With the continuous development of new surgical technology, new equipment and new concepts, the research focused in the field of surgery is also in constant change. Among them, there are still confusion and controversies in the current clinical practice when facing the one-stop proposition of benefit population screening, advantageous surgical indication decision-making, surgical intervention timing selection, postoperative complication prediction and management. Therefore, our team tries to analyze whether the concept of"co-management of liver and pancreas"exists in clinical practice from the aspects of anatomy, physiology, histology and embryology of liver and pancreas, as well as the interaction between liver and pancreas, and explore the relationship between liver and pancreas in anatomy and tissue embryonic development, and the relationship between the concept of"co-management of liver and pancreas"and pancreatitis and pancreatic tumors as well as the concept of “co-management of liver and pancreas” applied in neoadjuvant chemoradiotherapy, and attempts to establish a new treatment pathway for pancreatic diseases based on this concept, in order to provide a new idea, new scheme and new possibility for the clinical research of pancreatic diseases and pancreatic surgery.

With the continuous development of new surgical technology, new equipment and new concepts, the research focused in the field of surgery is also in constant change. Among them, there are still confusion and controversies in the current clinical practice when facing the one-stop proposition of benefit population screening, advantageous surgical indication decision-making, surgical intervention timing selection, postoperative complication prediction and management. Therefore, our team tries to analyze whether the concept of"co-management of liver and pancreas"exists in clinical practice from the aspects of anatomy, physiology, histology and embryology of liver and pancreas, as well as the interaction between liver and pancreas, and explore the relationship between liver and pancreas in anatomy and tissue embryonic development, and the relationship between the concept of"co-management of liver and pancreas"and pancreatitis and pancreatic tumors as well as the concept of “co-management of liver and pancreas” applied in neoadjuvant chemoradiotherapy, and attempts to establish a new treatment pathway for pancreatic diseases based on this concept, in order to provide a new idea, new scheme and new possibility for the clinical research of pancreatic diseases and pancreatic surgery.

ObjectiveTo investigate the relationship between the vasodilation and hydrogen sulfide （H₂S） mechanism of total flavonoids of chrysanthemum （TFCC） and the large conductance Ca²⁺- activated K⁺ （BK_Ca） channels on vascular smooth muscle cells （VSMCs） of the middle cerebral artery in rats. In addition， this study will also investigate the effect of TFCC on the expression of BK_Ca channel alpha protein in rat middle cerebral artery VSMCs. MethodsThe primary method employed was acute digestion to isolate VSMCs from the middle cerebral artery of rats； whole-cell patch-clamp techniques were used to measure BK_Ca channel currents； primary tissue adherence culture was utilized to cultivate VSMCs from the middle cerebral artery of rats； Western blot were employed to determine protein expression levels. ResultsIn whole-cell patch-clamp experiments， both the H₂S donor NaHS （100 μmol/L） and endogenous H₂S enhanced BK_Ca channel currents. TFCC （30， 90， and 270 mg/L） also activatedBK_Ca channels and exhibited a certain concentration-dependent effect. Even after blocking endogenous H₂S production， TFCC （270 mg/L） still activated BK_Ca channels in VSMCs of the middle cerebral artery in rats. In Western blot experiments， the α-subunit of BK_Ca channel proteins was expressed in all groups of cells， but TFCC （30， 90， and 270 mg/L） and inhibitor IBTX group did not affect the expression of channel protein content.Conclusion TFCC can promote the opening of BK_Ca channels by promoting the generation of endogenous H₂S， or directly activate BK_Ca channels， thereby playing a role in relaxing cerebral blood vessels. However， TFCC had no significant effect on the expression of BK_Ca channel proteins.

AIM: To investigate the correlation between different severity grades of obstructive sleep apnea-hypopnea syndrome(OSAHS)and visual field defects as well asvisual evoked potential(VEP)parameters in patients with anterior ischemic optic neuropathy(AION). METHODS: A retrospective case-control study. Patients diagnosed with AION complicated by OSAHS at the Department of Ophthalmology, the Affiliated Xuzhou Municipal Hospital of Xuzhou Medical University, between June 2022 and October 2025 were selected as the study subjects. According to the AHI and mSaO2, the patients were divided into three groups: a mild group(AHI 5-15 events/h, mSaO2 85%-90%), moderate group(AHI 16-30 events/h, mSaO2 80%-85%), and severe group(AHI >30 events/h, mSaO2 <80%). General demographic data, retinal nerve fiber layer(RNFL)thickness, visual field defect indicators including mean defect(MD)and pattern standard deviation(PSD), as well as VEP parameters(P100 latency and amplitude)were compared among the three groups. RESULTS: This study included a total of 110 patients with AION complicated by OSAHS. Based on the severity of OSAHS, the patients were divided into a mild group of 37 patients(21 men and 16 women, mean age 62.15±9.37 y), a moderate group of 35 patients(20 men, 15 women; mean age 61.82±8.94 y), and a severe group of 38 patients(22 men, 16 women; mean age 63.02±9.61 y). There were no significant differences among the three groups in terms of age, sex, TG, TC, LDL-C, HDL-C levels, or AION severity(all P>0.05); however, there were significant differences in history of hypertension, history of diabetes, systolic blood pressure, diastolic blood pressure, and FPG levels(all P<0.05). The mean RNFL thickness in the severe group(63.27±5.58 μm)was significantly lower than that in the moderate group(74.14±6.28 μm)and the mild group(83.22±7.02 μm), and the moderate group was lower than the mild group(all P<0.05); The MD value(-11.57±1.82 dB)and PSD value(7.35±0.87 dB)in the severe group were both higher than those in the moderate group [(-7.62±1.31 dB),(4.89±0.62 dB)] and the mild group [(-4.38±1.05 dB),(2.57±0.45 dB)](all P<0.05); the P100 latency in the severe group(132.41±8.57 ms)was longer than that in the moderate group(118.75±7.32 ms)and the mild group(105.62±6.14 ms), and the amplitude(7.65±1.53 μV)was lower than that of the moderate group(11.24±1.89 μV)and the mild group(15.38±2.11 μV)(all P<0.05). Spearman's correlation analysis revealed that the severity of OSAHS was negatively correlated with the MD value(rs=-0.901, P<0.05)and positively correlated with the PSD value and P100 latency(rs=0.947, 0.807, P<0.05), and was negatively correlated with P100 amplitude(rs=-0.878, P<0.05). CONCLUSION:The severity of OSAHS is closely associated with RNFL thickness, visual field defects, and VEP parameters in patients with AION; the more severe the OSAHS, the more pronounced the structural and functional damage to the optic nerve. Monitoring AHI and mSaO2 can aid in assessing the condition of patients with AION and developing personalized intervention plans.

Cataract surgery is one of the most common ophthalmologic procedures. Advances in technology and medical policies have made it more precise. Residual refractive errors and deviation of target diopters are a main cause of dissatisfaction among patients. Refractive enhancement after cataract surgery can correct or eliminate these errors, improving patients' visual quality of life. There are multiple options for correcting residual refractive errors. The best approach depends on factors like the cause of the error, degrees of residual refractive errors, type of intraocular lens, ocular comorbidities, and patient preference. This paper summarizes the incidence and types of residual refractive errors, advancements in refractive enhancement surgeries, and provides practical solutions for clinical practice.

Objective:To analyze the risk factors for in-hospital malignant ventricular arrhythmia (MVA) in acute myocardial infarction (AMI) and to construct and validate a risk prediction model.Methods:This study was a retrospective cohort study. Patients aged≥18 years who were admitted to Qilu Hospital of Shandong University with a diagnosis of AMI and underwent coronary angiography (CAG) from May 2016 to March 2023 were selected, and the patients' clinical routine test indicators and CAG results were collected. Univariate and bidirectional stepwise logistic regression were used to screen out the risk factors for constructing the best prediction model. The prediction model was constructed by combining the results of multivariate logistic regression. The Hosmer-Lemeshow test and ROC curve, calibration curve, and decision curve were drawn to evaluate the model. The nomogram was drawn to visualize the model, and the Bootstrap self-sampling method was used for internal validation. The ROC curve was drawn to evaluate the predictive performance of each risk factor and prediction model. Finally, a multicollinearity test was performed.Results:Among the 4 205 patients finally included in the study, 115 patients (2.735%) developed MVA during hospitalization. The predictive factors screened out included age (X1), diastolic blood pressure (X2), respiratory rate (X3), blood glucose (X4), serum potassium (X5), logarithmic NT-proBNP (X6), myocardial infarction type (NSTEMI=X7, unclassified=X8), J wave (X9), Killip grade (Ⅱ=X10, Ⅲ=X11, Ⅳ=X12), and the regression equation was ln(p/1-p)=-4.699+0.029×X1-0.012×X2+0.059×X3+0.148×X4-1.175×X5+0.866×X6-1.427×X7-0.475×X8+0.758×X9+0.294×X10+0.902×X11+1.815×X12. The area under the ROC curve (AUC) of the model was 0.855 (95% CI: 0.816-0.894), and the Hosmer-Lemeshow test ( χ2=14.178, P=0.077) and the calibration curve showed that the predicted probability was consistent with the actual probability. The probability threshold of 0% to 65% had a better clinical net benefit. The area under the internal validation ROC curve (AUC) was 0.855, 95% CI: 0.813-0.891. The prediction performance of the nine variables was stronger than that of any single variable. There was no multicollinearity between the variables. Conclusions:Age, diastolic blood pressure, respiratory rate, blood glucose, serum potassium, NT-proBNP, type of AMI, J wave, and Killip class are forecasting indicator for in-hospital MVA in AMI. The risk prediction model based on the above factors has good predictive performance.

Enhanced recovery after surgery (ERAS) is a series of perioperative optimization measures based on evidence-based medicine aimed at achieving rapid recovery. Existing studies have shown that ERAS can effectively reduce surgical stress, decrease the incidence of complications, shorten hospital stays, save medical costs, and improve patient satisfaction. Although lung transplantation techniques have become increasingly mature, lung transplant recipients still have a high incidence of complications during perioperative period. To further improve the perioperative survival rate of lung transplant recipients, introducing ERAS concept into the perioperative management strategy of lung transplantation is of great significance for reducing incidence of perioperative complications, promoting rapid recovery and long-term survival of lung transplant recipients. This article discusses the advances in application of ERAS concept in the perioperative management of lung transplantation, aiming to provide references for optimizing the perioperative management of lung transplant recipients and reducing perioperative complications.

The inappropriate utilisation of the agricultural insecticide lambda-cyhalothrin (LCT) has the potential to result in residues that compromise food safety and human health. Respiratory exposure represents a major route of LCT contact in humans. Nevertheless, its deleterious effects on the respiratory system remain inadequately characterized. It is imperative to elucidate the potential relationship and mechanisms by which lung cancer, a significant malignant neoplasm of the respiratory system, is associated with exposure to LCT. The objective of this study is to utilise bioinformatics methodologies to screen and analyse the key target molecules affected by LCT in the occurrence of lung cancer, and their mechanisms of action. Specifically, network toxicology methods were employed to identify core targets of LCT-induced lung cancer. Subsequently, functional annotation to delineate associated cellular pathways, and finally, molecular docking to simulate binding modes between LCT and shared core targets. Core target screening identified 50 targets for large cell lung cancer, 54 for small cell lung cancer, 29 for lung squamous cell carcinoma, and 28 for lung adenocarcinoma, with EGFR, HSP90AA1, JUN, CCL2, MYC, CXCL8, and HSPA4 shared in all subtypes. Functional annotation revealed that LCT-triggered oncogenic pathways predominantly involved ubiquitination, chemotaxis, and tumor immune signaling. Molecular docking demonstrated spontaneous binding of LCT to core targets mediated by hydrogen bonds and π-cation interactions. These results establish a theoretical framework for evaluating LCT-associated risks of lung cancer and respiratory system damage.
Lung Neoplasms/metabolism* ; Pyrethrins/toxicity* ; Humans ; Insecticides/toxicity* ; Nitriles/toxicity* ; Molecular Docking Simulation

Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.