AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

PURPOSE: This study aimed to investigate the effects of PIK3CA on the sensitivity of acute B lymphocytic leukemia cells (Nalm-6 cells) to chemotherapy drugs. MATERIALS AND METHODS: Children's normal B lymphocytes and Nalm-6 cells were cultured. Nalm-6 cells were transfected with PIK3CA siRNA (siPIK3CA group) or its negative control (PIK3CA-Control group). Normal Nalm-6 cells were named Mock group. Nalm-6 cells transfected by PIK3CA siRNA were treated with Akt inhibitor (siPIK3CA+Akti-1/2 group). mRNA and protein expression was detected by qRT-PCR and Western blot. Proliferation and sensitivity to chemotherapeutic drugs was detected by MTT assay. Cell cycle and apoptosis was explored by low cytometry. Transwell assay was performed to test invasion. RESULTS: PIK3CA mRNA (p=0.008) and protein (p=0.006) expression was higher in Nalm-6 cells than that in normal B lymphocytes. Compared with the Mock group and PIK3CA-Control group, Nalm-6 cells of the siPIK3CA group had lower OD495 values (all p < 0.05) and invasion cell numbers (p=0.03 and p=0.025), as well as a higher proportion of G0/G1 phase cells (p=0.020 and p=0.022), percentage of apoptosis (p=0.016 and p=0.022), and inhibition rate (all p < 0.05). pAkt expression in the siPIK3CA group (p=0.026 and p=0.031) and siPIK3CA+Akti-1/2 group (p=0.019 and p=0.023) was lower than that in the Mock group. CONCLUSION: PIK3CA silencing inhibited Nalm-6 cell proliferation and invasion, and promoted their apoptosis and sensitivity to chemotherapeutic drugs, potentially through regulation of the PI3K/AKT signaling pathway.
Apoptosis ; B-Lymphocytes ; Blotting, Western ; Cell Count ; Cell Cycle ; Cell Proliferation ; Drug Therapy ; Leukemia ; Leukemia, B-Cell ; Phosphorylation ; RNA, Messenger ; RNA, Small Interfering