1.Reliability of 4D flow cardiac MRI for measuring hemodynamic parameters of left ventricle
Lirong MA ; Jiaxuan GUO ; Wenling LI ; Li MA ; Yan ZHENG ; Huairong ZHANG ; Li ZHU
Chinese Journal of Medical Imaging Technology 2024;40(2):221-225
Objective To observe the reliability of regional 4D flow and whole heart 4D flow cardiac MRI(CMRI)for measuring hemodynamic parameters of left ventricle.Methods Heart ultrasonography and CMRI were prospectively obtained in 31 healthy subjects.Hemodynamic parameters of left ventricle were measured using heart ultrasound,3-chamber 4D flow CMRI(based on inflow and outflow channel of left ventricle)and whole heart 4D flow CMRI,respectively.Intra-class correlation coefficient(ICC)was performed to evaluate the consistencies of the measured left ventricle hemodynamic parameters among the above 3 methods.Results Good consistencies of peak systolic velocity in aortic supravalvular/subvalvular,E peak diastolic velocity of mitral valve,supravalvular/subvalvular aortic pressure and aortic valve pressure gradient(all ICC>0.75),while moderate consistency of A peak diastolic velocity of mitral valve(ICC=0.718)were found between heart ultrasound and 3-chamber 4D flow CMRI.Good consistencies of peak systolic velocity in aortic supravalvular/subvalvular,A peak diastolic velocity of mitral valve and supravalvular/subvalvular aortic pressure(all ICC>0.75),while moderate consistencies of E peak diastolic velocity of mitral valve and aortic valve pressure gradient(ICC=0.600,0.628)were found between heart ultrasound and whole heart 4D flow CMRI.Meanwhile,good consistencies of the above parameters were found between 3-chamber 4D flow CMRI and whole heart 4D flow CMRI(all ICC>0.75).Conclusion Measuring left ventricular hemodynamic parameters using local regional 4D flow and whole heart 4D flow CMRI were reliable,with good consistency with cardiac ultrasound.
2.Lithium carbonate-induced distal renal tubular acidosis: a case report and literature review
Wenjun ZHANG ; Xixi ZHENG ; Wenling YE ; Limeng CHEN
Chinese Journal of Nephrology 2024;40(5):389-391
Antipsychotics, lithium preparations can cause a variety of renal side effects, most of which occur insidiously. The paper reports a 46-year-old female patient developing fatigue and soft paresis after taking lithium carbonate for 17 years. Laboratory tests showed hypokalemia, distal renal tubular acidosis (dRTA), and renal calculus. After discontinuation of lithium carbonate, partial remission of hypokalemia and dRTA were observed. Combined with literature review, in addition to dRTA, the renal side effects of lithium preparations also include acute toxic kidney injury, nephrogenic diabetes insipidus and various glomerulopathy.
3.Open surgical approach for two coincidental splenic artery aneurysms: a case report
World Journal of Emergency Medicine 2023;14(5):419-420
Several factors can contribute to the formation of aneurysms, including hemodynamic changes, polyarteritis nodosa, bacterial endocarditis, vasculitis, fibromuscular dysplasia, vascular malformation, and cystic medial necrosis.[1,2] Surgery is recommended for splenic artery aneurysms (SAAs) greater than 25 mm in diameter, and several surgical approaches are used, including open surgery, laparoscopic surgery, and percutaneous embolization. Laparoscopic surgery might be associated with an increased risk of pancreatic leakage compared to the open surgery approach. Open surgery without complete aneurysm resection should be preferred for patients with large SAAs in close contact with the pancreas. Here, we report a patient with two splenic artery aneurysms.
4.Molecular mechanism of Ganoderma against gastric cancer based on network pharmacology and experimental test.
Jia-Yi ZHONG ; Hai-Bing CHEN ; Da-Zeng YE ; Zheng-Jun DENG ; Jia-Jia SHAO ; Jia-Wei HAN ; Jun-Hui YUAN ; Nian-Ying DENG
China Journal of Chinese Materia Medica 2022;47(1):203-223
This study aims to explore the molecular mechanism of Ganoderma against gastric cancer based on network pharmacology, molecular docking, and cell experiment. The active components and targets of Ganoderma were retrieved from Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform(TCMSP), and gastric cancer-related targets from GeneCards and Online Mendelian Inheritance in Man(OMIM). The protein-protein interaction(PPI) network of the common targets was constructed with STRING, followed by Gene Ontology(GO) term enrichment and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis of the common genes based on Bioconductor and R language. The medicinal-disease-component-target network and medicinal-disease-component-target-pathway network were established by Cytoscape. Molecular docking was performed between β-sitosterol(the key component in Ganoderma) and the top 15 targets in the PPI network. Cell experiment was performed to verify the findings. A total of 14 active components and 28 targets of Ganoderma were retrieved, and the medicinal and the disease shared 25 targets, including caspase-3(CASP3), caspase-8(CASP8), caspase-9(CASP9), and B-cell lymphoma-2(BCL2). The common targets involved 72 signaling pathways and apoptosis and p53 signaling pathway may play a crucial role in the effect of Ganoderma against gastric cancer. β-sitosterol had strong binding activity to the top 15 targets in the PPI network. The in vitro cell experiment demonstrated that β-sitosterol inhibited gastric cancer AGS cell proliferation by inducing cell apoptosis and cell cycle arrest in the S phase, which might be related to the regulation of the p53 pathway. This study shows the multi-component, multi-target, and multi-pathway characteristics of Ganoderma against gastric cancer, which lays a scientific basis for further research on the molecular mechanism.
Ganoderma
;
Humans
;
Medicine, Chinese Traditional
;
Molecular Docking Simulation
;
Network Pharmacology
;
Stomach Neoplasms/genetics*
5.Kimura disease with renal impairment: case series and literature review
Rongrong HU ; Lei ZHANG ; Jie MA ; Cai YUE ; Yubing WEN ; Wei YE ; Wenling YE ; Ke ZHENG ; Yan QIN ; Limeng CHEN ; Xuemei LI
Chinese Journal of Nephrology 2022;38(3):196-202
Objective:To analyze the clinical and pathological characteristics, treatment and prognosis of renal changes in patients with Kimura disease and improve the clinicians′ understanding on renal manifestations of Kimura disease.Methods:The clinical data of Kimura disease patients with definite diagnosis and detailed data in Peking Union Medical College Hospital from January 1980 to August 2020 were retrospectively analyzed. The patients were divided into renal impairment group and non-renal impairment group according to whether the kidney was involved or not and the related clinical data between the two groups were compared. The patients presenting with nephrotic syndrome were followed up.Results:There were 60 patients with Kimura disease confirmed by pathological diagnosis with 48 males. The median age was 33(3, 62) years old, and the median duration was 36(12, 111) months. There were 18 cases complicated with renal injury in 49 patients with complete routine urine and renal function examination and the main manifestations of renal injury were proteinuria and/or microscopic hematuria. There was no significant difference at age, sex and absolute value of eosinophils between the two groups (all P>0.05). Compared with the renal inpairment group, patients in non-renal inpairment group had longer course of disease, higher levels of hypersensitive C-reactive protein and erythrocyte sedimentation rate, and lower median values of total eosinophils and total IgE, but there was no statistically significant difference (all P>0.05). Among the patients with renal involvement, 6 patients met the diagnostic criteria for nephrotic syndrome, and 5 of them completed renal biopsies. The renal pathological diagnosis was membranous nephropathy in 2 cases and minimal change disease in 3 cases, and no interstitial eosinophil infiltration was found in renal biopsy tissues. These patients had a good response to glucocorticoids and/or immunosuppressive therapy, and achieved complete remission of nephrotic syndrome; at the same time, lymphadenopathy caused by Kimura disease could be well controlled. Conclusions:Kimura disease can combine with various renal lesions, and the pathology of nephrotic syndrome can be membranous nephropathy or minimal change nephropathy. After energetic treatment of glucocorticoids and/or immunosuppressive therapy, nephrotic syndrome can be completely relieved, and lymphadenopathy can be well controlled. The relationship between Kimura disease and renal disease needs further study.
6.The effect of diabetes and prediabetes on the prevalence, complications and mortality in nonalcoholic fatty liver disease
Cheng Han NG ; Kai En CHAN ; Yip Han CHIN ; Rebecca Wenling ZENG ; Pei Chen TSAI ; Wen Hui LIM ; Darren Jun Hao TAN ; Chin Meng KHOO ; Lay Hoon GOH ; Zheng Jye LING ; Anand KULKARNI ; Lung-Yi Loey MAK ; Daniel Q HUANG ; Mark CHAN ; Nicholas WS CHEW ; Mohammad Shadab SIDDIQUI ; Arun J. SANYAL ; Mark MUTHIAH
Clinical and Molecular Hepatology 2022;28(3):565-574
Background/Aims:
Nonalcoholic fatty liver disease (NAFLD) is closely associated with diabetes. The cumulative impact of both diseases synergistically increases risk of adverse events. However, present population analysis is predominantly conducted with reference to non-NAFLD individuals and has not yet examined the impact of prediabetes. Hence, we sought to conduct a retrospective analysis on the impact of diabetic status in NAFLD patients, referencing non-diabetic NAFLD individuals.
Methods:
Data from the National Health and Nutrition Examination Survey 1999–2018 was used. Hepatic steatosis was defined with United States Fatty Liver Index (US-FLI) and FLI at a cut-off of 30 and 60 respectively, in absence of substantial alcohol use. A multivariate generalized linear model was used for risk ratios of binary outcomes while survival analysis was conducted with Cox regression and Fine Gray model for competing risk.
Results:
Of 32,234 patients, 28.92% were identified to have NAFLD. 36.04%, 38.32% and 25.63% were non-diabetic, prediabetic and diabetic respectively. Diabetic NAFLD significantly increased risk of cardiovascular disease (CVD), stroke, chronic kidney disease, all-cause and CVD mortality compared to non-diabetic NAFLD. However, prediabetic NAFLD only significantly increased the risk of CVD and did not result in a higher risk of mortality.
Conclusions
Given the increased risk of adverse outcomes, this study highlights the importance of regular diabetes screening in NAFLD and adoption of prompt lifestyle modifications to reduce disease progression. Facing high cardiovascular burden, prediabetic and diabetic NAFLD individuals can benefit from early cardiovascular referrals to reduce risk of CVD events and mortality.
7.A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis.
Shuhong ZHENG ; Hairui CHEN ; Miaojun MO
Chinese Journal of Medical Genetics 2021;38(7):671-673
OBJECTIVE:
To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.
METHODS:
High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.
RESULTS:
The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.
CONCLUSION
The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Autistic Disorder/genetics*
;
Child
;
Developmental Disabilities
;
Female
;
Humans
;
Mutation
;
Retrospective Studies
;
Syndrome
;
Transcription Factors/genetics*
8.Advance on the infectivity of SARS-CoV-2 infection at different stages
Xiaokun YANG ; Yu LI ; Hongting ZHAO ; Zhili LI ; Mengjie GENG ; Wenling WANG ; Ying QIN ; Jianxing YU ; Zhibin PENG ; Wenjie TAN ; Jiandong ZHENG ; Zhongjie LI ; Zijian FENG
Chinese Journal of Epidemiology 2021;42(1):33-38
The studies on infectiousness of person infected with SARS-CoV-2 at different stages of illness are an important basis for making effective prevention and control measures such as investigating the infectious source, determining the scope of close contacts and the timing of case isolation. This review discusses the infectiousness of cases infected with SARS-CoV-2 in the incubation period, symptomatic period and convalescent period by reviewing national and international literatures, technical and professional guidelines. Existing researches suggest that the infectious viruses could be isolated at the end of the incubation period as well as since illness onset, and viral load in upper respiratory tract swabs reached the peak on day 4-6 after illness onset and thereafter began to decline, implying the infectiousness was relatively strong at the end of incubation period and within one week after illness onset. Although there were a few cases who tested positive for SARS-CoV-2 after recovery, no evidence was found to indicate these cases can cause the transmission.
9.The correlation between blood pressure response to cold pressor test and long-term blood pressure changes
Tongshuai GUO ; Chao CHU ; Wenling ZHENG ; Jiawen HU ; Jianjun MU
Chinese Journal of Internal Medicine 2020;59(4):286-291
Objective:The aim of the study was to investigate the correlation between blood pressure response to cold pressor test (CPT) and follow-up blood pressure after 8 years in subjects, and to evaluate the predictive value of CPT for long-term blood pressure levels.Methods:A total of 365 individuals from eight natural villages were enrolled by stratified cluster sampling from Mei County, Shaanxi Province in 2004. Baseline characteristics of subjects were collected and CPTs were conducted. Subjects were followed up in 2009 and 2012, respectively. According to the maximal change of systolic response (SR), the area under the curve (AUC) of systolic blood pressure change (AUC-SBP), the maximal change of diastolic response (DR) and the AUC of diastolic blood pressure change (AUC-DBP) in CPT, the individuals were divided into four quartile groups by above parameters, respectively: group Ⅰ ( P25), group Ⅱ ( P50), group Ⅲ ( P75) and group Ⅳ ( P100). The correlation between blood pressure response to CPT and the follow-up blood pressure was analyzed. Results:(1) There were no significant differences in baseline blood pressure levels and prevalence of hypertension among four quartile groups no matter it was grouped on SR, DR, AUC-SBP or AUC-DBP. (2) The prevalence of hypertension in each group from lowest ( P25) to highest ( P100) in 2012 was 25.64%, 30.67%, 38.03%, 55.74% on SR grouping ( P<0.01), and 27.5%, 29.17%, 38.46%, 57.35% on AUC-SBP grouping ( P<0.05), respectively. (3) There were no significant differences in the prevalence of hypertension among four groups in 2012 ( P>0.05) either on DR or on AUC-DBP grouping. (4) The random effects model analysis showed that the correlation coefficient between SR, AUC-SBP and long-term systolic blood pressure increase were 1.91 ( P<0.05) and 1.44 ( P<0.05), respectively, and the correlation coefficient between DR, AUC-DBP and long-term diastolic blood pressure increase were 0.82 ( P<0.05) and 0.78 ( P>0.05), respectively. Age, male, body mass index, and fasting blood glucose were independent risk factors for long-term blood pressure elevation, and age, body mass index and fasting blood glucose positively correlated with changes in long-term blood pressure (all P<0.05). Conclusion:Individual systolic blood pressure response to CPT can be used as a predictor of long-term hypertension.
10. Early antiviral therapy of abidor combined with lopinavir/ritonavir and re-combinant interferonα-2b in patients with novel coronavirus pneumonia in Zhejiang: A multicenter and prospective study
Runan WEI ; Nanhong ZHENG ; Xiangao JIANG ; Chunlian MA ; Xiaowei XU ; Shourong LIU ; Yongping CHEN ; Kaijin XU ; Hainv GAO ; Jiansheng ZHU ; Qiang SHU ; Jifang SHENG ; Xiaoqiang ZHANG ; Minghui LI ; Yan ZHANG ; Mengjie MA ; Xuan ZHANG ; Shibo LI ; Qiujing WANG ; Lingjun YING ; Yongjun ZHANG ; Yunzhen SHI ; Lingyan FAN ; Wanjun YU ; Huaying WANG ; Dandan SUN ; Xiaodong WANG ; Jichan SHI ; Yinghu CHEN ; Xinsheng XIE ; Yunqing CHEN ; Weihong WANG ; Zhaowei TONG ; Lingling TANG ; Mengfei ZHU ; Lingjian ZHANG ; Lanjuan LI
Chinese Journal of Clinical Infectious Diseases 2020;13(0):E010-E010
Objective:
Comparing the benefit of Abidor, lopinavir/ritonavir and recombinant interferon α-2b triple combination antiviral therapy and lopinavir/ritonavir and interferon dual combination antiviral therapy to hospitalized novel coronavirus pneumonia 2019 in Zhejiang province.
Methods:
A multi-center prospective study was carried out to compare the effect of triple combination antiviral therapy with dual combination antiviral therapy in 15 medical institutions of Zhejiang Province. All patients were treated with recombinant interferon α-2b (5 million U, 2 times/d) aerosol inhalation. 196 patients were treated with abidol (200 mg, 3 times/d) + lopinavir / ritonavir (2 tablets, 1 time/12 h) as the triple combination antiviral treatment group. 41 patients were treated with lopinavir / ritonavir (2 tablets, 1 time/12 h) as the dual combination antiviral treatment group. The patients who received triple combination antiviral therapy were divided into three groups: within 48 hours, 3-5 days and > 5 days after the symptom onset. To explore the therapeutic effects of triple combination antiviral drugs and dual combination antiviral drugs, as well as triple combination antiviral drugs with different antiviral initiate time. SPSS17.0 software was used to analyze the data.
Results:
The time of virus nucleic acid turning negative was (12.2 ± 4.7) days in the triple combination antiviral drug group, which was shorter than that in the dual combination antiviral drug group [(15.0 ± 5.0) days] (


Result Analysis
Print
Save
E-mail