1.Mechanism of Quanduzhong Capsules in treating knee osteoarthritis from perspective of spatial heterogeneity.
Zhao-Chen MA ; Zi-Qing XIAO ; Chu ZHANG ; Yu-Dong LIU ; Ming-Zhu XU ; Xiao-Feng LI ; Zhi-Ping WU ; Wei-Jie LI ; Yi-Xin YANG ; Na LIN ; Yan-Qiong ZHANG
China Journal of Chinese Materia Medica 2025;50(8):2209-2216
This study aims to systematically characterize the targeted effects of Quanduzhong Capsules on cartilage lesions in knee osteoarthritis by integrating spatial transcriptomics data mining and animal experiments validation, thereby elucidating the related molecular mechanisms. A knee osteoarthritis model was established using Sprague-Dawley(SD) rats, via a modified Hulth method. Hematoxylin and eosin(HE) staining was employed to detect knee osteoarthritis-associated pathological changes in knee cartilage. Candidate targets of Quanduzhong Capsules were collected from the HIT 2.0 database, followed by bioinformatics analysis of spatial transcriptomics datasets(GSE254844) from cartilage tissues in clinical knee osteoarthritis patients to identify spatially specific disease genes. Furthermore, a "formula candidate targets-spatially specific genes in cartilage lesions" interaction network was constructed to explore the effects and major mechanisms of Quanduzhong Capsules in distinct cartilage regions. Experimental validation was conducted through immunohistochemistry using animal-derived biospecimens. The results indicated that Quanduzhong Capsules effectively inhibited the degenerative changes in the cartilage of affected joints in rats, which was associated with the regulation of Quanduzhong Capsules on the thioredoxin-interacting protein(TXNIP)-NOD-like receptor family pyrin domain containing 3(NLRP3)-bone morphogenetic protein receptor type 2(BMPR2)-fibronectin 1(FN1)-matrix metallopeptidase 2(MMP2) signal axis in the articular cartilage surface and superficial zones, subsequently inhibiting cartilage matrix degradation leading to oxidative stress and inflammatory diffusion. In summary, this study clarifies the spatially specific targeted effects and protective mechanisms of Quanduzhong Capsules within pathological cartilage regions in knee osteoarthritis, providing theoretical and experimental support for the clinical application of this drug in the targeted therapy on the inflamed cartilage.
Animals
;
Osteoarthritis, Knee/metabolism*
;
Drugs, Chinese Herbal/administration & dosage*
;
Rats, Sprague-Dawley
;
Rats
;
Male
;
Humans
;
Capsules
;
Female
;
Disease Models, Animal
2.Optimal harvesting period of cultivated Notopterygium incisum based on HPLC specific chromatogram combined with chemometrics and entropy weight-gray correlation analysis.
Jing-Cheng WANG ; Hong-Bing SUN ; Teng LIU ; Wen-Tao ZHU ; Hong-Lan WANG ; Yi ZHOU ; Wei-Yan WANG ; Ping YANG ; Shun-Yuan JIANG
China Journal of Chinese Materia Medica 2025;50(14):3878-3886
To determine the optimal cultivation duration and harvest period for cultivated Notopterygium incisum and promote its industrial development, this study established a characteristic chromatographic profile of cultivated N. incisum and employed chemometrics combined with entropy-weighted grey correlation analysis to assess differences in agronomic traits and quality indicators across different cultivation years and harvest periods. By comparing with reference substances, ten common peaks were identified, including chlorogenic acid, p-coumaric acid, ferulic acid, marmesinin, nodakenin, isochlorogenic acid B, notopterol, phenethyl ferulate, isoimperatorin, and falcarindiol. The similarity between the characteristic chromatographic profiles of N. incisum at different cultivation years and the reference profile was all above 0.932. Principal component analysis(PCA) and orthogonal partial least squares discriminant analysis(OPLS-DA) revealed that the quality of 1-to 3-year-old cultivated N. incisum was highly dispersed and unstable, whereas the quality of 4-year-old cultivated N. incisum remained relatively stable across different harvest periods. This suggests that the accumulation of relevant compounds in the medicinal material had reached a plateau, confirming that the optimal cultivation period for N. incisum is four years. Entropy-weighted grey correlation analysis indicated that the quality of 4-year-old cultivated N. incisum across different harvest periods ranked from highest to lowest as follows: November, December, October, August, July, and September, demonstrating that November is the optimal harvest time. The findings of this study establish the suitable cultivation duration and optimal harvest period for N. incisum, providing a scientific basis for cultivation guidance and quality standardization.
Chromatography, High Pressure Liquid/methods*
;
Apiaceae/chemistry*
;
Entropy
;
Chemometrics/methods*
;
Drugs, Chinese Herbal/chemistry*
;
Principal Component Analysis
;
Quality Control
3.Mechanisms of puerarin-mediated lipid modulation to enhance glucose-lowering effects via hepatic ChREBP/PPARα/PPARγ in vitro.
Can CUI ; Han-Yue XIAO ; Li-Ke YAN ; Zhong-Hua XU ; Wei-Hua LIU ; Hui-Ping LI ; Jun TU
China Journal of Chinese Materia Medica 2025;50(14):3951-3961
This study aims to investigate the in vitro mechanisms underlying the beneficial effects of puerarin on hepatic insulin resistance(IR) based on the carbohydrate response element-binding protein(ChREBP)/peroxisome proliferator-activated receptor(PPAR)α/PPARγ axis involved in glucose and lipid metabolism. An IR-HepG2 cell model was established by treating cells with dexamethasone for 48 h, and the cells were then treated with 10, 20, and 40 μmol·L~(-1) puerarin for 24 h. Glucose levels and output in the extracellular fluid were measured by the glucose oxidase method, while cell viability was assessed by the cell counting kit-8(CCK-8) assay. The adenosine triphosphate(ATP) content and glycogen synthesis were evaluated through chemiluminescence and periodic acid-Schiff staining, respectively. Western blot was employed to quantify the protein levels of forkhead box protein O1(FoxO1), phosphorylated forkhead box protein O1 [p-FoxO1(Ser256)], glucagon, phosphofructokinase, liver type(PFKL), pyruvate kinase L-R(PKLR), pyruvate dehydrogenase complex 1(PDHA1), insulin receptor substrate 2(IRS2), phosphatidylinositol 3-kinase p85(PI3KR1), phosphorylated protein kinase B [p-Akt(Thr308)], glycogen synthase(GYS), glycogen phosphorylase, liver type(PYGL), adiponectin(ADPN), ChREBP, PPARα, and PPARγ. Additionally, the protein levels of acetyl-CoA carboxylase 1(ACC1), phosphorylated ATP citrate lyase [p-ACLY(Ser455)], sterol regulatory element binding protein 1c(SREBP-1c), peroxisome proliferator-activated receptor gamma coactivator 1α(PGC1α), carnitine palmitoyltransferase 1α(CPT1α), and glucagon receptor(GCGR) were also determined. Immunofluorescence was employed to visualize the expression and nuclear location of ChREBP/PPARα/PPARγ. Furthermore, quantitative PCR with the antagonists GW6471 and GW9662 was employed to assess Pparα, Pparγ, and Chrebp. The findings indicated that puerarin effectively reduced both the glucose level and glucose output in the extracellular fluid of IR-HepG2 cells without obvious effect on the cell viability, and it increased intracellular glycogen and ATP levels. Puerarin down-regulated the protein levels of FoxO1 and glucagon while up-regulating the protein levels of p-FoxO1(Ser256), PFKL, PKLR, PDHA1, IRS2, PI3KR1, p-Akt(Thr308), GYS, PYGL, ADPN, ACC1, SREBP-1c, p-ACLY(Ser455), PGC1α, CPT1α, and GCGR in IR-HepG2 cells. Furthermore, puerarin up-regulated both the mRNA and protein levels of ChREBP, PPARα, and PPARγ and promoted the translocation into the nucleus. GW6471 was observed to down-regulate the expression of Pparα while up-regulating the expression of Chrebp and Pparγ. GW9662 down-regulated the expression of Pparγ while up-regulating the expression of Pparα, with no significant effect on Chrebp. In summary, puerarin activated the hepatic ChREBP/PPARα/PPARγ axis, thereby coordinating the glucose and lipid metabolism, promoting the conversion of glucose to lipids to exert the blood glucose-lowering effect.
Isoflavones/pharmacology*
;
Humans
;
PPAR gamma/genetics*
;
Hep G2 Cells
;
Glucose/metabolism*
;
Lipid Metabolism/drug effects*
;
PPAR alpha/genetics*
;
Liver/drug effects*
;
Basic Helix-Loop-Helix Leucine Zipper Transcription Factors/genetics*
;
Insulin Resistance
4.Hypoglycemic effect and mechanism of berberine in vitro based on regulation of BMAL1:CLOCK complex involved in hepatic glycolysis, glucose oxidation a nd gluconeogenesis to improve energy metabolism.
Zhong-Hua XU ; Li-Ke YAN ; Wei-Hua LIU ; Can CUI ; Han-Yue XIAO ; Hui-Ping LI ; Jun TU
China Journal of Chinese Materia Medica 2025;50(15):4293-4303
This paper aims to investigate the hypoglycemic effect and mechanism of berberine in improving energy metabolism based on the multi-pathway regulation of brain and muscle aromatic hydrocarbon receptor nuclear translocal protein 1(BMAL1): cyclin kaput complex of day-night spontaneous output cyclin kaput(CLOCK). The dexamethasone-induced hepatic insulin resistance(IR) HepG2 cell model was used; 0.5, 1, 5, 10, 20 μmol·L~(-1) berberine were administered at 15, 18, 21, 24, 30, 36 h. The time-dose effect of glucose content in extracellular fluid was detected by glucose oxidase method. The optimal dosage and time of berberine were determined for the follow-up study. Glucose oxidase method and chemiluminescence method were respectively performed to detect hepatic glucose output and relative content of ATP in cells; Ca~(2+), reactive oxygen species(ROS), mitochondrial structure and membrane potential were detected by fluorescent probes. Moreover, ultraviolet colorimetry method was used to detect the liver type of pyruvate kinase(L-PK) and phosphoenol pyruvate carboxykinase(PEPCK). In addition, pyruvate dehydrogenase E1 subunit α1(PDHA1), phosphate fructocrine-liver type(PFKL), forkhead box protein O1(FoxO1), peroxisome proliferator-activated receptor gamma co-activator 1α(PGC1α), glucose-6-phosphatase(G6Pase), glucagon, phosphorylated nuclear factor-red blood cell 2-related factor 2(p-Nrf2)(Ser40), heme oxygenase 1(HO-1), NAD(P)H quinone oxidoreductase 1(NQO1), fibroblast growth factor 21(FGF21), uncoupled protein(UCP) 1 and UCP2 were detected by Western blot. BMAL1:CLOCK complex was detected by immunofluorescence double-staining method, combined with small molecule inhibitor CLK8. Western blot was used to detect PDHA1, PFKL, FoxO1, PGC1α, G6Pase, glucagon, Nrf2, HO-1, NQO1, FGF21, UCP1 and UCP2 in the CLK8 group. The results showed that berberine downregulated the glucose content in extracellular fluid in IR-HepG2 cells in a time-and dose-dependent manner. Moreover, berberine inhibited hepatic glucose output and reduced intracellular Ca~(2+) and ROS whereas elevated JC-1 membrane potential and improved mitochondrial structure to enhance ATP production. In addition, berberine upregulated the rate-limiting enzymes such as PFKL, L-PK and PDHA1 to promote glycolysis and aerobic oxidation but also downregulated PGC1α, FoxO1, G6Pase, PEPCK and glucagon to inhibit hepatic gluconeogenesis. Berberine not only upregulated p-Nrf2(Ser40), HO-1 and NQO1 to enhance antioxidant capacity but also upregulated FGF21, UCP1 and UCP2 to promote energy metabolism. Moreover, berberine increased BMAL1, CLOCK and nuclear BMAL1:CLOCK complex whereas CLK8 reduced the nuclear BMAL1:CLOCK complex. Finally, CLK8 decreased PDHA1, PFKL, Nrf2, HO-1, NQO1, FGF21, UCP1, UCP2 and increased FoxO1, PGC1α, G6Pase and glucagon compared with the 20 μmol·L~(-1) berberine group. BMAL1:CLOCK complex inhibited gluconeogenesis, promoted glycolysis and glucose aerobic oxidation pathways, improved the reduction status within mitochondria, protected mitochondrial structure and function, increased ATP energy storage and promoted energy consumption in IR-HepG2 cells. These results suggested that berberine mediated BMAL1:CLOCK complex to coordinate the regulation of hepatic IR cells to improve energy metabolism in vitro.
Humans
;
Berberine/pharmacology*
;
Gluconeogenesis/drug effects*
;
Hep G2 Cells
;
Glucose/metabolism*
;
Liver/drug effects*
;
Energy Metabolism/drug effects*
;
Hypoglycemic Agents/pharmacology*
;
ARNTL Transcription Factors/genetics*
;
Glycolysis/drug effects*
;
Oxidation-Reduction/drug effects*
5.Application of a digital chylous plasma assessment device in the determination of chylous plasma
Lingyue GUO ; Caina LI ; Hongyan GAO ; Wei WEI ; Ping ZHANG ; Yan LIU ; Yajie WANG ; Weidong HE
Chinese Journal of Blood Transfusion 2025;38(9):1236-1241
Objective: To develop a simple digital chylous plasma device and validate its ability to accurately, standardly, and non-destructively determine chylous plasma in blood banks and clinical transfusions in hospitals. Methods: A digital chylous plasma assessment device was designed and manufactured. This device was used to measure the chylous degrees of chylous plasma samples before freezing, after freeze-thawing, before viral inactivation, and after viral inactivation. The measured chylosity index values were categorized according to the requirements specified in Appendix A of the Chinese national standard GB 18469-2001 "Quality Requirements for Whole Blood and Blood Components". This process established a digital standard for chylous plasma, enabling the identification of severe, moderate and mild chylous plasma, and non-chylous plasma. Results: The initial simple product of the digital chylous assessment device was successfully designed and manufactured. There was no significant difference in the degree of chylous plasma between pre-freezing 468.11±217.73 lux and post-thawing 538.91±273.39 lux of chylous plasma (P>0.05), or between pre-viral inactivation 858.33±387.79 lux and post-viral inactivation 928.33±166.51 lux of chylous plasma (P>0.05). The median of chylous degree values for plasma chylous index grades 0 to 6 were 45 lux, 250 lux, 620 lux, 835 lux, 1 130 lux, 1 390 lux, and 1 700 lux, respectively. The defined cutoff values/ranges for the chylous degree values corresponding to plasma chylous index grade 0 to 6 were ≤125 lux, 126-465 lux, 466-740 lux, 741-1 000 lux, 1 001-1 233 lux, 1 234-1 560 lux, and ≥1 561 lux. Conclusion: This study successfully developed the initial product of the digital chylous device and established digital standards for classifying chylous plasma. The device demonstrates the potential to meet the needs for assessment of chylous plasma in both blood banks and clinical transfusions in hospitals, thereby promoting the development and application of standardized, non-destructive chylous plasma assessment technology.
7.Advances in role and mechanism of traditional Chinese medicine active ingredients in regulating balance of Th1/Th2 and Th17/Treg immune responses in asthma patients.
Ya-Sheng DENG ; Lan-Hua XI ; Yan-Ping FAN ; Wen-Yue LI ; Yong-Hui LIU ; Zhao-Bing NI ; Ming-Chan WEI ; Jiang LIN
China Journal of Chinese Materia Medica 2025;50(4):1000-1021
Asthma is a chronic inflammatory disease involving multiple inflammatory cells and cytokines. Its pathogenesis is complex, involving various cells and cytokines. Traditional Chinese medicine(TCM) theory suggests that the pathogenesis of asthma is closely related to the dysfunction of internal organs such as the lungs, spleen, and kidneys. In contrast, modern immunological studies have revealed the central role of T helper 1(Th1)/T helper 2(Th2) and T helper 17(Th17)/regulatory T(Treg) cellular immune imbalance in the pathogenesis of asthma. Th1/Th2 imbalance is manifested as hyperfunction of Th2 cells, which promotes the synthesis of immunoglobulin E(IgE) and the activation of eosinophil granulocytes, leading to airway hyperresponsiveness and inflammation.Meanwhile, Th17/Treg imbalance exacerbates the inflammatory response in the airways, further contributing to asthma pathology.Currently, therapeutic strategies for asthma are actively exploring potential targets for regulating the balance of Th1/Th2 and Th17/Treg immune responses. These targets include cytokines, transcription factors, key proteins, and non-coding RNAs. Precisely regulating the expression and function of these targets can effectively modulate the activation and differentiation of immune cells. In recent years,traditional Chinese medicine active ingredients have shown unique potential and prospects in the field of asthma treatment. Based on this, the present study systematically summarizes the efficacy and specific mechanisms of TCM active ingredients in treating asthma by regulating Th1/Th2 and Th17/Treg immune balance through literature review and analysis. These active ingredients, including flavonoids, terpenoids, polysaccharides, alkaloids, and phenolic acids, exert their effects through various mechanisms, such as inhibiting the activation of inflammatory cells, reducing the release of cytokines, and promoting the normal differentiation of immune cells. This study aims to provide a solid foundation for the widespread application and in-depth development of TCM in asthma treatment and to offer new ideas for clinical research and drug development of asthma.
Asthma/genetics*
;
Humans
;
Drugs, Chinese Herbal/chemistry*
;
Th2 Cells/drug effects*
;
Th17 Cells/drug effects*
;
T-Lymphocytes, Regulatory/drug effects*
;
Th1 Cells/drug effects*
;
Animals
;
Cytokines/immunology*
;
Medicine, Chinese Traditional
8.One-year seedling cultivation technology and seed germination-promoting mechanism by warm water soaking of Polygonatum kingianum var. grandifolium.
Ke FU ; Jian-Qing ZHOU ; Zhi-Wei FAN ; Mei-Sen YANG ; Ya-Qun CHENG ; Yan ZHU ; Yan SHI ; Jin-Ping SI ; Dong-Hong CHEN
China Journal of Chinese Materia Medica 2025;50(4):1022-1030
Polygonati Rhizoma demonstrates significant potential for addressing both chronic and hidden hunger. The supply of high-quality seedlings is a primary factor influencing the development of the Polygonati Rhizoma industry. Warm water soaking is often used in agriculture to promote the rapid germination of seeds, while its application and molecular mechanism in Polygonati Rhizoma have not been reported. To rapidly obtain high-quality seedlings, this study treated Polygonatum kingianum var. grandifolium seeds with sand storage at low temperatures, warm water soaking, and cultivation temperature gradients. The results showed that the culture at 25 ℃ or sand storage at 4 ℃ for 2 months rapidly broke the seed dormancy of P. kingianum var. grandifolium, while the culture at 20 ℃ or sand storage at 4 ℃ for 1 month failed to break the seed dormancy. Soaking seeds in 60 ℃ warm water further increased the germination rate, germination potential, and germination index. Specifically, the seeds soaked at 60 ℃ and cultured at 25 ℃ without sand storage treatment(Aa25) achieved a germination rate of 78. 67%±1. 53% on day 42 and 83. 40%±4. 63% on day 77. The seeds pretreated with sand storage at 4 ℃ for 2 months, soaked in 60 ℃ water, and then cultured at 25 ℃ achieved a germination rate comparable to that of Aa25 on day 77. Transcriptomic analysis indicated that warm water soaking might promote germination by triggering reactive oxygen species( ROS), inducing the expression of heat shock factors( HSFs) and heat shock proteins( HSPs), which accelerated DNA replication, transcript maturation, translation, and processing, thereby facilitating the accumulation and turnover of genetic materials. According to the results of indoor controlled experiments and field practices, maintaining a germination and seedling cultivation environment at approximately 25 ℃ was crucial for the one-year seedling cultivation of P. kingianum var. grandifolium.
Germination
;
Seedlings/genetics*
;
Water/metabolism*
;
Seeds/metabolism*
;
Polygonatum/genetics*
;
Temperature
;
Plant Proteins/genetics*
;
Plant Dormancy
9.Correlation of IGF2 levels with sperm quality, inflammation, and DNA damage in infertile patients.
Jing-Gen WU ; Cai-Ping ZHOU ; Wei-Wei GUI ; Zhong-Yan LIANG ; Feng-Bin ZHANG ; Ying-Ge FU ; Rui LI ; Fang WU ; Xi-Hua LIN
Asian Journal of Andrology 2025;27(2):204-210
Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans
;
Male
;
Insulin-Like Growth Factor II/metabolism*
;
Infertility, Male/genetics*
;
DNA Damage
;
Adult
;
Inflammation/metabolism*
;
Spermatozoa/metabolism*
;
Semen Analysis
;
Semen/metabolism*
;
Tumor Necrosis Factor-alpha/metabolism*
;
Histones/metabolism*
;
Interleukin-1beta/metabolism*
10.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test

Result Analysis
Print
Save
E-mail