ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

Background Meteorological factors are among the key extrinsic triggers for the onset and exacerbation of cardiovascular and cerebrovascular diseases (CVD). Against the backdrop of sustained global warming, elucidating the impact of ambient temperature and atmospheric pressure on CVD, especially on pre-hospital CVD emergent events, has become imperative for evidence-based prevention and emergency preparedness. Objective To quantify the temporal trends of daily mean temperature and atmospheric pressure and their associations with pre-hospital CVD emergent events in Yantai, and to explore effect modification by demographic subgroups and geographic areas, thereby providing an empirical basis for the rational allocation of emergency medical resources. Methods Pre-hospital CVD emergency data from January 1, 2016 to December 31, 2022 were selected from the Yantai 120 Emergency Medical Command System. Synchronous meteorological factors and environmental pollutant data were obtained from the websites of the National Oceanic and Atmospheric Administration and the National Centers for Environmental Information of the United States. Time-series analysis combined with distributed lag non-linear model was used to analyze the association between daily temperature, atmospheric pressure, and pre-hospital CVD emergencies. Average annual percentage changes (AAPC) were calculated using Joinpoint (version 5.2.0.0) to reflect temporal trends. Spearman correlation analysis was employed to screen variables with low collinearity for inclusion in the multi-pollutant adjusted models. Results From 2016 to 2022, a total of 268275 pre-hospital CVD emergency cases were recorded in Yantai City, showing an increasing annual trend (AAPC=7.16%, P=0.002). Emergency volume, daily temperature, atmospheric pressure, and PM₁₀ displayed marked seasonal patterns, with summer bottoms and winter peaks for emergencies, daily temperature higher in summer and lower in winter, and the inverse for atmospheric pressure. Correlation analysis showed that both daily temperature and atmospheric pressure were positively correlated with O₃, with correlation coefficients of 0.745 and 0.723, respectively; negatively correlated with PM_2.5, with correlation coefficients of −0.246 and −0.235, respectively; and negatively correlated with PM₁₀, with correlation coefficients of −0.241 and −0.229, respectively (P < 0.05). A U-shaped correlation was revealed between daily temperature and pre-hospital CVD emergency risk. Using 24 °C as the reference, risk was elevated at both low and high daily temperatures, with the strongest cold effect at –11 ℃ (RR=1.53, 95%CI: 1.35, 1.73) and strongest heat effect at 30 ℃ (RR=1.06, 95%CI: 1.01, 1.11); cold effects were prolonged (lag0–14d) compared to heat effects. Atmospheric pressure exhibited a positive association with emergencies; using a median of 1012.2 hPa as the reference, the maximum risk occurred at 1037 hPa (RR=1.25, 95%CI: 1.03, 1.52), with a 0–5 d lag. In the subgroup analysis, the impact of low temperature was more pronounced among females (RR_{−9 ℃}=1.66), people over 60 years (RR_{−9 ℃}=1.91), and rural residents (RR_{−9 ℃}=1.76). High atmospheric pressure significantly increased the risk of pre-hospital CVD emergency among females (RR_{1035 hPa}=1.54), people under 18 years (RR_{1035 hPa}=3.62), and rural residents (RR_{1035 hPa}=1.46). The sensitivity analysis results indicated that, after excluding the impact of pandemic and the degrees of freedom for time variations, the effects of daily average temperature and atmospheric pressure on pre-hospital CVD emergency volume were consistent with the primary analysis findings. Conclusion Both non-optimal temperature and atmospheric pressure significantly increase the pre-hospital CVD emergency volume; therefore, emergency medical services should develop targeted response protocols, optimize resource allocation, and intensify public health education to mitigate the pre-hospital burden attributable to temperature and pressure fluctuations.

ObjectiveTo investigate the molecular mechanisms related to angiogenesis during the development and progression of diabetic retinopathy （DR）. MethodsAngiogenesis-related genes were obtained from the Gencard website and intersected with differentially expressed genes from DR datasets （GSE60436 and GSE94019）. Functional enrichment and protein-protein interaction （PPI） networks were then used to screen candidate genes and evaluate their diagnostic value. Gene set enrichment analysis （GSEA） was used to explore potential pathways underlying candidate genes， and immune infiltration analysis revealed associations between candidate genes and immune cells. Cellular experiments were conducted to validate the role of fibronectin 1 （FN1） in human retinal microvascular endothelial cells （HRMECs） under high glucose （HG） conditions. ResultsA total of 237 differentially expressed genes related to angiogenesis were identified， enriched in pathways such as phosphoinositide 3-kinase/protein kinase B signaling pathway （PI3K-Akt）， tumor suppressor protein 53 （P53）， tumor necrosis factor （TNF）， and Janus kinase （JAK）/signal transducer and activator of transcription signaling pathway （STAT）. Among them， collagen type I alpha 1 chain （COL1A1）， COL1A2， FN1， TNF， and tumor protein p53 （TP53） were key genes with high diagnostic value. GSEA indicated that these genes were involved in multiple signaling pathways， including P53. CIBERSORTx analysis revealed significant associations with the infiltration of multiple immune cells. HG treatment led to the upregulation of FN1. In HG-induced HRMECs， compared with the si-NC control group， si-FN1 significantly reduced cell proliferation， migration， and tube formation， while P53 protein expression was increased. ConclusionThis study reveals the important role of FN1 in angiogenesis in DR and suggests that it may be a potential diagnostic and therapeutic target.

ObjectiveThis paper aims to investigate the traditional Chinese medicine syndrome types in patients with chronic hepatitis B （CHB） complicated by metabolic dysfunction-associated fatty liver disease （MAFLD） and explore the correlations between these syndrome types and clinical indicators， as well as ocular manifestation characteristics， thereby providing a reference for syndrome differentiation and treatment strategies in traditional Chinese medicine. MethodsGeneral data， information from the four diagnostic methods of traditional Chinese medicine， clinical indicators， and ocular manifestation data were collected from 506 patients with CHB complicated by MAFLD enrolled at the Public Health Clinical Center of Chengdu between June 2024 and December 2024. Cluster analysis， principal component analysis， and complex network models were employed to identify the distribution patterns of traditional Chinese medicine syndromes. Correlations between different syndrome types and clinical indicators， as well as ocular manifestation characteristics， were further analyzed. ResultsThe predominant syndromes identified in patients with CHB complicated by MAFLD were dampness and heat accumulation （51.58%）， liver depression with spleen deficiency （31.62%）， blood stasis obstructing collaterals （8.89%）， and Qi-Yin deficiency （7.91%）. No statistically significant differences were found among the four syndrome types in routine blood tests and liver function indicators. However， patients with the dampness and heat accumulation type exhibited significantly higher levels of total cholesterol （TC）， triglycerides （TG）， low-density lipoprotein cholesterol （LDL-C）， liver stiffness measurement （LSM）， controlled attenuation parameter （CAP）， and alpha-fetoprotein （AFP）， along with lower levels of high-density lipoprotein cholesterol （HDL-C）， compared with those with other syndrome types. Regarding ocular manifestations， the incidence of moon halo signs was significantly higher in patients with the blood stasis obstructing collaterals type than in those with other syndrome types. Additionally， the incidence in scleral zone 3 （corresponding to the large intestine） was higher in patients with the damp and heat accumulation type. ConclusionDampness and heat accumulation is the core syndrome type in patients with CHB complicated by MAFLD， commonly accompanied by spleen deficiency， liver depression， blood stasis， and Yin deficiency. A complex syndrome pattern characterized by a predominance of dampness and heat， along with a mixture of deficiency and excess， is formed. Different traditional Chinese medicine syndrome types are associated with distinct clinical indicators and ocular manifestation characteristics. Among them， patients with the dampness and heat accumulation type exhibit more pronounced metabolic disturbances and liver injury， whereas those with the blood stasis type show a higher incidence of moon halo signs. Abnormalities in scleral zone 3 are also more prevalent in patients with dampness and heat type.

The holistic view is the key in the study of traditional Chinese medicine(TCM). The component structure theory is based on the holistic view to investigate the correlation between material basis and efficiency, which enriches the holistic "component-effect" research of TCM. Gintonin is a newly isolated non-saponin component of ginseng. Compared to ginsenosides, gintonin has many different pharmacological activities, and it provides new knowledge for the holistic research of ginseng. Thus, taking the discovery of gintonin from ginseng as an example, this paper explored the linkage between ginsenosides and gintonin from the perspective of "component-effect" correlations and systematically sorted out the similarities and differences between them in terms of structural characteristics, modes of action, and pharmacological activities. Starting from the collaborative interaction of TCM compounds, the study discussed the application and value of the holistic view in TCM "component-effect" research in the light of the component structure theory to provide new thoughts for the development of modern TCM research.
Panax/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Medicine, Chinese Traditional ; Humans ; Ginsenosides/pharmacology* ; Animals

This study aims to investigate the ameliorating effect of Corni Fructus(CF) on the myocardial ischemic injury and the pharmacokinetic properties of characteristic components of CF. The mouse model of isoproterenol-induced myocardial ischemia was established and administrated with the aqueous extract of CF. The general efficacy of CF in ameliorating the myocardial ischemic injury was evaluated based on the cardiac histopathology and the levels of myocardial injury markers: creatine kinase isoenzyme(CK-MB) and cardiac troponin I(cTn-I). The metabolomics analysis was carried out for the heart and serum samples of mice to screen the biomarkers of CF in ameliorating the myocardial ischemic injury and then the predicted biomarkers were submitted to metabolic pathway enrichment. The pharmacokinetic analysis was performed for morroniside, loganin, and cornuside Ⅰ in mouse heart and serum samples to obtain the pharmacokinetic parameters of these components. The pharmacokinetic parameters were then integrated on the basis of self-defined weighting coefficients to simulate an integrated pharmacokinetic profile of CF iridoid glycosides in the heart and serum of the mouse model of myocardial ischemia. The results indicated that CF reduced the pathological damage to cardiac cells and tissue(hematoxylin-eosin staining) and lowered the levels of CK-MB and cTn-I in the serum of the mouse model of myocardial ischemia(P<0.01). Metabolomics analysis screed out 31 endogenous metabolites in the heart and 35 in the serum as biomarkers of CF in ameliorating the myocardial ischemic injury. These biomarkers were altered by modeling and restored by CF. Six metabolic pathways in the heart and 5 in the serum were enriched based on these metabolic markers. The main integrated pharmacokinetic parameters of CF iridoid glycosides were T_(max)=1 h, t_(1/2)=(1.52±0.05) h in the heart and T_(max)=1 h, t_(1/2)=(1.56±0.50) h in the serum. Both concentration-time curves showed a double-peak phenomenon. In conclusion, CF demonstrated the cardioprotective effect by regulating metabolic pathways such as taurine and hypotaurine metabolism, and pantothenic acid and coenzyme A biosynthesis. The integrated pharmacokinetics reflect the general pharmacokinetic properties of characteristic components in CF.
Animals ; Cornus/chemistry* ; Mice ; Metabolomics ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Myocardial Ischemia/metabolism* ; Humans ; Troponin I/metabolism* ; Myocardium/pathology* ; Disease Models, Animal ; Biomarkers/metabolism* ; Creatine Kinase, MB Form/metabolism*

The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To evaluate the early clinical efficacy and safety of trans-catheter aortic valve replacement (TAVR) for patients with severe pure native aortic regurgitation (PNAR) who are not suitable for conventional surgical aortic valve replace-ment. METHODS: A retrospective analysis was conducted on 48 patients with PNAR who underwent TAVR at the Department of Cardiac Surgery, the First Affiliated Hospital of Sun Yat-sen University between March 2019 and February 2025. These included 25 cases with transfemoral approach (TF-TAVR group) and 23 cases with transapical approach (TA-TAVR group). Efficacy and safety were assessed by analyzing baseline characteristics, all-cause mortality, and procedure-related complications. RESULTS: Compared with the TA-TAVR group, the TF-TAVR group exhibited significantly smaller aortic annulus circumference and diameter, left ventricular outflow tract circumference and diameter, diameters of the left, right, and non-coronary sinuses, and sinotubular junction (STJ) diameter, along with a shorter distance from the STJ to the aortic annular plane ring plane, a smaller annulus angle (all P<0.05). Additionally, the TF-TAVR group showed a deeper prosthesis implantation depth relative to the aortic annular plane (P<0.01). The overall technical success rate was 91.67%, and the device success rate was 83.33%. Post-TAVR, both groups demonstrated significant improvement in left ventricular end-diastolic diameter (both P<0.05), while only the TA-TAVR group showed significant reduction in left ventricular end-systolic diameter (P<0.05). For primary outcomes, in-hospital mortality occurred in 2 patients (4.17%). No additional deaths were reported at 60 or 90 d after surgery. During 90-180 d after surgery, one patient in the TF-TAVR group died of sudden cardiac death, and one in the TA-TAVR group died of gastroin-testinal bleeding. During 180 d-1 year after surgery, one patient in the TF-TAVR group died of low cardiac output syndrome. No statistically significant differences were observed in 1-year Kaplan-Meier survival curves between the two groups (P>0.05). No conduction block events occurred in TA-TAVR group during hospitalization or 1-year follow-up, while high-grade atrioventricular block, left bundle branch block, permanent pacemaker implantation occurred in TF-TAVR group during hospitalization (12.00%, 4.00%, and 12.00%, respectively). CONCLUSIONS TAVR demonstrates high feasibility and acceptable safety for severe PNAR patients who are not suitable for conventional SAVR. Both TF-TAVR and TA-TAVR show comparable early postoperative efficacy and safety profiles.
Humans ; Transcatheter Aortic Valve Replacement/adverse effects* ; Aortic Valve Insufficiency/surgery* ; Retrospective Studies ; Male ; Female ; Aged ; Treatment Outcome ; Aortic Valve/surgery* ; Aged, 80 and over ; Heart Valve Prosthesis