1.Impact of portal vein tumor thrombus classification on rebleeding in hepatocellular carcinoma patients with esophagogastric variceal bleeding
Jiali MA ; Xiaohui YE ; Hongshan WEI ; Ping LI ; Xiuxia LIANG
Journal of Clinical Hepatology 2026;42(5):1101-1108
ObjectiveTo investigate the impact of portal vein tumor thrombus (PVTT) classification on rebleeding in hepatocellular carcinoma (HCC) patients with different PVTT subtypes and esophagogastric variceal bleeding (EGVB), and to provide a reference for formulating rational treatment regimens for such patients. MethodsA retrospective study was performed for 130 patients with HCC and PVTT who were treated due to EGVB in Beijing Ditan Hospital, Capital Medical University, from July 2020 to January 2025, and according to whether endoscopic treatment was performed, the patients were divided into endoscopic treatment group with 97 patients and conservative treatment group with 33 patients. Demographic and clinical data were collected from all patients, and the two groups were compared in terms of hemostasis success rate and rebleeding rate. The independent-samples t test was used for comparison of normally distributed continuous data between groups, and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups; the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to estimate the cumulative incidence rate of rebleeding in patients with different subtypes of PVTT. Propensity score matching (PSM) was performed for the endoscopic treatment group and the conservative treatment group to balance the baseline data of the two groups. The Cox proportional hazards model was used to perform univariate and multivariate analyses and identify independent risk factors for rebleeding. ResultsThe endoscopic treatment group had a significantly lower cumulative rebleeding rate within 6 months than the conservative treatment group (35.1% vs 57.6%, hazard ratio [HR]=0.480, 95% confidence interval [CI]: 0.272—0.851, P=0.019). The PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate within 6 months than the PVTT Ⅱ group (52.2% vs 37.5%, HR=1.744, 95%CI: 1.008 — 3.018, P=0.022). After PSM, there was no significant difference in rebleeding rate between the endoscopic treatment group and the conservative treatment group (38.1% vs 14.3%,HR=1.500,95%CI:0.125 — 2.002, P=0.588), while the PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate than the PVTT Ⅱ group (58.8% vs 12.5%,HR=1.561,95%CI:1.195 — 12.499,P=0.033). The multivariate Cox regression analysis showed that PVTT subtype (HR=1.412, 95%CI: 0.998 — 1.997, P=0.049), platelet count (HR=1.006, 95%CI: 1.001 — 1.010, P=0.021), C-reactive protein (HR=1.011, 95%CI: 1.001 — 1.021, P=0.026), and ascites (HR=1.803, 95%CI: 1.059 — 3.068, P=0.030) were independent risk factors for rebleeding. ConclusionFor HCC patients with PVTT and EGVB, endoscopic treatment can successfully achieve hemostasis, while it fails to significantly reduce rebleeding rates. PVTT classification can affect the risk of rebleeding, and patients with PVTT types Ⅲ—Ⅳ have a relatively high rebleeding rate.
2.Comparison of the clinical efficacy in staged open reduction internal fixation and external fixation combined with limited internal fixation for the treatment of high-energy tibial Pilon fracture.
Wei-Qing CHEN ; Ye-Hai CHEN ; Jun-Rong SHU ; Bao-Ping XU ; Bao-Lin CHEN ; Jun-Tao YANG ; Xiu-Po HU
China Journal of Orthopaedics and Traumatology 2025;38(7):716-721
OBJECTIVE:
To compare the clinical efficacy and complication rates of staged open reduction internal fixation (ORIF) and external fixation combined with limited internal fixation (EFLIF) in the treatment of high-energy Pilon fractures.
METHODS:
A retrospective selection was conducted on 78 patients diagnosed with high-energy tibial Pilon fractures who received treatment between January 2021 and October 2023. These patients were categorized into the staged ORIF group and the EFLIF group according to their respective treatment protocols. The staged ORIF group comprised 48 patients, including 29 males and 19 females, aged from 33 to 53 years old with a mean age of (43.25±4.67) years old. The time from injury to treatment averaged (6.54±2.21) hours. All patients received staged ORIF treatment. The EFLIF Group consisted of 30 patients, including 18 males and 12 females, aged from 36 to 54 years old with a mean age of (43.37±3.24) years old. The time from injury to treatment averaged (6.87±1.96) hours. All patients received EFLIF treatment. The recovery of ankle joint function, fracture reduction quality, fracture healing time, and surgical-related indicators between two groups were observed and compared six months after surgery. Additionally, the postoperative complications of the two groups were recorded.
RESULTS:
Both groups of patients were followed up and the duration ranged from 6 to 12 months, with an average of (8.97±1.26) months. At 6-month postoperative follow-up, the American Orthopaedic Foot and Ankle Society (AOFAS) score in the ORIF group was (83.15±20.93), which did not show a statistically significant difference compared to the EFLIF group (81.88±20.67), P>0.05. The excellent and good rate of fracture reduction in the staged ORIF group was 33.33% (16/48), which did not show a statistically significant difference compared to the EFLIF group (30.00%, 9/30), P>0.05. The hospitalization duration and fracture healing time in the staged ORIF group were (16.57±1.25) days and (12.14±1.15) weeks, respectively. When compared to the EFLIF group, which demonstrated a hospitalization duration of (15.97±2.16 ) days and a fracture healing time of (12.36±1.17) weeks, no statistically significant differences were observed (P>0.05). The intraoperative blood loss in the staged ORIF group was (76.54±11.65) ml, which was significantly higher than that in the EFLIF group (70.15±10.29) ml, and the difference was statistically significant (P<0.05). The incidence of superficial tissue infection was 2.08%(1/48), which was significantly lower than that observed in the EFLIF group at 16.67% (5/30), and this difference was statistically significant (P<0.05).
CONCLUSION
Both staged ORIF and EFLIF were effective treatment options for high-energy closed Pilon fractures of the tibia. However, regarding the prevention of superficial tissue infection, staged ORIF demonstrates superior risk control compared to EFLIF.
Humans
;
Male
;
Female
;
Middle Aged
;
Adult
;
Tibial Fractures/physiopathology*
;
Fracture Fixation, Internal/methods*
;
Retrospective Studies
;
External Fixators
;
Open Fracture Reduction/methods*
;
Treatment Outcome
3.Explainable machine learning model for predicting septic shock in critically sepsis patients based on coagulation indexes: A multicenter cohort study.
Qing-Bo ZENG ; En-Lan PENG ; Ye ZHOU ; Qing-Wei LIN ; Lin-Cui ZHONG ; Long-Ping HE ; Nian-Qing ZHANG ; Jing-Chun SONG
Chinese Journal of Traumatology 2025;28(6):404-411
PURPOSE:
Septic shock is associated with high mortality and poor outcomes among sepsis patients with coagulopathy. Although traditional statistical methods or machine learning (ML) algorithms have been proposed to predict septic shock, these potential approaches have never been systematically compared. The present work aimed to develop and compare models to predict septic shock among patients with sepsis.
METHODS:
It is a retrospective cohort study based on 484 patients with sepsis who were admitted to our intensive care units between May 2018 and November 2022. Patients from the 908th Hospital of Chinese PLA Logistical Support Force and Nanchang Hongdu Hospital of Traditional Chinese Medicine were respectively allocated to training (n=311) and validation (n=173) sets. All clinical and laboratory data of sepsis patients characterized by comprehensive coagulation indexes were collected. We developed 5 models based on ML algorithms and 1 model based on a traditional statistical method to predict septic shock in the training cohort. The performance of all models was assessed using the area under the receiver operating characteristic curve and calibration plots. Decision curve analysis was used to evaluate the net benefit of the models. The validation set was applied to verify the predictive accuracy of the models. This study also used Shapley additive explanations method to assess variable importance and explain the prediction made by a ML algorithm.
RESULTS:
Among all patients, 37.2% experienced septic shock. The characteristic curves of the 6 models ranged from 0.833 to 0.962 and 0.630 to 0.744 in the training and validation sets, respectively. The model with the best prediction performance was based on the support vector machine (SVM) algorithm, which was constructed by age, tissue plasminogen activator-inhibitor complex, prothrombin time, international normalized ratio, white blood cells, and platelet counts. The SVM model showed good calibration and discrimination and a greater net benefit in decision curve analysis.
CONCLUSION
The SVM algorithm may be superior to other ML and traditional statistical algorithms for predicting septic shock. Physicians can better understand the reliability of the predictive model by Shapley additive explanations value analysis.
Humans
;
Shock, Septic/blood*
;
Machine Learning
;
Male
;
Female
;
Retrospective Studies
;
Middle Aged
;
Aged
;
Sepsis/complications*
;
ROC Curve
;
Cohort Studies
;
Adult
;
Intensive Care Units
;
Algorithms
;
Blood Coagulation
;
Critical Illness
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Diagnosis of coronary artery lesions in children based on Z-score regression model.
Yong WANG ; Jia-Ying JIANG ; Yan DENG ; Bo LI ; Ping SHUAI ; Xiao-Ping HU ; Yin-Yan ZHANG ; Han WU ; Lu-Wei YE ; Qian PENG
Chinese Journal of Contemporary Pediatrics 2025;27(2):176-183
OBJECTIVES:
To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula.
METHODS:
A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated.
RESULTS:
The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas.
CONCLUSIONS
The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans
;
Male
;
Female
;
Child, Preschool
;
Child
;
Coronary Artery Disease/diagnostic imaging*
;
Infant
;
Mucocutaneous Lymph Node Syndrome
;
Regression Analysis
;
Coronary Vessels/diagnostic imaging*
;
Echocardiography
;
Adolescent
6.Granuloma faciale and Takayasu arteritis in a child: a case report.
Wei LIAO ; Juan LONG ; Jian-Ping TANG ; Dan-Ni WO ; Ye SHU ; Zhu WEI
Chinese Journal of Contemporary Pediatrics 2025;27(10):1266-1270
An 11-year-old boy presented with erythematous plaques over the bilateral mandibular and mental regions for 2 years, accompanied by cough and dyspnea for more than 2 months. Chest computed tomography angiography revealed marked stenosis of the right pulmonary artery, irregular aortic caliber, and aortic wall thickening. Histopathological examination of the skin lesion, including immunohistochemistry and special stains, confirmed a chronic suppurative inflammation. Whole-exome sequencing was negative. A final diagnosis of granuloma faciale and Takayasu arteritis was established. Combination therapy with systemic tocilizumab, prednisone, and methotrexate, along with topical 0.1% tacrolimus ointment, resulted in a favorable clinical response. This report summarizes the clinical features of a pediatric case of granuloma faciale and Takayasu arteritis and reviews the etiology, diagnostic approach, and current treatment strategies for the disorders, aiming to enhance clinicians' understanding of these conditions.
Humans
;
Male
;
Child
;
Takayasu Arteritis/diagnosis*
;
Facial Dermatoses/diagnosis*
7.Expert consensus on evaluation index system construction for new traditional Chinese medicine(TCM) from TCM clinical practice in medical institutions.
Li LIU ; Lei ZHANG ; Wei-An YUAN ; Zhong-Qi YANG ; Jun-Hua ZHANG ; Bao-He WANG ; Si-Yuan HU ; Zu-Guang YE ; Ling HAN ; Yue-Hua ZHOU ; Zi-Feng YANG ; Rui GAO ; Ming YANG ; Ting WANG ; Jie-Lai XIA ; Shi-Shan YU ; Xiao-Hui FAN ; Hua HUA ; Jia HE ; Yin LU ; Zhong WANG ; Jin-Hui DOU ; Geng LI ; Yu DONG ; Hao YU ; Li-Ping QU ; Jian-Yuan TANG
China Journal of Chinese Materia Medica 2025;50(12):3474-3482
Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards*
;
Humans
;
Consensus
;
Drugs, Chinese Herbal/therapeutic use*
;
Surveys and Questionnaires
8.Guideline for Adult Weight Management in China
Weiqing WANG ; Qin WAN ; Jianhua MA ; Guang WANG ; Yufan WANG ; Guixia WANG ; Yongquan SHI ; Tingjun YE ; Xiaoguang SHI ; Jian KUANG ; Bo FENG ; Xiuyan FENG ; Guang NING ; Yiming MU ; Hongyu KUANG ; Xiaoping XING ; Chunli PIAO ; Xingbo CHENG ; Zhifeng CHENG ; Yufang BI ; Yan BI ; Wenshan LYU ; Dalong ZHU ; Cuiyan ZHU ; Wei ZHU ; Fei HUA ; Fei XIANG ; Shuang YAN ; Zilin SUN ; Yadong SUN ; Liqin SUN ; Luying SUN ; Li YAN ; Yanbing LI ; Hong LI ; Shu LI ; Ling LI ; Yiming LI ; Chenzhong LI ; Hua YANG ; Jinkui YANG ; Ling YANG ; Ying YANG ; Tao YANG ; Xiao YANG ; Xinhua XIAO ; Dan WU ; Jinsong KUANG ; Lanjie HE ; Wei GU ; Jie SHEN ; Yongfeng SONG ; Qiao ZHANG ; Hong ZHANG ; Yuwei ZHANG ; Junqing ZHANG ; Xianfeng ZHANG ; Miao ZHANG ; Yifei ZHANG ; Yingli LU ; Hong CHEN ; Li CHEN ; Bing CHEN ; Shihong CHEN ; Guiyan CHEN ; Haibing CHEN ; Lei CHEN ; Yanyan CHEN ; Genben CHEN ; Yikun ZHOU ; Xianghai ZHOU ; Qiang ZHOU ; Jiaqiang ZHOU ; Hongting ZHENG ; Zhongyan SHAN ; Jiajun ZHAO ; Dong ZHAO ; Ji HU ; Jiang HU ; Xinguo HOU ; Bimin SHI ; Tianpei HONG ; Mingxia YUAN ; Weibo XIA ; Xuejiang GU ; Yong XU ; Shuguang PANG ; Tianshu GAO ; Zuhua GAO ; Xiaohui GUO ; Hongyi CAO ; Mingfeng CAO ; Xiaopei CAO ; Jing MA ; Bin LU ; Zhen LIANG ; Jun LIANG ; Min LONG ; Yongde PENG ; Jin LU ; Hongyun LU ; Yan LU ; Chunping ZENG ; Binhong WEN ; Xueyong LOU ; Qingbo GUAN ; Lin LIAO ; Xin LIAO ; Ping XIONG ; Yaoming XUE
Chinese Journal of Endocrinology and Metabolism 2025;41(11):891-907
Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.
9.High Resolution Liquid Chromatography-Mass Spectrometry Combined with Forced Degradation and Nuclear Magnetic Resonance for Analysis of Novel Impurity in Torasemide Injection and Evaluation of Impact of Residual Oxygen Levels on Its Formation
Hai-Wei YE ; Li-Ping ZHOU ; Min LI ; Jin-Sheng LIN
Chinese Journal of Analytical Chemistry 2025;53(10):1732-1740,中插54-中插57
Drug impurity control is essential for ensuring pharmaceutical quality.In this study,an unknown impurity at relative retention time(RRT)of 0.45 in Torasemide injection was systematically investigated using high performance liquid chromatography-ion trap time-of-flight mass spectrometry(LC-IT-TOF-MS/MS),forced degradation studies,and nuclear magnetic resonance(NMR)spectroscopy,aiming to elucidate its chemical structure,propose a formation mechanism,and establish a control strategy.By analysis of the ultraviolet absorption spectrum and high-resolution MS1 and MS2 data of the impurity,its possible structure was postulated.Subsequently,the target impurity was prepared via forced degradation experiment,and its structure was confirmed by NMR spectroscopy.A detailed analysis of its formation mechanism revealed that Torasemide first hydrolyzed in solution to form Torasemide sulfonamide,and then underwent condensation,dehydration,and cyclization reactions with trace amounts of formaldehyde in the excipient polyethylene glycol(PEG)400 to generate the impurity.It was experimentally proven that the target impurity was related to the residual oxygen content in Torasemide injection.Ultimately,by optimizing the prescription process,the target impurity level was controlled below the individual impurity limit of the final product(≤0.3%).This study provided valuable insights for enhancing the quality control of Torasemide injection.
10.Isolation,identification,and biological characterization of enterotoxigenic Escherichia coli from a South China tiger
Jing-ru XU ; Zhi-hao ZHU ; Yu-qi LI ; Si-si FAN ; Ya-li KANG ; Yu-bin ZHUO ; Ling-shan HUANG ; Shu-qi QIU ; XUE-YUXI ; Xiao-ping WU ; Yu-ting LIAO ; Wei-ye LIN ; Xiao-ziyi XIAO ; Xue-jin LI ; Teng-teng CHEN ; Xi-pan LIN ; Kai-xiong LIN ; Ke-wei FAN
Chinese Journal of Zoonoses 2025;41(6):567-573
This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.

Result Analysis
Print
Save
E-mail