AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Thyroid-associated ophthalmopathy(TAO)is a common autoimmune complication in thyroid diseases. Its pathogenesis is complex and involves the abnormal activation of multiple signaling pathways. With the rapid development of molecular biology and genomics technologies, the signal transduction mechanisms and regulatory networks related to TAO have been deeply analyzed. At present, studies have found that the interaction between the TSH receptor(TSHR)and the insulin-like growth factor-1 receptor(IGF-1R)signaling pathway, as well as immune inflammation-related pathways, oxidative stress, and calcium signaling pathways, play important roles in the pathogenesis of TAO. In addition, the research on the regulatory mechanism of non-coding RNA and fibrosis-related signaling molecules has gradually become the focus. Despite much advancement, there are still many unsolved mysteries regarding the exact pathogenesis of TAO. This article aims to systematically review the latest research progress of the main signaling pathways of TAO. By combining the latest achievements in gene expression profiles, single-cell sequencing and drug design, it analyzes potential therapeutic targets and the development directions of innovative drugs, providing a theoretical basis for the pathological mechanism of TAO and a scientific basis for the optimization of clinical treatment strategies at the same time.