Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

The use of wastewater analysis, or wastewater-based epidemiology, to assess and monitor the situation of drug abuse is now widely used at home and abroad. However, there is currently a lack of effective evaluation methods and effective ways of comparison, supervision and standardization, which is not conducive to the analysis and comparisons of data in different countries and regions. Quality control techniques can control the laboratory's analytical errors, safeguard the consistency and comparability of identification conclusions, and promote the further improvement of the level and capacity of urban drug governance, thus playing significant roles. This paper provides an overview of sample collection, sample preservation and transportation, laboratory analysis, back-calculation of drug use and external laboratory quality control in the process of wastewater analysis, with a view to exploring more comprehensive scientific and objective methods and approaches suitable for examining and evaluating qualitative and quantitative analysis of drugs in wastewater among laboratories.

"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy. METHODS: A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG. RESULTS: After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05). CONCLUSIONS The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.
Humans ; Thrombelastography ; Hemophilia A/physiopathology* ; Male ; Child ; Antibodies, Bispecific/therapeutic use* ; Antibodies, Monoclonal, Humanized/therapeutic use* ; Blood Coagulation/drug effects* ; Child, Preschool ; Retrospective Studies ; Female ; Partial Thromboplastin Time ; Adolescent ; Infant

Early screening, diagnosis, and intervention for congenital muscular torticollis (CMT) in infants are crucial for improving clinical outcomes. However, in China, limited awareness of CMT among child healthcare institutions and caregivers, as well as inconsistent professional standards among rehabilitation personnel, pose significant challenges to the effective diagnosis and management of CMT. The "Physical therapy management of congenital muscular torticollis: a 2024 evidence-based clinical practice guideline from the American Physical Therapy Association Academy of Pediatric Physical Therapy" includes 17 action statements, primarily addressing the prevention, identification, assessment, and intervention of CMT. This guideline is expected to facilitate early detection of CMT in infants, enhance the treatment capabilities of physical therapists, and improve clinical outcomes. This article provides an interpretation of the guideline in the context of the current status of CMT diagnosis and management in China, aiming to offer a reference for improving the ability of primary child healthcare providers and physical therapists to recognize and manage CMTropriately.
Humans ; Torticollis/diagnosis* ; Physical Therapy Modalities ; Practice Guidelines as Topic ; Infant ; United States

Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.

AIM To evaluate the quality of Tibetan medicine"Sangdi"based on HPLC fingerprints combined with chemometrics.METHODS The analysis was performed on a 30 ℃ thermostatic Welch Ultimate AQ-C18 column(250 mm × 4.6 mm,5 μm),with the mobile phase comprising of acetonitrile-0.2％phosphoric acid flowing at 1 mL/min in a gradient elution manner,and the detection wavelength was set at 245 nm,after which cluster analysis,principal component analysis and orthogonal partial least squares discriminant analysis were performed,the contents of gentiopicroside,sweroside,mangiferin,isoorientin,8-hydroxy-1,3,5-trimethoxyxanthone(R2)and 1,8-dihydroxy-3,7-dimethoxyxanthone(R3)were determined.RESULTS There were 18 common peaks in the fingerprints for 15 batches of samples with the similarities of more than 0.90.Six constituents showed good linear relationships within their own ranges(R 2 ≥ 0.999 2),whose average recoveries were 96.93％-103.58％with the RSDs of 0.82％-2.9％.Various batches of samples were clustered into 2 categories,4 principal components demonstrated the accumulative variance contribution rate of 86.404％,mangiferin,gentiopicroside and isoorientin were taken as quality difference markers.CONCLUSION This stable,reliable and reproducibe method can provide a reference for the comprehensive quality evaluation of"Sangdi".