1.Epidemiological characteristics and spatial-temporal clustering of severe fever with thrombocytopenia syndrome in Huai'an City from 2011 to 2024
XIA Wenling ; GAO Qiang ; LI Yang ; CAI Ben ; WAN Chunyu ; CUI Zhizhen ; ZHANG Zheng ; PAN Enchun
Journal of Preventive Medicine 2026;38(1):55-59,65
Objective:
To investigate the epidemiological characteristics and spatial-temporal clustering of severe fever with thrombocytopenia syndrome (SFTS) in Huai'an City, Jiangsu Province from 2011 to 2024, so as to provide a basis for optimizing local SFTS prevention and control strategies, and identifying high-risk areas and key populations.
Methods:
Data on SFTS incidence and deaths in Huai'an City from 2011 to 2024 were collected from the Infectious Disease Reporting Information System of the Chinese Disease Prevention and Control Information System. The reported incidence, mortality, and fatality rates were calculated. Descriptive analysis was performed on temporal, population, and regional distribution. The average annual percent change (AAPC) was used to analyze the trend in the reported incidence of SFTS. Global and local spatial autocorrelation analyses were employed to examine the spatial distribution patterns and spatial association patterns of SFTS incidence while spatio-temporal scanning analyses was used to assess the spatial-temporal clustering of SFTS.
Results:
A total of 337 SFTS cases were reported in Huai'an City from 2011 to 2024, with the reported incidence rising from 0.17/100 000 to 1.88/100 000. There were 20 deaths, with an average annual mortality of 0.03/100 000, and a fatality rate of 5.93%. The incidence showed obvious seasonality, with a peak in May and June (148 cases, accounting for 43.92%). Spring and summer accounted for 107 cases (31.75%) and 159 cases (47.18%), respectively. The reported SFTS cases were mainly male, farmers, and individuals aged ≥41 years, accounting for 56.38%, 79.23%, and 96.74%, respectively. The population distribution of death cases was basically consistent with that of incident cases. Xuyi County was a high-incidence area, with a total of 332 reported cases, accounting for 98.52%. All death cases were reported in this county. Spatial autocorrelation analyses revealed a positive spatial correlation in SFTS incidence from 2019 to 2024, with Moran's I values ranging from 0.214 to 0.336 (all P<0.05). Heqiao Town, Tianquanhu Town, and Guiwu Town in Xuyi County were identified as high-high clustering areas. Spatio-temporal scanning analyses showed that cluster 1 was consistent with the high-high clustering areas, with an aggregation time from the second quarter of 2019 to the second quarter of 2022.
Conclusions
From 2011 to 2024, the reported incidence of SFTS in Huai'an City showed an upward trend, with a high incidence in spring and summer. Males, farmers, and the middle-aged and elderly population were the key populations for prevention and control. Xuyi County was the key area for prevention and control.
2.Lithium carbonate-induced distal renal tubular acidosis: a case report and literature review
Wenjun ZHANG ; Xixi ZHENG ; Wenling YE ; Limeng CHEN
Chinese Journal of Nephrology 2024;40(5):389-391
Antipsychotics, lithium preparations can cause a variety of renal side effects, most of which occur insidiously. The paper reports a 46-year-old female patient developing fatigue and soft paresis after taking lithium carbonate for 17 years. Laboratory tests showed hypokalemia, distal renal tubular acidosis (dRTA), and renal calculus. After discontinuation of lithium carbonate, partial remission of hypokalemia and dRTA were observed. Combined with literature review, in addition to dRTA, the renal side effects of lithium preparations also include acute toxic kidney injury, nephrogenic diabetes insipidus and various glomerulopathy.
3.Reliability of 4D flow cardiac MRI for measuring hemodynamic parameters of left ventricle
Lirong MA ; Jiaxuan GUO ; Wenling LI ; Li MA ; Yan ZHENG ; Huairong ZHANG ; Li ZHU
Chinese Journal of Medical Imaging Technology 2024;40(2):221-225
Objective To observe the reliability of regional 4D flow and whole heart 4D flow cardiac MRI(CMRI)for measuring hemodynamic parameters of left ventricle.Methods Heart ultrasonography and CMRI were prospectively obtained in 31 healthy subjects.Hemodynamic parameters of left ventricle were measured using heart ultrasound,3-chamber 4D flow CMRI(based on inflow and outflow channel of left ventricle)and whole heart 4D flow CMRI,respectively.Intra-class correlation coefficient(ICC)was performed to evaluate the consistencies of the measured left ventricle hemodynamic parameters among the above 3 methods.Results Good consistencies of peak systolic velocity in aortic supravalvular/subvalvular,E peak diastolic velocity of mitral valve,supravalvular/subvalvular aortic pressure and aortic valve pressure gradient(all ICC>0.75),while moderate consistency of A peak diastolic velocity of mitral valve(ICC=0.718)were found between heart ultrasound and 3-chamber 4D flow CMRI.Good consistencies of peak systolic velocity in aortic supravalvular/subvalvular,A peak diastolic velocity of mitral valve and supravalvular/subvalvular aortic pressure(all ICC>0.75),while moderate consistencies of E peak diastolic velocity of mitral valve and aortic valve pressure gradient(ICC=0.600,0.628)were found between heart ultrasound and whole heart 4D flow CMRI.Meanwhile,good consistencies of the above parameters were found between 3-chamber 4D flow CMRI and whole heart 4D flow CMRI(all ICC>0.75).Conclusion Measuring left ventricular hemodynamic parameters using local regional 4D flow and whole heart 4D flow CMRI were reliable,with good consistency with cardiac ultrasound.
4.Open surgical approach for two coincidental splenic artery aneurysms: a case report
World Journal of Emergency Medicine 2023;14(5):419-420
Several factors can contribute to the formation of aneurysms, including hemodynamic changes, polyarteritis nodosa, bacterial endocarditis, vasculitis, fibromuscular dysplasia, vascular malformation, and cystic medial necrosis.[1,2] Surgery is recommended for splenic artery aneurysms (SAAs) greater than 25 mm in diameter, and several surgical approaches are used, including open surgery, laparoscopic surgery, and percutaneous embolization. Laparoscopic surgery might be associated with an increased risk of pancreatic leakage compared to the open surgery approach. Open surgery without complete aneurysm resection should be preferred for patients with large SAAs in close contact with the pancreas. Here, we report a patient with two splenic artery aneurysms.
5.The effect of diabetes and prediabetes on the prevalence, complications and mortality in nonalcoholic fatty liver disease
Cheng Han NG ; Kai En CHAN ; Yip Han CHIN ; Rebecca Wenling ZENG ; Pei Chen TSAI ; Wen Hui LIM ; Darren Jun Hao TAN ; Chin Meng KHOO ; Lay Hoon GOH ; Zheng Jye LING ; Anand KULKARNI ; Lung-Yi Loey MAK ; Daniel Q HUANG ; Mark CHAN ; Nicholas WS CHEW ; Mohammad Shadab SIDDIQUI ; Arun J. SANYAL ; Mark MUTHIAH
Clinical and Molecular Hepatology 2022;28(3):565-574
Background/Aims:
Nonalcoholic fatty liver disease (NAFLD) is closely associated with diabetes. The cumulative impact of both diseases synergistically increases risk of adverse events. However, present population analysis is predominantly conducted with reference to non-NAFLD individuals and has not yet examined the impact of prediabetes. Hence, we sought to conduct a retrospective analysis on the impact of diabetic status in NAFLD patients, referencing non-diabetic NAFLD individuals.
Methods:
Data from the National Health and Nutrition Examination Survey 1999–2018 was used. Hepatic steatosis was defined with United States Fatty Liver Index (US-FLI) and FLI at a cut-off of 30 and 60 respectively, in absence of substantial alcohol use. A multivariate generalized linear model was used for risk ratios of binary outcomes while survival analysis was conducted with Cox regression and Fine Gray model for competing risk.
Results:
Of 32,234 patients, 28.92% were identified to have NAFLD. 36.04%, 38.32% and 25.63% were non-diabetic, prediabetic and diabetic respectively. Diabetic NAFLD significantly increased risk of cardiovascular disease (CVD), stroke, chronic kidney disease, all-cause and CVD mortality compared to non-diabetic NAFLD. However, prediabetic NAFLD only significantly increased the risk of CVD and did not result in a higher risk of mortality.
Conclusions
Given the increased risk of adverse outcomes, this study highlights the importance of regular diabetes screening in NAFLD and adoption of prompt lifestyle modifications to reduce disease progression. Facing high cardiovascular burden, prediabetic and diabetic NAFLD individuals can benefit from early cardiovascular referrals to reduce risk of CVD events and mortality.
6.Molecular mechanism of Ganoderma against gastric cancer based on network pharmacology and experimental test.
Jia-Yi ZHONG ; Hai-Bing CHEN ; Da-Zeng YE ; Zheng-Jun DENG ; Jia-Jia SHAO ; Jia-Wei HAN ; Jun-Hui YUAN ; Nian-Ying DENG
China Journal of Chinese Materia Medica 2022;47(1):203-223
This study aims to explore the molecular mechanism of Ganoderma against gastric cancer based on network pharmacology, molecular docking, and cell experiment. The active components and targets of Ganoderma were retrieved from Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform(TCMSP), and gastric cancer-related targets from GeneCards and Online Mendelian Inheritance in Man(OMIM). The protein-protein interaction(PPI) network of the common targets was constructed with STRING, followed by Gene Ontology(GO) term enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis of the common genes based on Bioconductor and R language. The medicinal-disease-component-target network and medicinal-disease-component-target-pathway network were established by Cytoscape. Molecular docking was performed between β-sitosterol(the key component in Ganoderma) and the top 15 targets in the PPI network. Cell experiment was performed to verify the findings. A total of 14 active components and 28 targets of Ganoderma were retrieved, and the medicinal and the disease shared 25 targets, including caspase-3(CASP3), caspase-8(CASP8), caspase-9(CASP9), and B-cell lymphoma-2(BCL2). The common targets involved 72 signaling pathways and apoptosis and p53 signaling pathway may play a crucial role in the effect of Ganoderma against gastric cancer. β-sitosterol had strong binding activity to the top 15 targets in the PPI network. The in vitro cell experiment demonstrated that β-sitosterol inhibited gastric cancer AGS cell proliferation by inducing cell apoptosis and cell cycle arrest in the S phase, which might be related to the regulation of the p53 pathway. This study shows the multi-component, multi-target, and multi-pathway characteristics of Ganoderma against gastric cancer, which lays a scientific basis for further research on the molecular mechanism.
Ganoderma
;
Humans
;
Medicine, Chinese Traditional
;
Molecular Docking Simulation
;
Network Pharmacology
;
Stomach Neoplasms/genetics*
7.Kimura disease with renal impairment: case series and literature review
Rongrong HU ; Lei ZHANG ; Jie MA ; Cai YUE ; Yubing WEN ; Wei YE ; Wenling YE ; Ke ZHENG ; Yan QIN ; Limeng CHEN ; Xuemei LI
Chinese Journal of Nephrology 2022;38(3):196-202
Objective:To analyze the clinical and pathological characteristics, treatment and prognosis of renal changes in patients with Kimura disease and improve the clinicians′ understanding on renal manifestations of Kimura disease.Methods:The clinical data of Kimura disease patients with definite diagnosis and detailed data in Peking Union Medical College Hospital from January 1980 to August 2020 were retrospectively analyzed. The patients were divided into renal impairment group and non-renal impairment group according to whether the kidney was involved or not and the related clinical data between the two groups were compared. The patients presenting with nephrotic syndrome were followed up.Results:There were 60 patients with Kimura disease confirmed by pathological diagnosis with 48 males. The median age was 33(3, 62) years old, and the median duration was 36(12, 111) months. There were 18 cases complicated with renal injury in 49 patients with complete routine urine and renal function examination and the main manifestations of renal injury were proteinuria and/or microscopic hematuria. There was no significant difference at age, sex and absolute value of eosinophils between the two groups (all P>0.05). Compared with the renal inpairment group, patients in non-renal inpairment group had longer course of disease, higher levels of hypersensitive C-reactive protein and erythrocyte sedimentation rate, and lower median values of total eosinophils and total IgE, but there was no statistically significant difference (all P>0.05). Among the patients with renal involvement, 6 patients met the diagnostic criteria for nephrotic syndrome, and 5 of them completed renal biopsies. The renal pathological diagnosis was membranous nephropathy in 2 cases and minimal change disease in 3 cases, and no interstitial eosinophil infiltration was found in renal biopsy tissues. These patients had a good response to glucocorticoids and/or immunosuppressive therapy, and achieved complete remission of nephrotic syndrome; at the same time, lymphadenopathy caused by Kimura disease could be well controlled. Conclusions:Kimura disease can combine with various renal lesions, and the pathology of nephrotic syndrome can be membranous nephropathy or minimal change nephropathy. After energetic treatment of glucocorticoids and/or immunosuppressive therapy, nephrotic syndrome can be completely relieved, and lymphadenopathy can be well controlled. The relationship between Kimura disease and renal disease needs further study.
8.A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis.
Shuhong ZHENG ; Hairui CHEN ; Miaojun MO
Chinese Journal of Medical Genetics 2021;38(7):671-673
OBJECTIVE:
To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS:
High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS:
The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION
The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics*
;
Child
;
Developmental Disabilities
;
Female
;
Humans
;
Mutation
;
Retrospective Studies
;
Syndrome
;
Transcription Factors/genetics*
9.Advance on the infectivity of SARS-CoV-2 infection at different stages
Xiaokun YANG ; Yu LI ; Hongting ZHAO ; Zhili LI ; Mengjie GENG ; Wenling WANG ; Ying QIN ; Jianxing YU ; Zhibin PENG ; Wenjie TAN ; Jiandong ZHENG ; Zhongjie LI ; Zijian FENG
Chinese Journal of Epidemiology 2021;42(1):33-38
The studies on infectiousness of person infected with SARS-CoV-2 at different stages of illness are an important basis for making effective prevention and control measures such as investigating the infectious source, determining the scope of close contacts and the timing of case isolation. This review discusses the infectiousness of cases infected with SARS-CoV-2 in the incubation period, symptomatic period and convalescent period by reviewing national and international literatures, technical and professional guidelines. Existing researches suggest that the infectious viruses could be isolated at the end of the incubation period as well as since illness onset, and viral load in upper respiratory tract swabs reached the peak on day 4-6 after illness onset and thereafter began to decline, implying the infectiousness was relatively strong at the end of incubation period and within one week after illness onset. Although there were a few cases who tested positive for SARS-CoV-2 after recovery, no evidence was found to indicate these cases can cause the transmission.
10.Anlotinib-induced renal thrombotic microangiopathy
Yueyi ZHANG ; Wenling YE ; Mingxi LI ; Wei YE ; Yubing WEN ; Ke ZHENG ; Xuemei LI ; Sanxi AI
Adverse Drug Reactions Journal 2021;23(9):497-499
A 64-year-old female patient received postoperative adjuvant chemotherapy with oxaliplatin and capecitabine after radical resection of rectal cancer for rectal adenocarcinoma with multiple lung metastases. Due to poor therapeutic effect, the patient was switched to anlotinib treatment at a dose of 12 mg/d orally for 2 weeks with a 1-week break and 3 weeks was one cycle. During the second cycle of anlotinib treatment, the patient developed edema, proteinuria, hypertension, and hypoalbuminemia, with normal serum creatinine. The renal pathology suggested renal thrombotic microangiopathy, which was in line with the clinical and pathological manifestations of drug-related renal injury due to anti-vascular endothelial growth factor. After discontinuation of anlotinib and receiving symptomatic treatment such as blood pressure control, the edema gradually subsided along with remission of proteinuria. Three months later, the patient had no proteinuria and the serum albumin was normal.


Result Analysis
Print
Save
E-mail