ObjectiveBased on the theory of "spleen governing transportation and transformation"， this study investigates the efficacy of Atractylodis Macrocephalae Rhizoma processed with Aurantii Fructus Immaturus juice（AMR-AFI） in improving slow-transit constipation（STC）， as well as the synergistic regulatory mechanism involving the microbiota-metabolism axis， thereby elucidating the scientific basis of its processing theory. MethodsAnimals were randomly divided into the control group， model group， positive drug（mosapride） group（3 mg·kg^-1）， and low-， medium-， and high-dose groups of AMR-AFI（3.9， 7.8， 15.6 g·kg^-1）. Except for the control group， the remaining five groups were induced with STC using loperamide hydrochloride. Following modeling， interventions were administered. All groups received continuous administration for 15 d， during which fecal samples， colon tissue， and serum were collected. Constipation improvement was assessed by measuring fecal moisture content and small intestinal propulsion rate， histological morphology of colonic tissue was observed via hematoxylin-eosin（HE） staining， and the levels of interleukin（IL）-6， tumor necrosis factor（TNF）-α， and IL-2 in serum were detected using enzyme-linked immunosorbent assay（ELISA）. Furthermore， the microbial community structure in mouse feces was analyzed by 16S rRNA sequencing， while transcriptomic sequencing was employed to screen differentially expressed genes in colonic tissue， followed by gene ontology（GO） and Kyoto Encyclopedia of Genes and Genomes（KEGG） enrichment analyses. Finally， Spearman correlation analysis was conducted to explore the association between differential microbiota and differential genes. ResultsCompared with the control group， the intestinal propulsion rate and fecal moisture content in the model group were significantly decreased（P<0.01）， while serum levels of IL-6， TNF-α， and IL-2 were significantly elevated（P<0.01）. HE staining showed damage and shedding of colonic mucosal epithelial cells， along with a reduction in goblet cells in the model group. In comparison with the model group， all treatment groups improved the pathological state of the colonic mucosa to varying degrees and reduced serum levels of IL-6， TNF-α， and IL-2（P<0.01）. Among these， the high-dose group of AMR-AFI significantly increased the intestinal propulsion rate and fecal moisture content of rats（P<0.05， P<0.01）. Further transcriptomic analysis revealed that a total of 104 differentially expressed genes were identified from comparisons between the model group and the control group， as well as between the model group and the high-dose group of AMR-AFI. These genes were mainly enriched in pathways closely related to STC pathogenesis， such as arachidonic acid metabolism and aldosterone-regulated sodium reabsorption. 16S rRNA sequencing results indicated that AMR-AFI reversed the structural imbalance of the gut microbiota in model mice， increased species richness， downregulated the relative abundance of pro-inflammatory bacteria such as Parasutterella， and enriched beneficial and butyrate-producing bacteria， including Lachnospiraceae_NK4A136_group， Ruminococcaceae， and Lachnospiraceae. Spearman correlation analysis further showed that the beneficial bacteria enriched in the AMR-AFI group were negatively correlated with genes involved in the arachidonic acid metabolic pathway and positively correlated with genes in the aldosterone-regulated sodium reabsorption pathway. In contrast， pro-inflammatory bacteria in the model group exhibited the opposite correlation trends. ConclusionAMR-AFI can effectively exert synergistic therapeutic effects on STC by regulating intestinal microbiota， arachidonic acid-mediated inflammatory metabolism， and aldosterone-regulated water-salt balance pathways.

ObjectiveBased on the theory of "spleen governing transportation and transformation"， this study investigates the efficacy of Atractylodis Macrocephalae Rhizoma processed with Aurantii Fructus Immaturus juice（AMR-AFI） in improving slow-transit constipation（STC）， as well as the synergistic regulatory mechanism involving the microbiota-metabolism axis， thereby elucidating the scientific basis of its processing theory. MethodsAnimals were randomly divided into the control group， model group， positive drug（mosapride） group（3 mg·kg^-1）， and low-， medium-， and high-dose groups of AMR-AFI（3.9， 7.8， 15.6 g·kg^-1）. Except for the control group， the remaining five groups were induced with STC using loperamide hydrochloride. Following modeling， interventions were administered. All groups received continuous administration for 15 d， during which fecal samples， colon tissue， and serum were collected. Constipation improvement was assessed by measuring fecal moisture content and small intestinal propulsion rate， histological morphology of colonic tissue was observed via hematoxylin-eosin（HE） staining， and the levels of interleukin（IL）-6， tumor necrosis factor（TNF）-α， and IL-2 in serum were detected using enzyme-linked immunosorbent assay（ELISA）. Furthermore， the microbial community structure in mouse feces was analyzed by 16S rRNA sequencing， while transcriptomic sequencing was employed to screen differentially expressed genes in colonic tissue， followed by gene ontology（GO） and Kyoto Encyclopedia of Genes and Genomes（KEGG） enrichment analyses. Finally， Spearman correlation analysis was conducted to explore the association between differential microbiota and differential genes. ResultsCompared with the control group， the intestinal propulsion rate and fecal moisture content in the model group were significantly decreased（P<0.01）， while serum levels of IL-6， TNF-α， and IL-2 were significantly elevated（P<0.01）. HE staining showed damage and shedding of colonic mucosal epithelial cells， along with a reduction in goblet cells in the model group. In comparison with the model group， all treatment groups improved the pathological state of the colonic mucosa to varying degrees and reduced serum levels of IL-6， TNF-α， and IL-2（P<0.01）. Among these， the high-dose group of AMR-AFI significantly increased the intestinal propulsion rate and fecal moisture content of rats（P<0.05， P<0.01）. Further transcriptomic analysis revealed that a total of 104 differentially expressed genes were identified from comparisons between the model group and the control group， as well as between the model group and the high-dose group of AMR-AFI. These genes were mainly enriched in pathways closely related to STC pathogenesis， such as arachidonic acid metabolism and aldosterone-regulated sodium reabsorption. 16S rRNA sequencing results indicated that AMR-AFI reversed the structural imbalance of the gut microbiota in model mice， increased species richness， downregulated the relative abundance of pro-inflammatory bacteria such as Parasutterella， and enriched beneficial and butyrate-producing bacteria， including Lachnospiraceae_NK4A136_group， Ruminococcaceae， and Lachnospiraceae. Spearman correlation analysis further showed that the beneficial bacteria enriched in the AMR-AFI group were negatively correlated with genes involved in the arachidonic acid metabolic pathway and positively correlated with genes in the aldosterone-regulated sodium reabsorption pathway. In contrast， pro-inflammatory bacteria in the model group exhibited the opposite correlation trends. ConclusionAMR-AFI can effectively exert synergistic therapeutic effects on STC by regulating intestinal microbiota， arachidonic acid-mediated inflammatory metabolism， and aldosterone-regulated water-salt balance pathways.

AIM To establish a rapid quantitative analysis model for saponins in Paris polyphylla var.yunnanensis(PPY)by near infrared spectroscopy.METHODS The contents of polyphyllins Ⅰ,Ⅱ,Ⅶ and there total content in PPY were determined by HPLC,while spectral data within the range of 10 000 to 4 000 cm-1 were collected.A quantitative analysis model was established by combining these data with partial least squares regression(PLSR).Multivariate scatter correction(MSC)and vector normalization(SNV)were applied prior to further preprocessing the spectra with original,first-order derivative(1stD),or second-order derivative(2ndD)treatments.Lastly,the model was optimized through non-smoothing(NS),Norris Derivative filtering(Nd),and Savitzky-Golay filtering(S-G)method.Model stability was evaluated based on correlation coefficients and variance.The predicted contents of each saponin component in the validation set samples were calculated.RESULTS The contents of polyphyllins Ⅰ,Ⅱ,Ⅶ were 0.42-17.98,0.46-10.44,0.23-3.86 mg/g,respectively.The total content ranged from 2.91 to 22.1 mg/g.The optimal parameters of three saponins were achieved when selecting the MSC+2ndD+S-G pretreatment method.The corresponding ratio of line segment length to segment gap was 13∶5,15∶5,11∶5,with correlation coefficients of 0.982,0.930,0.958,respectively.The root mean square errors of calibration(RMSEC)were 0.702,0.797,0.238,and the root mean square errors of prediction(RMSEP)were 1.120,0.835,0.304,respectively.The optimal parameters for the total content were obtained when selecting the MSC+2ndD+NS pretreatment method,with a correlation coefficient of 0.970,a RMSEC of 1.090,and a RMSEP of 1.740.CONCLUSION This accurate and rapid method can be used for detection of saponin contents in P.Polyphylla.

With the rapid development of generative artificial intelligence(GAI)technologies,their widespread application in academic research and writing is continuously expanding the boundaries of sci-entific inquiry.However,this trend has also raised a series of ethical and regulatory challenges,inclu-ding issues related to authorship,content authenticity,citation accuracy,and accountability.In light of the growing involvement of AI in generating academic content,establishing an open,controllable,and trustworthy ethical governance framework has become a key task for safeguarding research integrity and maintaining trust within the academic community.This expert consensus outlines ethical requirements across key stages of AI-assisted academic writing-including topic selection,data management,citation practices,and authorship attribution.It aims to clarify the boundaries and ethical obligations surrounding AI use in academic writing,ensuring that technological tools enhance efficiency without compromising in-tegrity.The goal is to provide guidance and institutional support for building a responsible and sustainable research ecosystem.

Objective To investigate the clinical feasibility and safety of endoscopic ultrasonography(EUS)combined with modified endoscopic mucosal resection(EMR)in the treatment of rectal neuroendo-crine tumors(RNETs).Methods A total of 48 patients diagnosed with RNETs by colonoscopy in the depart-ment of gastroenterology in this hospital from December 2021 to June 2023 were selected as the study objects.Patients were randomly divided into the study group(EUS combined with modified EMR,n=16),the control 1 group(traditional EMR,n=16)and the control 2 group[endoscopic submucosal dissection(ESD),n=16].The operation time,R0 resection rate and postoperative complications of each group were observed.Endoscop-ic ultrasonography was followed up 3 and 6 months after surgery to determine whether there was any recur-rence.Results The operative time of the study group[(17.813±0.379)min]was significantly shorter than that of the control 2 group[(36.250±3.296)min],the difference was statistically significant(P＜0.05),but compared with the control 1 group[(16.375±1.996)min],there was no significant difference(P＞0.05).The incidence of complications in the study group(6.2％)was significantly lower than that in the control 2 group(37.5％),the difference was statistically significant(P＜0.05).while the incidence of complications in the study group was not significantly higher than that in the control 1 group(12.5％,P＞0.05).R0 removal rate in the study group(93.8％)was significantly higher than that in the control 1 group(62.5％)and the control 2 group(75.0％),the difference was statistically significant(P＜0.05).Conclusion EUS combined with modified EMR has more advantages than EMR and ESD in the treatment of RNETs,and has certain fea-sibility and safety,which is convenient for clinical application.

With the rapid development of generative artificial intelligence(GAI)technologies,their widespread application in academic research and writing is continuously expanding the boundaries of sci-entific inquiry.However,this trend has also raised a series of ethical and regulatory challenges,inclu-ding issues related to authorship,content authenticity,citation accuracy,and accountability.In light of the growing involvement of AI in generating academic content,establishing an open,controllable,and trustworthy ethical governance framework has become a key task for safeguarding research integrity and maintaining trust within the academic community.This expert consensus outlines ethical requirements across key stages of AI-assisted academic writing-including topic selection,data management,citation practices,and authorship attribution.It aims to clarify the boundaries and ethical obligations surrounding AI use in academic writing,ensuring that technological tools enhance efficiency without compromising in-tegrity.The goal is to provide guidance and institutional support for building a responsible and sustainable research ecosystem.

Objective To explore the effect of repetitive transcranial magnetic stimulation(rTMS)on the sleep disorder and examination results of recruits.Methods At a training base,the Pittsburgh Sleep Quality Index(PSQI)was used to screen the recruits with sleep disorders(total score of PSQI>7).The recruits were randomly assigned to rTMS group or sham rTMS group.Both groups received cognitive and behavioral intervention therapy,including sleep health education and relaxation training.Moreover,the rTMS group was treated with rTMS at the right posterior parietal lobe by continuous theta burst stimulation(cTBS)twice a day at an interval of at least 50 min for 5 consecutive days as a course of treatment with an interval of 2 days for a total of 2 courses of treatment.The coil position and stimulus intensity of sham rTMS group were consistent with the rTMS group,but the head of subjects was perpendicular to the coil plane and there was no effective stimulation.Before and after treatment,PSQI,self-rating depression scale,generalized anxiety disorder-7 and health questionnaire-15 were used to evaluate the sleep,mood and physical state of the recruits.The training result was assessed one month after treatment.The total effective rate of PSQI improvement and examination results were compared between the two groups.The independent influencing factors of excellent examination result were analyzed.Results Among 351 recruits,83 with sleep disorders completed treatment and follow-up.There were 40 patients in the rTMS group and 43 patients in the sham rTMS group.There was no significant difference between the two groups at baseline.After treatment,the total effective rate of PSQI improvement in the rTMS group was higher than that in the sham rTMS group(77.50%vs 53.49%,P=0.022).The average examination score and excellent rate of the rTMS group were higher than those of the sham rTMS group(91.58±3.19 vs 89.47±4.67,P=0.020;85%vs 65.12%,P=0.037).Logistic regression analysis showed that the treatment mode(rTMS group)was the independent influencing factor of excellent examination results(P=0.032).Conclusion rTMS can effectively and safely improve the sleep disorders and examination results of recruits.rTMS may play a positive role in improving the learning and training effect of recruits,which needs to be further proved.

Objective To investigate the comparative neuroprotective effects of human umbilical cord mesenchymal stem cells(hUC-MSCs-Exos)administered via different routes on hypoxic ischemic brain damage(HIBD)in neonatal mice.Methods Healthy one-week-old SPF-grade BALB/c mice were randomly divided into 4 groups:sham operation group(n=6),model group(n=6),exosome group 1(n=8),exosome group 2(n=8).HIBD was induced using the Rice-Vannucci method.Exosome group 1 and Exosome group 2 were intraperitoneal injection/intranasal drip of phosphate buffer(PBS)100 μl containing 10 μl exosomes within 24 h after successful modeling,respectively.Sham operation and model groups were intraperitoneal injection of PBS 100 μl.On the 7th day after the intervention,neuromotor function was assessed using the horizontal grid test and pole climbing test.On the 2nd day after the evaluation,all mice were killed and their brains were removed by decapitation.HE staining was used to observe the pathological injury of brain tissue,toluidine blue staining was used to observe the survival of neurons in cerebral cortex,and TUNEL staining was used to observe the apoptosis of cerebral cortex cells.Results Compared with sham operation group,model group,exosome group 1 and exosome group 2 exhibited increased hind limb drops in horizontal grid test and climbing scores(P<0.05).No significant difference was found in model group,exosome group 1 and exosome group 2 in these measures(P<0.05).Significant pathology was observed in model group,exosome group 1 and exosome group 2 compared to sham operation group(P<0.05),with significantly reduced damage in exosome group 1 and exosome group 2 compared to model group(P<0.05).Compared with sham operation group,Nissl body count was lower in model group and exosome group 1 and exosome group 2,with a higher count in exosome group 2 compared to exosome group 1(P<0.05).Compared with sham operation group,apoptotic cells were higher in model group and exosome group 1 and exosome group 2,with a significant reduction in exosome group 1 and exosome group 2 compared to model group,and the lowest in exosome group 2(P<0.05).Conclusions hUC-MSCs-Exos can improve the neuronal motor function,promote neuron repair and inhibit apoptosis in HIBD mice.Intranasal administration of hUC-MSCs-Exos is more effective than intraperitoneal administration for reducing neuronal apoptosis in HIBP neonatal mice,offering a convenient and rapid method suitable for clinical application.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test