Background Meteorological factors are among the key extrinsic triggers for the onset and exacerbation of cardiovascular and cerebrovascular diseases (CVD). Against the backdrop of sustained global warming, elucidating the impact of ambient temperature and atmospheric pressure on CVD, especially on pre-hospital CVD emergent events, has become imperative for evidence-based prevention and emergency preparedness. Objective To quantify the temporal trends of daily mean temperature and atmospheric pressure and their associations with pre-hospital CVD emergent events in Yantai, and to explore effect modification by demographic subgroups and geographic areas, thereby providing an empirical basis for the rational allocation of emergency medical resources. Methods Pre-hospital CVD emergency data from January 1, 2016 to December 31, 2022 were selected from the Yantai 120 Emergency Medical Command System. Synchronous meteorological factors and environmental pollutant data were obtained from the websites of the National Oceanic and Atmospheric Administration and the National Centers for Environmental Information of the United States. Time-series analysis combined with distributed lag non-linear model was used to analyze the association between daily temperature, atmospheric pressure, and pre-hospital CVD emergencies. Average annual percentage changes (AAPC) were calculated using Joinpoint (version 5.2.0.0) to reflect temporal trends. Spearman correlation analysis was employed to screen variables with low collinearity for inclusion in the multi-pollutant adjusted models. Results From 2016 to 2022, a total of 268275 pre-hospital CVD emergency cases were recorded in Yantai City, showing an increasing annual trend (AAPC=7.16%, P=0.002). Emergency volume, daily temperature, atmospheric pressure, and PM₁₀ displayed marked seasonal patterns, with summer bottoms and winter peaks for emergencies, daily temperature higher in summer and lower in winter, and the inverse for atmospheric pressure. Correlation analysis showed that both daily temperature and atmospheric pressure were positively correlated with O₃, with correlation coefficients of 0.745 and 0.723, respectively; negatively correlated with PM_2.5, with correlation coefficients of −0.246 and −0.235, respectively; and negatively correlated with PM₁₀, with correlation coefficients of −0.241 and −0.229, respectively (P < 0.05). A U-shaped correlation was revealed between daily temperature and pre-hospital CVD emergency risk. Using 24 °C as the reference, risk was elevated at both low and high daily temperatures, with the strongest cold effect at –11 ℃ (RR=1.53, 95%CI: 1.35, 1.73) and strongest heat effect at 30 ℃ (RR=1.06, 95%CI: 1.01, 1.11); cold effects were prolonged (lag0–14d) compared to heat effects. Atmospheric pressure exhibited a positive association with emergencies; using a median of 1012.2 hPa as the reference, the maximum risk occurred at 1037 hPa (RR=1.25, 95%CI: 1.03, 1.52), with a 0–5 d lag. In the subgroup analysis, the impact of low temperature was more pronounced among females (RR_{−9 ℃}=1.66), people over 60 years (RR_{−9 ℃}=1.91), and rural residents (RR_{−9 ℃}=1.76). High atmospheric pressure significantly increased the risk of pre-hospital CVD emergency among females (RR_{1035 hPa}=1.54), people under 18 years (RR_{1035 hPa}=3.62), and rural residents (RR_{1035 hPa}=1.46). The sensitivity analysis results indicated that, after excluding the impact of pandemic and the degrees of freedom for time variations, the effects of daily average temperature and atmospheric pressure on pre-hospital CVD emergency volume were consistent with the primary analysis findings. Conclusion Both non-optimal temperature and atmospheric pressure significantly increase the pre-hospital CVD emergency volume; therefore, emergency medical services should develop targeted response protocols, optimize resource allocation, and intensify public health education to mitigate the pre-hospital burden attributable to temperature and pressure fluctuations.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

ObjectiveThis paper aims to investigate the traditional Chinese medicine syndrome types in patients with chronic hepatitis B （CHB） complicated by metabolic dysfunction-associated fatty liver disease （MAFLD） and explore the correlations between these syndrome types and clinical indicators， as well as ocular manifestation characteristics， thereby providing a reference for syndrome differentiation and treatment strategies in traditional Chinese medicine. MethodsGeneral data， information from the four diagnostic methods of traditional Chinese medicine， clinical indicators， and ocular manifestation data were collected from 506 patients with CHB complicated by MAFLD enrolled at the Public Health Clinical Center of Chengdu between June 2024 and December 2024. Cluster analysis， principal component analysis， and complex network models were employed to identify the distribution patterns of traditional Chinese medicine syndromes. Correlations between different syndrome types and clinical indicators， as well as ocular manifestation characteristics， were further analyzed. ResultsThe predominant syndromes identified in patients with CHB complicated by MAFLD were dampness and heat accumulation （51.58%）， liver depression with spleen deficiency （31.62%）， blood stasis obstructing collaterals （8.89%）， and Qi-Yin deficiency （7.91%）. No statistically significant differences were found among the four syndrome types in routine blood tests and liver function indicators. However， patients with the dampness and heat accumulation type exhibited significantly higher levels of total cholesterol （TC）， triglycerides （TG）， low-density lipoprotein cholesterol （LDL-C）， liver stiffness measurement （LSM）， controlled attenuation parameter （CAP）， and alpha-fetoprotein （AFP）， along with lower levels of high-density lipoprotein cholesterol （HDL-C）， compared with those with other syndrome types. Regarding ocular manifestations， the incidence of moon halo signs was significantly higher in patients with the blood stasis obstructing collaterals type than in those with other syndrome types. Additionally， the incidence in scleral zone 3 （corresponding to the large intestine） was higher in patients with the damp and heat accumulation type. ConclusionDampness and heat accumulation is the core syndrome type in patients with CHB complicated by MAFLD， commonly accompanied by spleen deficiency， liver depression， blood stasis， and Yin deficiency. A complex syndrome pattern characterized by a predominance of dampness and heat， along with a mixture of deficiency and excess， is formed. Different traditional Chinese medicine syndrome types are associated with distinct clinical indicators and ocular manifestation characteristics. Among them， patients with the dampness and heat accumulation type exhibit more pronounced metabolic disturbances and liver injury， whereas those with the blood stasis type show a higher incidence of moon halo signs. Abnormalities in scleral zone 3 are also more prevalent in patients with dampness and heat type.

ObjectiveTo investigate the molecular mechanisms related to angiogenesis during the development and progression of diabetic retinopathy （DR）. MethodsAngiogenesis-related genes were obtained from the Gencard website and intersected with differentially expressed genes from DR datasets （GSE60436 and GSE94019）. Functional enrichment and protein-protein interaction （PPI） networks were then used to screen candidate genes and evaluate their diagnostic value. Gene set enrichment analysis （GSEA） was used to explore potential pathways underlying candidate genes， and immune infiltration analysis revealed associations between candidate genes and immune cells. Cellular experiments were conducted to validate the role of fibronectin 1 （FN1） in human retinal microvascular endothelial cells （HRMECs） under high glucose （HG） conditions. ResultsA total of 237 differentially expressed genes related to angiogenesis were identified， enriched in pathways such as phosphoinositide 3-kinase/protein kinase B signaling pathway （PI3K-Akt）， tumor suppressor protein 53 （P53）， tumor necrosis factor （TNF）， and Janus kinase （JAK）/signal transducer and activator of transcription signaling pathway （STAT）. Among them， collagen type I alpha 1 chain （COL1A1）， COL1A2， FN1， TNF， and tumor protein p53 （TP53） were key genes with high diagnostic value. GSEA indicated that these genes were involved in multiple signaling pathways， including P53. CIBERSORTx analysis revealed significant associations with the infiltration of multiple immune cells. HG treatment led to the upregulation of FN1. In HG-induced HRMECs， compared with the si-NC control group， si-FN1 significantly reduced cell proliferation， migration， and tube formation， while P53 protein expression was increased. ConclusionThis study reveals the important role of FN1 in angiogenesis in DR and suggests that it may be a potential diagnostic and therapeutic target.

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the early clinical efficacy and safety of trans-catheter aortic valve replacement (TAVR) for patients with severe pure native aortic regurgitation (PNAR) who are not suitable for conventional surgical aortic valve replace-ment. METHODS: A retrospective analysis was conducted on 48 patients with PNAR who underwent TAVR at the Department of Cardiac Surgery, the First Affiliated Hospital of Sun Yat-sen University between March 2019 and February 2025. These included 25 cases with transfemoral approach (TF-TAVR group) and 23 cases with transapical approach (TA-TAVR group). Efficacy and safety were assessed by analyzing baseline characteristics, all-cause mortality, and procedure-related complications. RESULTS: Compared with the TA-TAVR group, the TF-TAVR group exhibited significantly smaller aortic annulus circumference and diameter, left ventricular outflow tract circumference and diameter, diameters of the left, right, and non-coronary sinuses, and sinotubular junction (STJ) diameter, along with a shorter distance from the STJ to the aortic annular plane ring plane, a smaller annulus angle (all P<0.05). Additionally, the TF-TAVR group showed a deeper prosthesis implantation depth relative to the aortic annular plane (P<0.01). The overall technical success rate was 91.67%, and the device success rate was 83.33%. Post-TAVR, both groups demonstrated significant improvement in left ventricular end-diastolic diameter (both P<0.05), while only the TA-TAVR group showed significant reduction in left ventricular end-systolic diameter (P<0.05). For primary outcomes, in-hospital mortality occurred in 2 patients (4.17%). No additional deaths were reported at 60 or 90 d after surgery. During 90-180 d after surgery, one patient in the TF-TAVR group died of sudden cardiac death, and one in the TA-TAVR group died of gastroin-testinal bleeding. During 180 d-1 year after surgery, one patient in the TF-TAVR group died of low cardiac output syndrome. No statistically significant differences were observed in 1-year Kaplan-Meier survival curves between the two groups (P>0.05). No conduction block events occurred in TA-TAVR group during hospitalization or 1-year follow-up, while high-grade atrioventricular block, left bundle branch block, permanent pacemaker implantation occurred in TF-TAVR group during hospitalization (12.00%, 4.00%, and 12.00%, respectively). CONCLUSIONS TAVR demonstrates high feasibility and acceptable safety for severe PNAR patients who are not suitable for conventional SAVR. Both TF-TAVR and TA-TAVR show comparable early postoperative efficacy and safety profiles.
Humans ; Transcatheter Aortic Valve Replacement/adverse effects* ; Aortic Valve Insufficiency/surgery* ; Retrospective Studies ; Male ; Female ; Aged ; Treatment Outcome ; Aortic Valve/surgery* ; Aged, 80 and over ; Heart Valve Prosthesis

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny