1.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
2.Research progress on quality control methods for monitoring illicit drugs use in wastewater
Yue XIAO ; Shuai YUAN ; Ruxin LUO ; Ruiqin ZHU ; Bin DI ; Ping XIANG
Journal of China Pharmaceutical University 2025;56(2):139-147
The use of wastewater analysis, or wastewater-based epidemiology, to assess and monitor the situation of drug abuse is now widely used at home and abroad. However, there is currently a lack of effective evaluation methods and effective ways of comparison, supervision and standardization, which is not conducive to the analysis and comparisons of data in different countries and regions. Quality control techniques can control the laboratory's analytical errors, safeguard the consistency and comparability of identification conclusions, and promote the further improvement of the level and capacity of urban drug governance, thus playing significant roles. This paper provides an overview of sample collection, sample preservation and transportation, laboratory analysis, back-calculation of drug use and external laboratory quality control in the process of wastewater analysis, with a view to exploring more comprehensive scientific and objective methods and approaches suitable for examining and evaluating qualitative and quantitative analysis of drugs in wastewater among laboratories.
3.Inheritance, excavation, and modern research overview of processing methods of traditional Chinese medicine decoctions.
Xiao-Xia LIU ; Ping LUO ; Ling-Yun ZHONG ; Fang WANG ; Ming YANG
China Journal of Chinese Materia Medica 2025;50(13):3596-3631
"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification*
;
Humans
;
Medicine, Chinese Traditional/methods*
4.Intramedullary administration of tranexamic acid reduces bleeding in proximal femoral nail antirotation surgery for intertrochanteric fractures in elderly individuals: A randomized controlled trial.
Xiang-Ping LUO ; Jian PENG ; Ling ZHOU ; Hao LIAO ; Xiao-Chun JIANG ; Xiong TANG ; Dun TANG ; Chao LIU ; Jian-Hui LIU
Chinese Journal of Traumatology 2025;28(3):201-207
PURPOSE:
Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals.
METHODS:
A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test.
RESULTS:
The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups.
CONCLUSION
We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans
;
Tranexamic Acid/administration & dosage*
;
Hip Fractures/surgery*
;
Male
;
Aged
;
Female
;
Fracture Fixation, Intramedullary/adverse effects*
;
Blood Loss, Surgical/prevention & control*
;
Antifibrinolytic Agents/administration & dosage*
;
Aged, 80 and over
;
Bone Nails
;
Middle Aged
;
Blood Transfusion/statistics & numerical data*
5.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
6.Application value of thromboelastography in assessing coagulation function in children with severe hemophilia A after emicizumab therapy: a single-center study.
Dong PENG ; Ying WANG ; Gui-Chi ZHOU ; Qian LI ; Mei-Zhu LUO ; Li-Ping LUO ; Ya-Xian KUANG ; Xiao-Ying FU
Chinese Journal of Contemporary Pediatrics 2025;27(3):293-299
OBJECTIVES:
To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy.
METHODS:
A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG.
RESULTS:
After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05).
CONCLUSIONS
The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.
Humans
;
Thrombelastography
;
Hemophilia A/physiopathology*
;
Male
;
Child
;
Antibodies, Bispecific/therapeutic use*
;
Antibodies, Monoclonal, Humanized/therapeutic use*
;
Blood Coagulation/drug effects*
;
Child, Preschool
;
Retrospective Studies
;
Female
;
Partial Thromboplastin Time
;
Adolescent
;
Infant
7.Interpretation of "Physical therapy management of congenital muscular torticollis: a 2024 evidence-based clinical practice guideline from the American Physical Therapy Association Academy of Pediatric Physical Therapy".
Wan-Qiu TANG ; Xiao-Hong LUO ; Yu-Ping ZHANG
Chinese Journal of Contemporary Pediatrics 2025;27(9):1045-1049
Early screening, diagnosis, and intervention for congenital muscular torticollis (CMT) in infants are crucial for improving clinical outcomes. However, in China, limited awareness of CMT among child healthcare institutions and caregivers, as well as inconsistent professional standards among rehabilitation personnel, pose significant challenges to the effective diagnosis and management of CMT. The "Physical therapy management of congenital muscular torticollis: a 2024 evidence-based clinical practice guideline from the American Physical Therapy Association Academy of Pediatric Physical Therapy" includes 17 action statements, primarily addressing the prevention, identification, assessment, and intervention of CMT. This guideline is expected to facilitate early detection of CMT in infants, enhance the treatment capabilities of physical therapists, and improve clinical outcomes. This article provides an interpretation of the guideline in the context of the current status of CMT diagnosis and management in China, aiming to offer a reference for improving the ability of primary child healthcare providers and physical therapists to recognize and manage CMTropriately.
Humans
;
Torticollis/diagnosis*
;
Physical Therapy Modalities
;
Practice Guidelines as Topic
;
Infant
;
United States
8.Integrated evidence chain-based effectiveness evaluation of traditional Chinese medicines (Eff-iEC): A demonstration study.
Ye LUO ; Xu ZHAO ; Ruilin WANG ; Xiaoyan ZHAN ; Tianyi ZHANG ; Tingting HE ; Jing JING ; Jianyu LI ; Fengyi LI ; Ping ZHANG ; Junling CAO ; Jinfa TANG ; Zhijie MA ; Tingming SHEN ; Shuanglin QIN ; Ming YANG ; Jun ZHAO ; Zhaofang BAI ; Jiabo WANG ; Aiguo DAI ; Xiangmei CHEN ; Xiaohe XIAO
Acta Pharmaceutica Sinica B 2025;15(2):909-918
Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.
9.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
10.Nodal Marginal Zone B-Cell Lymphoma of a Single Lymph Node in the Adult Neck:Report of One Case.
Pan-Pan LI ; Ya-Ping LUO ; Xiao-Hua SHI ; Yu CHEN ; Feng-Dan WANG ; Tong SU ; Zhu-Hua ZHANG ; Feng FENG ; Zheng-Yu JIN
Acta Academiae Medicinae Sinicae 2025;47(4):651-659
Nodal marginal zone B-cell lymphoma(NMZL),the least common subtype of marginal zone lymphoma,represents a low-grade malignancy arising from the marginal zone of lymph node follicles,composed of small B-cells with an inert non-Hodgkin lymphoma nature.It accounts for 1.5% to 1.8% of all non-Hodgkin lymphomas and 10% of all marginal zone lymphomas.The low incidence and lack of typical clinical and pathological features pose a challenge to the diagnosis and clinical management of NMZL.In this article,we reported the diagnosis and treatment of a case of NMZL located in the parapharyngeal space of the left neck and reviewed the relevant literature from both domestic and international sources.We summarized the clinical manifestations,histopathological features,immunohistochemical characteristics,imaging features,diagnosis and treatment modalities,and prognosis of NMZL.
Humans
;
Lymphoma, B-Cell, Marginal Zone/pathology*
;
Lymph Nodes/pathology*
;
Neck/pathology*
;
Male

Result Analysis
Print
Save
E-mail