ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.

Peri-implant keratinized mucosa (PIKM) augmentation refers to surgical procedures aimed at increasing the width of PIKM. Consensus reports emphasize the necessity of maintaining a minimum width of PIKM to ensure long-term peri-implant health. Currently, several surgical techniques have been validated for their effectiveness in increasing PIKM. However, the selection and application of PIKM augmentation methods may present challenges for dental practitioners due to heterogeneity in surgical techniques, variations in clinical scenarios, and anatomical differences. Therefore, clear guidelines and considerations for PIKM augmentation are needed. This expert consensus focuses on the commonly employed surgical techniques for PIKM augmentation and the factors influencing their selection at second-stage surgery. It aims to establish a standardized framework for assessing, planning, and executing PIKM augmentation procedures, with the goal of offering evidence-based guidance to enhance the predictability and success of PIKM augmentation.
Humans ; Consensus ; Dental Implants ; Mouth Mucosa/surgery* ; Keratins

OBJECTIVE: To explore clinical efficacy of autologous platelet-rich plasma(PRP) in treating Rockwood type Ⅲ acromioclavicular dislocation. METHODS: From January 2019 to July 2021, 32 patients with Rockwood type Ⅲ acromioclavicular dislocation were treated with minimally invasive adjustable titanium plate internal fixation, and were divided into PRP group and control group according to whether PRP treatment was performed, with 16 patients in each group. In PRP group, there were 10 males and 6 females, aged from 28 to 47 years old with an average of (36.75±7.14) years old;the time from injury to surgery ranged from 1 to 31 h with an average of (26.13±3.98) h;5 patients on the left side and 11 patients on the right side;PRP was injected once during operation and the 4th and 8th weeks after operation respectively. In control group, there were 8 males and 8 females, aged from 30 to 52 years old with an average of (38.50±5.48) years old; the time from injury to surgery ranged from 1 to 29 h with an average of (25.48±3.11) h;7 patients on the left side and 9 patients on the right side; minimally invasive surgical treatment was performed. Visual analogue scale(VAS) was used to evaluate pain and Constant-Murley score for shoulder joint function was used to evaluate the recovery of shoulder joint movement function before operation and 1, 3, 6, and 12 months after operation respectively. RESULTS: All patients were followed up for 12 to 28 months with an average of (18.3±5.2) months. All incisions patients healed well without adverse events such as infection. Postoperative VAS of PRP group at 1, 3, and 6 months were (5.5±1.2), (3.7±1.6), and (2.4±1.2), respectively, while were lower than those of control group (6.6±1.4), (4.9±1.1), and (3.7±1.3), respectively;and had statistical differences between two groups (P<0.05). There was no statistically significant difference in VAS between two groups before operation and 12 months after operation (P>0.05). Postoperative Constant-Murley scores of PRP group at 1, 3, and 6 months were (64.09±11.61), (73.19±12.89), and (82.61±14.81) points, respectively, which were higher than those of control group were (52.32±17.42), (61.65±14.43), and (72.52±11.04) respectively;and the differences were statistically significant (P<0.05). There was no statistically significant difference in Constant-Murley scores at 12 months after operation between two groups (P>0.05). In PRP group, there was no statistically significant difference at 6 months and 12 months after operation (P>0.05), while there were statistically significant differences at the other time points (1 month after operation compared with before operation, 3 months after operation compared with 6 months after operation, and 3 months after operation compared with 1 month after operation) (P<0.05). In control group, there was no statistically significant difference when comparing 1 month and 3 months after operation (P>0.05), while at the other time points (1 month after operation with before operation, 3 months after operation with 6 months after operation, and 6 months after operation with 12 months after operation), the differences were all statistically significant (P<0.05). CONCLUSION Adjustable titanium plate fixation combined with postoperative injection of PRP for the treatment of Rockwood type III acromioclavicular joint dislocation has effect of promoting the recovery of shoulder joint function and reducing pain.
Humans ; Male ; Female ; Adult ; Middle Aged ; Platelet-Rich Plasma ; Acromioclavicular Joint/surgery* ; Bone Plates ; Titanium ; Joint Dislocations/therapy* ; Fracture Fixation, Internal/methods*

OBJECTIVE: To observe the clinical efficacy of 3D printing spinal external fixator combined with McKenzie therapy for patients with lumbar dics herniation (LDH). METHODS: Sixty patients with LDH between January 2022 and January 2023 were enrolled. Among them, 30 patients were given McKinsey training. According to different treatment methods, all patients were divided into McKenzie group and McKenzie + 3D printing group, 30 patients in each group. The McKenzie group provided McKenzie therapy. The McKenzie + 3D printing group were treated with 3D printing spinal external fixation brace on the basis of McKenzie therapy. Patients in both groups were between 25 and 60 years of age and had their first illness. In the McKenzie group, there were 19 males and 11 females, with an average age of (48.57±5.86) years old, and the disease duration was (7.03 ±2.39) months. The McKenzie + 3D printing group, there were 21 males and 9 females, with an average age of (48.80±5.92) years old, and the disease duration was(7.30±2.56) months. Pain was evaluated using the visual analogue scale (VAS), and lumbar spine function was assessed using the Oswestry disability index (ODI) and the Japanese Orthopaedic Association (JOA) score. VAS, ODI and JOA scores were compared between two groups before treatment and at 1, 3, 6, 9 and 12 months after treatment. RESULTS: All patients were followed up for 12 months. The VAS for the McKenzie combined with 3D printing group before treatment and at 1, 3, 6, 9, and 12 months post-treatment were(6.533±0.860), (5.133±1.008), (3.933±0.868), (2.900±0.759), (2.067±0.640), (1.433±0.504), respectively. In the McKenzie group, the corresponding scores were (6.467±0.860), (5.067±1.048), (4.600±0.968), (3.533±1.008), (2.567±0.728), (1.967±0.809), respectively. The ODI of the McKenzie group before treatment and at 1, 3, 6, 9, and 12 months post-treatment were (41.033±6.810)%, (37.933±6.209)%, (35.467±6.962)%, (27.567±10.081)%, (20.800±7.531)%, (13.533±5.158)%, respectively. For the McKenzie combined with 3D printing group, the corresponding ODI were(38.033±5.605)%, (33.000±6.192)%, (28.767±7.045)%, (22.200±5.517)%, (17.700±4.836)%, (11.900±2.771)%, respectively. The JOA scores of the McKenzie combined with 3D printing group before treatment and at 1, 3, 6, 9, and 12 months post-treatment were(8.900±2.074), (13.133±2.330), (15.700±3.583), (20.400±3.480), (22.267±3.084), (24.833±2.640), respectively. In the McKenzie group, the corresponding scores were(9.200±2.091), (12.267±2.406), (15.333±3.198), (18.467±2.240), (20.133±2.751), (22.467±2.849), respectively. Before the initiation of treatment, no statistically significant differences were observed in the VAS, ODI, and JOA scores between two groups (P>0.05). At 3, 6, 9, and 12 months post-treatment, the VAS in the McKenzie combined with 3D printing group was significantly lower than that in the McKenzie group, and the difference was statistically significant (P<0.05). The comparison of ODI between two groups at 1, 3, 6, 9, and 12 months post-treatment revealed statistically significant differences (P<0.05). At 6, 9, and 12 months post-treatment, the JOA score in the McKenzie combined with 3D printing group was significantly higher than that in the McKenzie-only group, and the difference was statistically significant (P<0.05). CONCLUSION The combination of 3D printed functional spinal external fixation brace with McKenzie therapy can significantly improve and maintain lumbar function in patients with LDH.
Humans ; Male ; Female ; Middle Aged ; Printing, Three-Dimensional ; Intervertebral Disc Displacement/surgery* ; External Fixators ; Lumbar Vertebrae/surgery* ; Adult ; Braces ; Treatment Outcome

PURPOSE: Lateral patellar compression syndrome (LPCS) is characterized by a persistent abnormally high stress exerted on the lateral articular surface of the patella due to lateral patellar tilt without dislocation and lateral retinaculum contracture, leading to anterior knee pain. The purpose of this study is to evaluate the efficacy and prognosis of lateral retinaculum release (LRR) combined with chondroplasty in the treatment of LPCS. METHODS: This retrospective study evaluated 40 patients who underwent LRR combined with chondroplasty for LPCS between 2020 and 2021. The assessment included improvement in postoperative tenderness and knee joint function. Patients were evaluated using the Lysholm, Tegner, and International Knee Documentation Committee 2000 scoring systems, as well as the visual analog scale, both preoperatively and postoperatively, with the paired comparisons analyzed using a t-test. Additionally, intraoperative observations were made regarding knee joint lesions, including cartilage damage and osteophyte formation, with analysis by the Chi-square test. RESULTS: The visual analog scale score for tenderness showed a significant decrease after surgery (p < 0.001). Evaluation of knee joint function also indicated significant improvements, as demonstrated by increased Lysholm, Tegner, and International Knee Documentation Committee 2000 scores postoperatively (p < 0.001, p = 0.011, p < 0.001, respectively). Furthermore, all LPCS patients included in the study presented with cartilage injuries and osteophyte formation. Significant differences were noted in the incidence of cartilage damage and osteophyte formation at different locations within the knee among patients with LPCS. CONCLUSION LRR combined with chondroplasty is an effective surgical approach for treating patients with LPCS, with satisfactory recovery observed at the 1-year follow-up. Additionally, the incidence of cartilage damage and osteophyte formation in LPCS patients varies significantly depending on the specific location within the knee joint.
Humans ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Patella/surgery* ; Knee Joint/physiopathology* ; Recovery of Function ; Young Adult ; Treatment Outcome ; Cartilage, Articular/surgery* ; Adolescent

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test