1.Development and validation of a prediction score for subtype diagnosis of primary aldosteronism.
Ping LIU ; Wei ZHANG ; Jiao WANG ; Hongfei JI ; Haibin WANG ; Lin ZHAO ; Jinbo HU ; Hang SHEN ; Yi LI ; Chunhua SONG ; Feng GUO ; Xiaojun MA ; Qingzhu WANG ; Zhankui JIA ; Xuepei ZHANG ; Mingwei SHAO ; Yi SONG ; Xunjie FAN ; Yuanyuan LUO ; Fangyi WEI ; Xiaotong WANG ; Yanyan ZHAO ; Guijun QIN
Chinese Medical Journal 2025;138(23):3206-3208
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Acupuncture Therapy on Dysphagia in Patients with Parkinson's Disease: A Randomized Controlled Study.
Hong-Ji ZENG ; Wei-Jia ZHAO ; Peng-Chao LUO ; Xu-Yang ZHANG ; Si-Yu LUO ; Yi LI ; He-Ping LI ; Liu-Gen WANG ; Xi ZENG
Chinese journal of integrative medicine 2025;31(3):261-269
OBJECTIVE:
To explore the effect of acupuncture therapy on dysphagia in patients with Parkinson's disease.
METHODS:
This randomized controlled study lasted 42 days and included 112 patients with Parkinson's disease and dysphagia. Participants were randomly assigned to the experimental and control groups (56 cases each group) using the completely randomized design, all under routine treatment. The experimental group was given acupuncture therapy. The primary outcome was Penetration-Aspiration Scale (PAS). The secondary outcomes were (1) Standardized Swallowing Assessment (SSA), and (2) nutritional status including body mass index (BMI), serum albumin, prealbumin, and hemoglobin. Adverse events were recorded as safety indicators.
RESULTS:
One participant quitted the study midway. There were no significant differences in baseline assessment (P>0.05). After treatment, both groups showed significant improvement in PAS, SSA and nutritional status except for BMI of the control group. There were significant differences between the two groups in the PAS for both paste and liquid, SSA (25.18±8.25 vs. 20.84±6.92), BMI (19.97±3.34 kg/m2vs. 21.26 ±2.38 kg/m2), serum albumin (35.16 ±5.29 g/L vs. 37.24 ±3.98 g/L), prealbumin (248.33 ±27.72 mg/L vs. 261.39 ±22.10 mg/L), hemoglobin (119.09±12.53 g/L vs. 126.67±13.97 g/L) (P<0.05). There were no severe adverse events during the study.
CONCLUSION:
The combination of routine treatment and acupuncture therapy can better improve dysphagia and nutritional status in patients with Parkinson's disease, than routine treatment solely. (registration No.
CLINICALTRIAL
gov NCT06199323).
Humans
;
Parkinson Disease/therapy*
;
Deglutition Disorders/physiopathology*
;
Acupuncture Therapy/adverse effects*
;
Male
;
Female
;
Aged
;
Middle Aged
;
Treatment Outcome
;
Nutritional Status
;
Body Mass Index
4.Preliminary clinical exploration of endoscopic ultrasound combined with modified endoscopic mucosal resection in the treatment of rectal neuroendocrine tumors
Ping LUO ; Aimin LIU ; Zhiqiang YI ; Qiaomu LUO ; Sha WEI ; Jing KUANG ; Jing TANG
Chongqing Medicine 2025;54(4):893-897
Objective To investigate the clinical feasibility and safety of endoscopic ultrasonography(EUS)combined with modified endoscopic mucosal resection(EMR)in the treatment of rectal neuroendo-crine tumors(RNETs).Methods A total of 48 patients diagnosed with RNETs by colonoscopy in the depart-ment of gastroenterology in this hospital from December 2021 to June 2023 were selected as the study objects.Patients were randomly divided into the study group(EUS combined with modified EMR,n=16),the control 1 group(traditional EMR,n=16)and the control 2 group[endoscopic submucosal dissection(ESD),n=16].The operation time,R0 resection rate and postoperative complications of each group were observed.Endoscop-ic ultrasonography was followed up 3 and 6 months after surgery to determine whether there was any recur-rence.Results The operative time of the study group[(17.813±0.379)min]was significantly shorter than that of the control 2 group[(36.250±3.296)min],the difference was statistically significant(P<0.05),but compared with the control 1 group[(16.375±1.996)min],there was no significant difference(P>0.05).The incidence of complications in the study group(6.2%)was significantly lower than that in the control 2 group(37.5%),the difference was statistically significant(P<0.05).while the incidence of complications in the study group was not significantly higher than that in the control 1 group(12.5%,P>0.05).R0 removal rate in the study group(93.8%)was significantly higher than that in the control 1 group(62.5%)and the control 2 group(75.0%),the difference was statistically significant(P<0.05).Conclusion EUS combined with modified EMR has more advantages than EMR and ESD in the treatment of RNETs,and has certain fea-sibility and safety,which is convenient for clinical application.
5.Effects of repetitive transcranial magnetic stimulation on sleep disorder and examination results of recruits
Yanbin ZHAN ; Yijie ZHAO ; Hui YUAN ; Longjuan YU ; Lei CHEN ; Benqiang DENG ; Wei WANG ; Shudan LUO ; Ping ZHANG
Journal of Navy Medicine 2025;46(5):440-445
Objective To explore the effect of repetitive transcranial magnetic stimulation(rTMS)on the sleep disorder and examination results of recruits.Methods At a training base,the Pittsburgh Sleep Quality Index(PSQI)was used to screen the recruits with sleep disorders(total score of PSQI>7).The recruits were randomly assigned to rTMS group or sham rTMS group.Both groups received cognitive and behavioral intervention therapy,including sleep health education and relaxation training.Moreover,the rTMS group was treated with rTMS at the right posterior parietal lobe by continuous theta burst stimulation(cTBS)twice a day at an interval of at least 50 min for 5 consecutive days as a course of treatment with an interval of 2 days for a total of 2 courses of treatment.The coil position and stimulus intensity of sham rTMS group were consistent with the rTMS group,but the head of subjects was perpendicular to the coil plane and there was no effective stimulation.Before and after treatment,PSQI,self-rating depression scale,generalized anxiety disorder-7 and health questionnaire-15 were used to evaluate the sleep,mood and physical state of the recruits.The training result was assessed one month after treatment.The total effective rate of PSQI improvement and examination results were compared between the two groups.The independent influencing factors of excellent examination result were analyzed.Results Among 351 recruits,83 with sleep disorders completed treatment and follow-up.There were 40 patients in the rTMS group and 43 patients in the sham rTMS group.There was no significant difference between the two groups at baseline.After treatment,the total effective rate of PSQI improvement in the rTMS group was higher than that in the sham rTMS group(77.50%vs 53.49%,P=0.022).The average examination score and excellent rate of the rTMS group were higher than those of the sham rTMS group(91.58±3.19 vs 89.47±4.67,P=0.020;85%vs 65.12%,P=0.037).Logistic regression analysis showed that the treatment mode(rTMS group)was the independent influencing factor of excellent examination results(P=0.032).Conclusion rTMS can effectively and safely improve the sleep disorders and examination results of recruits.rTMS may play a positive role in improving the learning and training effect of recruits,which needs to be further proved.
6.Comparison of neuroprotective effects of hUC-MSCs-Exos on hypoxic-ischemic brain injury in neonatal mice by different administration modes
Xiao-Xia HU ; Yi-Pa SAI ; Xing-Xing CHEN ; Wei-Jing CUI ; San-Ping WANG ; Xuan LUO ; Shi-Li WU
Medical Journal of Chinese People's Liberation Army 2025;50(2):207-213
Objective To investigate the comparative neuroprotective effects of human umbilical cord mesenchymal stem cells(hUC-MSCs-Exos)administered via different routes on hypoxic ischemic brain damage(HIBD)in neonatal mice.Methods Healthy one-week-old SPF-grade BALB/c mice were randomly divided into 4 groups:sham operation group(n=6),model group(n=6),exosome group 1(n=8),exosome group 2(n=8).HIBD was induced using the Rice-Vannucci method.Exosome group 1 and Exosome group 2 were intraperitoneal injection/intranasal drip of phosphate buffer(PBS)100 μl containing 10 μl exosomes within 24 h after successful modeling,respectively.Sham operation and model groups were intraperitoneal injection of PBS 100 μl.On the 7th day after the intervention,neuromotor function was assessed using the horizontal grid test and pole climbing test.On the 2nd day after the evaluation,all mice were killed and their brains were removed by decapitation.HE staining was used to observe the pathological injury of brain tissue,toluidine blue staining was used to observe the survival of neurons in cerebral cortex,and TUNEL staining was used to observe the apoptosis of cerebral cortex cells.Results Compared with sham operation group,model group,exosome group 1 and exosome group 2 exhibited increased hind limb drops in horizontal grid test and climbing scores(P<0.05).No significant difference was found in model group,exosome group 1 and exosome group 2 in these measures(P<0.05).Significant pathology was observed in model group,exosome group 1 and exosome group 2 compared to sham operation group(P<0.05),with significantly reduced damage in exosome group 1 and exosome group 2 compared to model group(P<0.05).Compared with sham operation group,Nissl body count was lower in model group and exosome group 1 and exosome group 2,with a higher count in exosome group 2 compared to exosome group 1(P<0.05).Compared with sham operation group,apoptotic cells were higher in model group and exosome group 1 and exosome group 2,with a significant reduction in exosome group 1 and exosome group 2 compared to model group,and the lowest in exosome group 2(P<0.05).Conclusions hUC-MSCs-Exos can improve the neuronal motor function,promote neuron repair and inhibit apoptosis in HIBD mice.Intranasal administration of hUC-MSCs-Exos is more effective than intraperitoneal administration for reducing neuronal apoptosis in HIBP neonatal mice,offering a convenient and rapid method suitable for clinical application.
7.Current situation and quality control of multidisciplinary clinic——a case study of a tertiary hospital in Guangxi
Zhixiong ZHAO ; Ruhong LONG ; Ping LI ; Liping LUO ; Xiuke WEI
Modern Hospital 2024;24(3):402-405
The Multi-disciplinary diagnosis and treatment(MDT)outpatient service is widely used in the diagnosis and treatment of patients with tumors,difficult critical and complex diseases and multiple diseases.The purpose of this paper is to study the one-stop treatment mode of MDT outpatient service in tertiary hospitals and the closed-loop management after diagnosis,which plays an important role in integrating medical resources,optimizing medical treatment process,improving patient medical experience,and ensuring medical quality and safety.In view of the weak links and difficulties in quality control in MDT outpa-tient management,such as insufficient attention from functional departments,low enthusiasm of clinicians,low initiative of pa-tients,imperfect information construction of MDT outpatient service,poor quality improvement effect,etc.,Effective manage-ment methods such as core members'guidance,supporting incentive and assessment mechanism,regular reporting of quality,im-proving information construction,extending service scope,and increasing publicity efforts have been adopted for continuous im-provement,and remarkable results have been achieved in increasing the number of cases and diseases,expanding brand influ-ence,and improving the quality of consultation.
8.Interventional effect of bone marrow mesenchymal stem cell transplantation with different doses of X-ray irradiation induced hepatic injury in mice
Yue LIANG ; Lan LUO ; Tianyu CHENG ; Gaofeng CHEN ; Wei LIU ; Yongping MU ; Jiamei CHEN ; Ping LIU
Chinese Journal of Hepatology 2024;32(11):1019-1027
Objective:To investigate the interventional effect of bone marrow mesenchymal stem cell (BMMSC) transplantation with different doses of X-ray irradiation induced hepatic injury in mice.Methods:Eighteen female C57BL/6J mice were randomly divided into 0, 2, and 3 Gy irradiation groups and 0, 2, and 3 Gy transplantation groups. The irradiation group was used as the control and injected with an equal volume of culture medium. The mice in the transplantation group were irradiated with different doses of X-ray irradiation, and BMMSCs were intravenously infused into the bone marrow. The mice were sacrificed for sampling at the end of the 21st day. Mice body weight changes were recorded daily. The changes in the content of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were detected by an automatic blood tester. The morphological changes in mice liver tissues were observed by hematoxylin-eosin staining. The serum activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were detected by a biochemical analyzer. The reduced glutathione contents in liver tissue were detected by the microplate method. The malondialdehyde content in liver tissue was detected by thiobarbituric acid. The content of total superoxide dismutase (T-SOD) in liver tissue was detected by the hydroxylamine method. The expression of the F4/80 protein in liver tissue was detected by the immunohistochemistry method. The protein expression of nuclear transcription factor erythroid 2 related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) in liver tissue was determined by the western blotting method. The mRNA expression of NLRP3, IL-6, and Nrf2 in liver tissue was detected by a real-time quantitative polymerase chain reaction. The multiple-group comparisons were analyzed by factorial analysis of variance. The inter-group comparisons were analyzed by the LSD method for statistical analysis.Results:The contents of peripheral blood lymphocytes, erythrocytes, platelets, and hemoglobin were significantly decreased in the 3 Gy irradiation group than the 0 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly increased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, nucleotide-binding domain and leucine-rich repeats, nucleotide oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3), and interleukin 6 mRNA expression levels were significantly increased in liver tissue, while the contents of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly decreased ( P<0.05). The contents of peripheral blood lymphocytes, red blood cells, platelets, and hemoglobin were significantly increased in the 3 Gy transplantation group than the 3 Gy irradiation group ( P<0.05), while the activities of serum ALT and AST were significantly decreased ( P<0.05). The malondialdehyde content, F4/80 protein expression level, NLRP3 and interleukin-6 mRNA expression levels in liver tissue were significantly decreased ( P<0.05), while the content of T-SOD and glutathione, Nrf2 and HO-1 protein expression levels, and Nrf2 mRNA expression level in liver tissue were significantly increased ( P<0.05). Conclusion:X-ray irradiation at a dose of 3 Gy can induce liver oxidative damage in mice. BMMSC transplantation can improve X-ray irradiation-induced liver oxidative damage in mice, and its mechanism of action may be related to the regulation of the Nrf2/HO-1 pathway.
9.Early Improvement in Interstitial Fluid Flow in Patients With Severe Carotid Stenosis After Angioplasty and Stenting
Chia-Hung WU ; Shih-Pin CHEN ; Chih-Ping CHUNG ; Kai-Wei YU ; Te-Ming LIN ; Chao-Bao LUO ; Jiing-Feng LIRNG ; I-Hui LEE ; Feng-Chi CHANG
Journal of Stroke 2024;26(3):415-424
Background:
and Purpose This study aimed to investigate early changes in interstitial fluid (ISF) flow in patients with severe carotid stenosis after carotid angioplasty and stenting (CAS).
Methods:
We prospectively recruited participants with carotid stenosis ≥80% undergoing CAS at our institute between October 2019 and March 2023. Magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI), and the Mini-Mental State Examination (MMSE) were performed 3 days before CAS. MRI with DTI and MMSE were conducted within 24 hours and 2 months after CAS, respectively. The diffusion tensor image analysis along the perivascular space (DTI-ALPS) index was calculated from the DTI data to determine the ISF status. Increments were defined as the ratio of the difference between post- and preprocedural values to preprocedural values.
Results:
In total, 102 participants (age: 67.1±8.9 years; stenosis: 89.5%±5.7%) with longitudinal data were evaluated. The DTI-ALPS index increased after CAS (0.85±0.15; 0.85 [0.22] vs. 0.86±0.14; 0.86 [0.21]; P=0.022), as did the MMSE score (25.9±3.7; 24.0 [4.0] vs. 26.9±3.4; 26.0 [3.0]; P<0.001). Positive correlations between increments in the DTI-ALPS index and MMSE score were found in all patients (rs=0.468; P<0.001).
Conclusion
An increased 24-hour post-CAS DTI-ALPS index suggests early improvement in ISF flow efficiency. The positive correlation between the 24-hour DTI-ALPS index and 2-month MMSE score increments suggests that early ISF flow improvement may contribute to long-term cognitive improvement after CAS.
10.Influence of curative-intent resection with textbook outcomes on long-term prognosis of gall-bladder carcinoma: a national multicenter study
Zhipeng LIU ; Zimu LI ; Yule LUO ; Xiaolin ZHAO ; Jie BAI ; Yan JIANG ; Yunfeng LI ; Chao YU ; Fan HUANG ; Zhaoping WU ; Jinxue ZHOU ; Dalong YIN ; Rui DING ; Wei GUO ; Yi ZHU ; Wei CHEN ; Kecan LIN ; Ping YUE ; Yao CHENG ; Haisu DAI ; Dong ZHANG ; Zhiyu CHEN
Chinese Journal of Digestive Surgery 2024;23(7):926-933
Objective:To investigate the influence of curative-intent resection with textbook outcomes of liver surgery (TOLS) on long-term prognosis of gallbladder carcinoma (GBC).Methods:The retrospective cohort study was conducted. The clinicopathological data of 824 patients with GBC in the national multicenter database of Biliary Surgery Group of Elite Group of Chinese Journal of Digestive Surgery, who were admitted to 15 medical centers from January 2014 to January 2021, were collected. There were 285 males and 539 females, aged (62±11)years. According to the evalua-tion criteria of TOLS, patients were divided into those who achieved TOLS and those who did not achieve TOLS. Measurement data with normal distribution were represented as Mean± SD, and com-parison between groups was conducted using the independent sample t test. Measurement data with skewed distribution were represented as M( Q1, Q3), and comparison between groups was conducted using the Mann-Whitney U test. Count data were described as absolute numbers, and comparison between groups was conducted using the chi-square test. Comparison of ordinal data were conduc-ted using the Mann-Whitney U test. The Kaplan-Meier method was used to calculate survival rate and draw survival curve, and the Log-rank test was used for survival analysis. The COX stepwise regression model with backward Wald method was used for univariate and multivariate analyses. Results:(1) Achievement of TOLS. Of the 824 patients undergoing curative-intent resection for GBC, there were 510 cases achieving TOLS and 314 cases not achieving TOLS. (2) Follow-up. Of the 824 patients undergoing curative-intent resection for GBC, after excluding 112 deaths within 90 days after discharge, 712 cases were included for the survival analysis. The median follow-up time, median overall survival time and 5-year overall survival rate of the 510 patients achieving TOLS were 22.1(11.4,30.1)months, 47.6(30.6,64.6)months and 47.5%. The median follow-up time, median overall survival time and 5-year overall survival rate of the 202 patients not achieving TOLS were 14.0(6.8,25.5)months, 24.3(20.0,28.6)months and 21.0%. There was a significant difference in overall survival between patients achieving TOLS and patients not achieving TOLS ( χ2=58.491, P<0.05). (3) Analysis of factors influencing prognosis of patients. Results of multivariate analysis showed that TOLS, carcinoembryonic antigen (CEA), CA19-9, poorly differentiation of tumor, T2 stage of eighth edition of American Joint Committee on Cancer (AJCC) staging, T3 and T4 stage of eighth edition of AJCC staging, N1 stage of the eighth edition of AJCC staging, N2 stage of the eighth edition of AJCC staging, adjuvant therapy were independent factors influencing overall survival time of patients undergoing curative-intent resection for GBC ( hazard ratio=0.452, 1.479, 1.373, 1.612, 1.455, 1.481, 1.835, 1.978, 0.538, 95% c onfidence interval as 0.352-0.581, 1.141-1.964, 1.052-1.791, 1.259-2.063, 1.102-1.920, 1.022-2.147, 1.380-2.441, 1.342-2.915, 0.382-0.758, P<0.05). Conclusion:Patients under-going curative-intent resection for GBC with TOLS can achieve better long-term prognosis.

Result Analysis
Print
Save
E-mail