscle activation in patients with adolescent idiopathic scoliosis (AIS), compared to healthy individuals. Methods: A total of 24 AIS patients and 25 healthy controls were recruited. The limits of stability (LOS) test were conducted to assess balance function, while surface electromyography was used to measure the activity of core muscles, including the internal oblique, external oblique, and multifidus. Diaphragm thickness was measured using ultrasound during different postural tasks. Center of pressure (COP) displacement and trunk inclination distance were also recorded during the LOS test. Results: AIS patients showed significantly greater activation of superficial core muscles, such as the internal and external oblique muscles, compared to the control group (p < 0.05). Diaphragm activation was lower in AIS patients during balance tasks (p < 0.01). Although no significant difference was observed in COP displacement between the groups, trunk inclination was significantly greater in the AIS group during certain tasks (p < 0.05). Conclusion These findings suggest distinct postural control patterns in AIS patients, highlighting the importance of targeted interventions to improve balance and core muscle function in this population.

Background With the progression of industrialization, an increasing number of emerging contaminants are entering aquatic environments, posing significant threats to the safety of drinking water. Therefore, establishing a system for identifying unknown hazardous factors and implementing safety warning mechanisms for drinking water is of paramount importance. Among these efforts, non-target screening plays a critical role, but its effectiveness is largely constrained by the scope of coverage of sample pre-treatment methods. Objective To integrate modern chromatography/mass spectrometry techniques with advanced data mining methods to develop a non-discriminatory sample pre-treatment method for comprehensive enrichment of unknown contaminants in drinking water, laying a technical foundation for the discovery and identification of unknown organic hazardous factors in drinking water. Methods A non-discriminatory pre-treatment method based on supramolecular and solid-phase extraction was developed. The final target compounds including 333 pesticides, 194 pharmaceuticals and personal care products (PPCPs), and 59 per- and polyfluoroalkyl substances (PFASs) were used for optimizing the pre-treatment method, confirming its coverage. The impacts of different eluents on the absolute recovery rates of target compounds were compared to select the conditions with the highest recovery for sample pre-treatment. The effects of different supramolecular solvents and salt concentrations on target compound recovery were also evaluated to determine the most suitable solvent and salt concentration. Results The solid-phase extraction elution solvents, supramolecular extraction solvents, and salt concentrations were optimized based on the target compound recovery rates. The optimal recovery conditions were achieved using 2 mL methanol, 2 mL methanol (containing 1% formic acid), 2 mL ethyl acetate, 2 mL dichloromethane, hexanediol supramolecular solvent, and 426 mg salt. The detection method developed based on these conditions showed a good linear relationship for all target compounds in the range of 0.1-100.0 ng·mL⁻¹, with R² > 0.99. The method’s limit of detection ranged from 0.01 ng⁻¹ to 0.95 ng⁻¹, and 95% of target compounds were recovered in the range of 20%-120%, with relative standard deviation (RSD) less than 30%, indicating good precision. Conclusion The combined pre-treatment method of solid-phase extraction and supramolecular solvent extraction can effectively enrich contaminants in drinking water across low, medium, and high polarities, enabling broad-spectrum enrichment of diverse trace contaminants in drinking water. It provides technical support for broad-spectrum, high-throughput screening and identification of organic pollutants in drinking water, and also serves as a reference for establishing urban drinking water public safety warning systems.

This article systematically reviews the characteristics and trends of the writing, editing, publication and promotion of physiology textbooks in China from the late 19th century to the present, focusing on the introduction, development and innovation of Chinese physiology textbooks. The development of physiology textbooks in China is divided into four main stages: the introduction and initial development of physiology textbooks from the late 19th century to 1925; the localization and diversification of textbooks from 1926 to 1949, after the establishment of the Chinese Physiological Society; the exploratory phase of textbook construction after the founding of the People's Republic of China from 1949 to 1976; the formation and innovation of the textbook development process from 1977 to the present, following the restoration of the college entrance examination. For each phase, the article not only records the historical development of physiology textbooks, but also analyzes the evolution of their content, writing styles and the interaction with the social and political contexts. The article summarizes the characteristics and experiences of all these four phases. Special attention is given to the comprehensive statistical analysis of physiology textbooks published since the restoration of the college entrance examination and Economic Reform and Opening-up in 1977, revealing the changes in the number, publication trends and academic features of textbooks during this period. Finally, the article presets the future development of physiology textbooks in China, proposing that textbook writing should integrate aspects such as ideological and political education, medical humanities, basic and clinical medicine, health education, scientific research and international exchange and collaboration. The article also advocates for the application of new technologies and methods, such as artificial intelligence, virtual teaching models and knowledge graphs, to support "personalized learning". This research provides a systematic reference for the study of the history of medical education and offers theoretical support for the future innovation of physiology textbook in China.
Humans ; China ; History, 19th Century ; History, 20th Century ; History, 21st Century ; Physiology/education* ; Textbooks as Topic/history*