1.Bali Chronic Constipation Roundtable Report: Chronic ConstipationManagement in Asia
Yi Ping REN ; Wah Loong CHAN ; Kee Huat CHUAH ; Yong Sung KIM ; Atsushi NAKAJIMA ; Sanjiv MAHADEVA ; Yeong Yeh LEE ; Andrew S B CHUA ; Tao BAI ; Ari Fahrial SYAM ; Chien-Lin CHEN ; Ching-Liang LU ; M. Masudur RAHMAN ; Tanisa PATCHARATRAKUL ; Victoria Ping Y TAN ; Dao Viet HANG ; Xiaohua HOU ; Yinglian XIAO ; Justin WU ; Uday C GHOSHAL ; Hidekazu SUZUKI ; Sutep GONLACHANVIT ; Kewin T H SIAH
Journal of Neurogastroenterology and Motility 2026;32(1):109-128
Background/Aims:
Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care.
Methods:
The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations.
Results:
Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing.
Conclusions
The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.
2.A finite element biomechanical study of anterior transpedicular root screw plate fixation system in the lower cervical spine.
Xiao-Ping XU ; Zhi-Peng HOU ; Liu-Jun ZHAO
China Journal of Orthopaedics and Traumatology 2025;38(8):848-855
OBJECTIVE:
To establish a two-segment vertebrectomy model using the finite element method, and to measure and compare the biomechanical properties of the lower cervical anterior transpedicular root screw (ATPRS) plate system, lower cervical anterior pedicle screw (ATPS) plate system, and lower cervical anterior cervical locked-plate (ACLP) system on this model.
METHODS:
CT data of the cervical spine (C0-T1) from a 34-year-old healthy adult male volunteer were collected. A nonlinear complete model of the lower cervical spine (C3-C7) was established using Mimics 10.01 software, based on which the ATPRS fixation model, ATPS fixation model, and ACLP fixation model were constructed respectively. An axial pressure of 75 N and a pure couple moment of 1.5 N·m were applied to C3 to make the model perform flexion-extension, left-right lateral bending, and left-right rotation movements. The range of motion (ROM) and stress distribution of each model under different working conditions were compared.
RESULTS:
The ROM of the C4-C7 segments in the ACLP group, ATPS group, and ATPRS group was reduced to 0.65° (-95.2%), 0.58° (-95.7%), and 0.62° (-95.4%) respectively compared with the intact model during flexion-extension movement;during lateral bending movement, it was reduced to 0.58° (-95.2%), 0.51°(-95.8%), and 0.60° (-95.1%) respectively;during rotation movement, it was reduced to 1.17° (-89.6%), 1.26° (-88.8%), and 1.27°(-88.7%) respectively. In terms of the stress on the titanium mesh graft, the ATPS group and ATPRS group had the maximum load during extension and the minimum load during flexion. Compared with the ACLP group, the stress on the titanium mesh graft in ATPS and ATPRS decreased by (-33.7%) and (-15.8%) in flexion, (-29.4%) and (-13.2%) in extension, (-26.2%) and (-23.4%) in lateral bending, and (-18.8%) and (-5.4%) in rotation, respectively. In terms of bone-screw interface stress, the peak bone stress near the C7 screw in the ACLP group, ATPS group, and ATPRS group increased by 49.2%, 45.0%, and 47.6% respectively compared with the peak bone stress near the C4 screw during extension. However, during flexion and lateral bending, there was no significant difference in the peak bone stress near the C4 and C7 screws. During rotation, the difference between the peak bone stress near the C4 screw and that near the C7 screw showed that in the ACLP group, left rotation (37.6%) was similar to right rotation (36.7%), while in the ATPS group and ATPRS group, left rotation was lower than right rotation.
CONCLUSION
Compared with the ACLP group, the ATPS group and ATPRS group have greater fixation stiffness and more stable fixation. However, in rotational movement, due to the uneven distribution of fixation stiffness, the stress distribution during torsion is uneven, but it is still better than the ACLP group. This indicates that ATPRS, like ATPS, has good primary stability, providing favorable conditions for bone graft fusion.
Humans
;
Finite Element Analysis
;
Male
;
Cervical Vertebrae/physiopathology*
;
Adult
;
Biomechanical Phenomena
;
Bone Plates
;
Bone Screws
;
Range of Motion, Articular
;
Fracture Fixation, Internal
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Glucocorticoid Discontinuation in Patients with Rheumatoid Arthritis under Background of Chinese Medicine: Challenges and Potentials Coexist.
Chuan-Hui YAO ; Chi ZHANG ; Meng-Ge SONG ; Cong-Min XIA ; Tian CHANG ; Xie-Li MA ; Wei-Xiang LIU ; Zi-Xia LIU ; Jia-Meng LIU ; Xiao-Po TANG ; Ying LIU ; Jian LIU ; Jiang-Yun PENG ; Dong-Yi HE ; Qing-Chun HUANG ; Ming-Li GAO ; Jian-Ping YU ; Wei LIU ; Jian-Yong ZHANG ; Yue-Lan ZHU ; Xiu-Juan HOU ; Hai-Dong WANG ; Yong-Fei FANG ; Yue WANG ; Yin SU ; Xin-Ping TIAN ; Ai-Ping LYU ; Xun GONG ; Quan JIANG
Chinese journal of integrative medicine 2025;31(7):581-589
OBJECTIVE:
To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM).
METHODS:
This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis.
RESULTS:
Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings.
CONCLUSIONS
RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Arthritis, Rheumatoid/drug therapy*
;
Glucocorticoids/therapeutic use*
;
Medicine, Chinese Traditional
;
Retrospective Studies
5.International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025).
Sheng-Sheng ZHANG ; Lu-Qing ZHAO ; Xiao-Hua HOU ; Zhao-Xiang BIAN ; Jian-Hua ZHENG ; Hai-He TIAN ; Guan-Hu YANG ; Won-Sook HONG ; Yu-Ying HE ; Li LIU ; Hong SHEN ; Yan-Ping LI ; Sheng XIE ; Jin SHU ; Bin-Fang ZENG ; Jun-Xiang LI ; Zhen LIU ; Zheng-Hua XIAO ; Jing-Dong XIAO ; Pei-Yong ZHENG ; Shao-Gang HUANG ; Sheng-Liang CHEN ; Gui-Jun FEI
Journal of Integrative Medicine 2025;23(5):502-518
Functional dyspepsia (FD), characterized by persistent or recurrent dyspeptic symptoms without identifiable organic, systemic or metabolic causes, is an increasingly recognized global health issue. The objective of this guideline is to equip clinicians and nursing professionals with evidence-based strategies for the management and treatment of adult patients with FD using traditional Chinese medicine (TCM). The Guideline Development Group consulted existing TCM consensus documents on FD and convened a panel of 35 clinicians to generate initial clinical queries. To address these queries, a systematic literature search was conducted across PubMed, EMBASE, the Cochrane Library, China National Knowledge Infrastructure (CNKI), VIP Database, China Biology Medicine (SinoMed) Database, Wanfang Database, Traditional Medicine Research Data Expanded (TMRDE), and the Traditional Chinese Medical Literature Analysis and Retrieval System (TCMLARS). The evidence from the literature was critically appraised using the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) approach. The strength of the recommendations was ascertained through a consensus-building process involving TCM and allopathic medicine experts, methodologists, pharmacologists, nursing specialists, and health economists, leveraging their collective expertise and empirical knowledge. The guideline comprises a total of 43 evidence-informed recommendations that span a range of clinical aspects, including the pathogenesis according to TCM, diagnostic approaches, therapeutic interventions, efficacy assessments, and prognostic considerations. Please cite this article as: Zhang SS, Zhao LQ, Hou XH, Bian ZX, Zheng JH, Tian HH, Yang GH, Hong WS, He YY, Liu L, Shen H, Li YP, Xie S, Shu J, Zeng BF, Li JX, Liu Z, Xiao ZH, Xiao JD, Zheng PY, Huang SG, Chen SL, Fei GJ. International clinical practice guideline on the use of traditional Chinese medicine for functional dyspepsia (2025). J Integr Med. 2025; 23(5):502-518.
Dyspepsia/drug therapy*
;
Humans
;
Medicine, Chinese Traditional/methods*
;
Practice Guidelines as Topic
;
Drugs, Chinese Herbal/therapeutic use*
6.(Meta)transcriptomic Insights into the Role of Ticks in Poxvirus Evolution and Transmission: A Multicontinental Analysis.
Yu Xi WANG ; Jing Jing HU ; Jing Jing HOU ; Xiao Jie YUAN ; Wei Jie CHEN ; Yan Jiao LI ; Qi le GAO ; Yue PAN ; Shui Ping LU ; Qi CHEN ; Si Ru HU ; Zhong Jun SHAO ; Cheng Long XIONG
Biomedical and Environmental Sciences 2025;38(9):1058-1070
OBJECTIVE:
Poxviruses are zoonotic pathogens that infect humans, mammals, vertebrates, and arthropods. However, the specific role of ticks in transmission and evolution of these viruses remains unclear.
METHODS:
Transcriptomic and metatranscriptomic raw data from 329 sampling pools of seven tick species across five continents were mined to assess the diversity and abundance of poxviruses. Chordopoxviral sequences were assembled and subjected to phylogenetic analysis to trace the origins of the unblasted fragments within these sequences.
RESULTS:
Fifty-eight poxvirus species, representing two subfamilies and 20 genera, were identified, with 212 poxviral sequences assembled. A substantial proportion of AT-rich fragments were detected in the assembled poxviral genomes. These genomic sequences contained fragments originating from rodents, archaea, and arthropods.
CONCLUSION
Our findings indicate that ticks play a significant role in the transmission and evolution of poxviruses. These viruses demonstrate the capacity to modulate virulence and adaptability through horizontal gene transfer, gene recombination, and gene mutations, thereby promoting co-existence and co-evolution with their hosts. This study advances understanding of the ecological dynamics of poxvirus transmission and evolution and highlights the potential role of ticks as vectors and vessels in these processes.
Animals
;
Poxviridae/physiology*
;
Ticks/virology*
;
Phylogeny
;
Transcriptome
;
Evolution, Molecular
;
Poxviridae Infections/virology*
;
Genome, Viral
7.Multidisciplinary expert consensus on weight management for overweight and obese children and adolescents based on healthy lifestyle
HONG Ping, MA Yuguo, TAO Fangbiao, XU Yajun, ZHANG Qian, HU Liang, WEI Gaoxia, YANG Yuexin, QIAN Junwei, HOU Xiao, ZHANG Yimin, SUN Tingting, XI Bo, DONG Xiaosheng, MA Jun, SONG Yi, WANG Haijun, HE Gang, CHEN Runsen, LIU Jingmin, HUANG Zhijian, HU Guopeng, QIAN Jinghua, BAO Ke, LI Xuemei, ZHU Dan, FENG Junpeng, SHA Mo, Chinese Association for Student Nutrition & ; Health Promotion, Key Laboratory of Sports and Physical Fitness of the Ministry of Education,〖JZ〗 Engineering Research Center of Ministry of Education for Key Core Technical Integration System and Equipment,〖JZ〗 Key Laboratory of Exercise Rehabilitation Science of the Ministry of Education
Chinese Journal of School Health 2025;46(12):1673-1680
Abstract
In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.
8.Study on the Correlation between Palm Temperature,Disease Activity,and Traditional Chinese Medicine Syndrome Types in Patients with Rheumatoid Arthritis
Xiao-shuang HOU ; Li-min PAN ; Chen-jing GAO ; Ya-ping LUO
Progress in Modern Biomedicine 2025;25(9):1517-1524,1548
Objective:To explore the correlation between palm temperature,disease activity,and traditional chinese medicine syndrome types in patients with rheumatoid arthritis(RA).Methods:80 RA patients(RA group)who were admitted to our hospital from April 2022 to June 2024 were selected,they were divided into high group(DAS28 score>5.1 score)and low to moderate group(2.6 score ≤ DAS28 score≤5.1 score)according to the 28 joint disease activity scores(DAS28).70 healthy volunteers who underwent physical examinations during the same period(control group)were selected.The palm temperature,erythrocyte sedimentation rate(ESR),C-reactive protein(CRP),and DAS28 scores between the control group and RA group were compared.The palm temperature,ESR,and CRP levels between low to moderate group and high group were compared.The correlation between palm temperature and disease activity,ESR,and CRP levels in RA patients was analyzed by Pearson correlation.The distribution of traditional chinese medicine syndrome types in RA patients was observed,the palm temperature,ESR,and CRP levels of RA patients with different traditional chinese medicine syndrome types were compared.Results:The palm temperature,ESR,CRP levels,and DAS28 score in the RA group were higher than those in the control group(P<0.05).The palm temperature,ESR,and CRP levels in the high group were higher than those in the low to moderate group(P<0.05).Pearson correlation analysis results showed that,the palm temperature of RA patients was positively correlated with DAS28 score,ESR,and CRP levels(P<0.05).Among 80 RA patients,there were 17 cases(21.25%)of liver and kidney deficiency syndrome,23 cases(29.02%)of cold and dampness obstruction syndrome,14 cases(17.86%)of qi and blood deficiency syndrome,17 cases(21.47%)of damp heat obstruction syndrome,and 9 cases(11.52%)of phlegm and blood stasis obstruction syndrome.The palm temperature,ESR,and CRP levels of patients with Qi and blood deficiency syndrome,liver and kidney deficiency syndrome,and phlegm and blood stasis obstruction syndrome increased in sequence and were higher than those of patients with damp heat obstruction syndrome and cold and dampness obstruction syndrome(P<0.05).There was no statistical difference in palm temperature,ESR,and CRP levels between the groups of damp heat obstruction syndrome and cold and dampness obstruction syndrome(P>0.05).Conclusion:There is a certain correlation between the palm temperature and disease activity and traditional chinese medicine syndrome types of RA patients.Regular observation of palm temperature,ESR,CRP levels,and DAS28 score is helpful for assessing the condition of RA patients.
9.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
10.Adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E gene polymorphisms for Alzheimer′s disease
Huiwang ZHANG ; Juan JIANG ; Huixian XIONG ; Qinchuan HOU ; Yongli LAN ; Mo ZHANG ; Peiyuan HE ; Wei PU ; Huili LIU ; Xiao XIAO ; Jun XIAO ; Yuping LIU ; Ping SHUAI
Chinese Journal of Health Management 2025;19(8):590-596
Objective:To investigate the adjunctive diagnostic value of retinal imaging structural parameters combined with apolipoprotein E (ApoE) gene polymorphisms for Alzheimer′s disease (AD).Methods:It was a case-control study, 71 confirmed AD patients who attended the Department of Neurology in Sichuan Provincial People′s Hospital from May 2023 to June 2024 and 156 healthy medical checkups who participated in medical checkups in the Health Management Center were continuously with convenience sampling method; the subjects were included as the AD case group and healthy control group, respectively. Optical coherence tomography (OCT) was used to measure the structural parameters of retinal imaging such as the thickness of the retinal nerve fiber layer (RNFL) and the retinal nerve fiber layer-inner plexiform layer (RNFL-IPL) in the study subjects. Information on demographic characteristics and disease history of the study participants were collected through a questionnaire, and venous blood was collected to test for ApoE gene polymorphisms. The retinal imaging structural parameters, ApoE gene polymorphisms and other related indicators were included in a multifactorial logistic regression model to analyze the main factors affecting the risk of AD. Based on the results of the multifactorial analysis, the receiver operating characteristic (ROC) curves were plotted and the areas under the curve (AUC) were calculated to evaluate the efficacy of different models in the adjunctive diagnosis of AD.Results:Of the 227 study subjects included in the analysis, 153 were females and 74 were males; there were 71 cases in the AD case group with a mean age of (66.73±8.83) years, and there were 156 subjects in the healthy control group with an average age of (61.95±8.21) years. Educational attainment of elementary school and below ( OR=4.683, 95% CI: 2.133-10.282), living visual acuity<0.5 ( OR=2.716, 95% CI: 1.12-6.583), and carrying ≥1 ApoE ε4 genes ( OR=5.331, 95% CI: 2.309-11.891) were positively correlated with the risk of AD. RNFL thickening ( OR=0.923, 95% CI: 0.854-0.998) was negatively associated with the risk of AD (all P<0.05). The AD risk assessment model (Model 4), which included fundus imaging features and ApoE gene polymorphisms, had the highest predictive efficacy (AUC=0.857, P<0.001). Conclusion:Retinal imaging structural parameters differ significantly between AD patients and healthy examinees, and a risk assessment model combining retinal imaging structural parameters and ApoE gene polymorphisms has high predictive value and is expected to serve as an auxiliary diagnostic tool for AD.


Result Analysis
Print
Save
E-mail