1.Exploring Intervention Effect of Atractylodis Macrocephalae Rhizoma Processed with Aurantii Fructus Immaturus Juice on Slow-transit Constipation and Its "Microbiota-Metabolism" Synergistic Regulation Mechanism Based on Theory of "Spleen Governing Transportation and Transformation"
Dan LI ; Xiaoxia LIU ; Xiaofen WANG ; Zuxin HE ; Junnan WEI ; Yanqing LIU ; Yuxuan GAO ; Ping LUO ; Fang WANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(10):201-209
ObjectiveBased on the theory of "spleen governing transportation and transformation", this study investigates the efficacy of Atractylodis Macrocephalae Rhizoma processed with Aurantii Fructus Immaturus juice(AMR-AFI) in improving slow-transit constipation(STC), as well as the synergistic regulatory mechanism involving the microbiota-metabolism axis, thereby elucidating the scientific basis of its processing theory. MethodsAnimals were randomly divided into the control group, model group, positive drug(mosapride) group(3 mg·kg-1), and low-, medium-, and high-dose groups of AMR-AFI(3.9, 7.8, 15.6 g·kg-1). Except for the control group, the remaining five groups were induced with STC using loperamide hydrochloride. Following modeling, interventions were administered. All groups received continuous administration for 15 d, during which fecal samples, colon tissue, and serum were collected. Constipation improvement was assessed by measuring fecal moisture content and small intestinal propulsion rate, histological morphology of colonic tissue was observed via hematoxylin-eosin(HE) staining, and the levels of interleukin(IL)-6, tumor necrosis factor(TNF)-α, and IL-2 in serum were detected using enzyme-linked immunosorbent assay(ELISA). Furthermore, the microbial community structure in mouse feces was analyzed by 16S rRNA sequencing, while transcriptomic sequencing was employed to screen differentially expressed genes in colonic tissue, followed by gene ontology(GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) enrichment analyses. Finally, Spearman correlation analysis was conducted to explore the association between differential microbiota and differential genes. ResultsCompared with the control group, the intestinal propulsion rate and fecal moisture content in the model group were significantly decreased(P<0.01), while serum levels of IL-6, TNF-α, and IL-2 were significantly elevated(P<0.01). HE staining showed damage and shedding of colonic mucosal epithelial cells, along with a reduction in goblet cells in the model group. In comparison with the model group, all treatment groups improved the pathological state of the colonic mucosa to varying degrees and reduced serum levels of IL-6, TNF-α, and IL-2(P<0.01). Among these, the high-dose group of AMR-AFI significantly increased the intestinal propulsion rate and fecal moisture content of rats(P<0.05, P<0.01). Further transcriptomic analysis revealed that a total of 104 differentially expressed genes were identified from comparisons between the model group and the control group, as well as between the model group and the high-dose group of AMR-AFI. These genes were mainly enriched in pathways closely related to STC pathogenesis, such as arachidonic acid metabolism and aldosterone-regulated sodium reabsorption. 16S rRNA sequencing results indicated that AMR-AFI reversed the structural imbalance of the gut microbiota in model mice, increased species richness, downregulated the relative abundance of pro-inflammatory bacteria such as Parasutterella, and enriched beneficial and butyrate-producing bacteria, including Lachnospiraceae_NK4A136_group, Ruminococcaceae, and Lachnospiraceae. Spearman correlation analysis further showed that the beneficial bacteria enriched in the AMR-AFI group were negatively correlated with genes involved in the arachidonic acid metabolic pathway and positively correlated with genes in the aldosterone-regulated sodium reabsorption pathway. In contrast, pro-inflammatory bacteria in the model group exhibited the opposite correlation trends. ConclusionAMR-AFI can effectively exert synergistic therapeutic effects on STC by regulating intestinal microbiota, arachidonic acid-mediated inflammatory metabolism, and aldosterone-regulated water-salt balance pathways.
2.Exploring Intervention Effect of Atractylodis Macrocephalae Rhizoma Processed with Aurantii Fructus Immaturus Juice on Slow-transit Constipation and Its "Microbiota-Metabolism" Synergistic Regulation Mechanism Based on Theory of "Spleen Governing Transportation and Transformation"
Dan LI ; Xiaoxia LIU ; Xiaofen WANG ; Zuxin HE ; Junnan WEI ; Yanqing LIU ; Yuxuan GAO ; Ping LUO ; Fang WANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(10):201-209
ObjectiveBased on the theory of "spleen governing transportation and transformation", this study investigates the efficacy of Atractylodis Macrocephalae Rhizoma processed with Aurantii Fructus Immaturus juice(AMR-AFI) in improving slow-transit constipation(STC), as well as the synergistic regulatory mechanism involving the microbiota-metabolism axis, thereby elucidating the scientific basis of its processing theory. MethodsAnimals were randomly divided into the control group, model group, positive drug(mosapride) group(3 mg·kg-1), and low-, medium-, and high-dose groups of AMR-AFI(3.9, 7.8, 15.6 g·kg-1). Except for the control group, the remaining five groups were induced with STC using loperamide hydrochloride. Following modeling, interventions were administered. All groups received continuous administration for 15 d, during which fecal samples, colon tissue, and serum were collected. Constipation improvement was assessed by measuring fecal moisture content and small intestinal propulsion rate, histological morphology of colonic tissue was observed via hematoxylin-eosin(HE) staining, and the levels of interleukin(IL)-6, tumor necrosis factor(TNF)-α, and IL-2 in serum were detected using enzyme-linked immunosorbent assay(ELISA). Furthermore, the microbial community structure in mouse feces was analyzed by 16S rRNA sequencing, while transcriptomic sequencing was employed to screen differentially expressed genes in colonic tissue, followed by gene ontology(GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) enrichment analyses. Finally, Spearman correlation analysis was conducted to explore the association between differential microbiota and differential genes. ResultsCompared with the control group, the intestinal propulsion rate and fecal moisture content in the model group were significantly decreased(P<0.01), while serum levels of IL-6, TNF-α, and IL-2 were significantly elevated(P<0.01). HE staining showed damage and shedding of colonic mucosal epithelial cells, along with a reduction in goblet cells in the model group. In comparison with the model group, all treatment groups improved the pathological state of the colonic mucosa to varying degrees and reduced serum levels of IL-6, TNF-α, and IL-2(P<0.01). Among these, the high-dose group of AMR-AFI significantly increased the intestinal propulsion rate and fecal moisture content of rats(P<0.05, P<0.01). Further transcriptomic analysis revealed that a total of 104 differentially expressed genes were identified from comparisons between the model group and the control group, as well as between the model group and the high-dose group of AMR-AFI. These genes were mainly enriched in pathways closely related to STC pathogenesis, such as arachidonic acid metabolism and aldosterone-regulated sodium reabsorption. 16S rRNA sequencing results indicated that AMR-AFI reversed the structural imbalance of the gut microbiota in model mice, increased species richness, downregulated the relative abundance of pro-inflammatory bacteria such as Parasutterella, and enriched beneficial and butyrate-producing bacteria, including Lachnospiraceae_NK4A136_group, Ruminococcaceae, and Lachnospiraceae. Spearman correlation analysis further showed that the beneficial bacteria enriched in the AMR-AFI group were negatively correlated with genes involved in the arachidonic acid metabolic pathway and positively correlated with genes in the aldosterone-regulated sodium reabsorption pathway. In contrast, pro-inflammatory bacteria in the model group exhibited the opposite correlation trends. ConclusionAMR-AFI can effectively exert synergistic therapeutic effects on STC by regulating intestinal microbiota, arachidonic acid-mediated inflammatory metabolism, and aldosterone-regulated water-salt balance pathways.
3.Development and validation of a prediction score for subtype diagnosis of primary aldosteronism.
Ping LIU ; Wei ZHANG ; Jiao WANG ; Hongfei JI ; Haibin WANG ; Lin ZHAO ; Jinbo HU ; Hang SHEN ; Yi LI ; Chunhua SONG ; Feng GUO ; Xiaojun MA ; Qingzhu WANG ; Zhankui JIA ; Xuepei ZHANG ; Mingwei SHAO ; Yi SONG ; Xunjie FAN ; Yuanyuan LUO ; Fangyi WEI ; Xiaotong WANG ; Yanyan ZHAO ; Guijun QIN
Chinese Medical Journal 2025;138(23):3206-3208
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Acupuncture Therapy on Dysphagia in Patients with Parkinson's Disease: A Randomized Controlled Study.
Hong-Ji ZENG ; Wei-Jia ZHAO ; Peng-Chao LUO ; Xu-Yang ZHANG ; Si-Yu LUO ; Yi LI ; He-Ping LI ; Liu-Gen WANG ; Xi ZENG
Chinese journal of integrative medicine 2025;31(3):261-269
OBJECTIVE:
To explore the effect of acupuncture therapy on dysphagia in patients with Parkinson's disease.
METHODS:
This randomized controlled study lasted 42 days and included 112 patients with Parkinson's disease and dysphagia. Participants were randomly assigned to the experimental and control groups (56 cases each group) using the completely randomized design, all under routine treatment. The experimental group was given acupuncture therapy. The primary outcome was Penetration-Aspiration Scale (PAS). The secondary outcomes were (1) Standardized Swallowing Assessment (SSA), and (2) nutritional status including body mass index (BMI), serum albumin, prealbumin, and hemoglobin. Adverse events were recorded as safety indicators.
RESULTS:
One participant quitted the study midway. There were no significant differences in baseline assessment (P>0.05). After treatment, both groups showed significant improvement in PAS, SSA and nutritional status except for BMI of the control group. There were significant differences between the two groups in the PAS for both paste and liquid, SSA (25.18±8.25 vs. 20.84±6.92), BMI (19.97±3.34 kg/m2vs. 21.26 ±2.38 kg/m2), serum albumin (35.16 ±5.29 g/L vs. 37.24 ±3.98 g/L), prealbumin (248.33 ±27.72 mg/L vs. 261.39 ±22.10 mg/L), hemoglobin (119.09±12.53 g/L vs. 126.67±13.97 g/L) (P<0.05). There were no severe adverse events during the study.
CONCLUSION:
The combination of routine treatment and acupuncture therapy can better improve dysphagia and nutritional status in patients with Parkinson's disease, than routine treatment solely. (registration No.
CLINICALTRIAL
gov NCT06199323).
Humans
;
Parkinson Disease/therapy*
;
Deglutition Disorders/physiopathology*
;
Acupuncture Therapy/adverse effects*
;
Male
;
Female
;
Aged
;
Middle Aged
;
Treatment Outcome
;
Nutritional Status
;
Body Mass Index
6.Quality evaluation of"Sangdi"based on HPLC fingerprints combined with chemometrics
Ping LIU ; Shi-ying LUO ; Meng-jia LI ; Xiao-yan TAN ; Jian-bin SUN ; Wei-zao LUO ; Ce TANG ; Yi ZHANG
Chinese Traditional Patent Medicine 2025;47(1):14-21
AIM To evaluate the quality of Tibetan medicine"Sangdi"based on HPLC fingerprints combined with chemometrics.METHODS The analysis was performed on a 30 ℃ thermostatic Welch Ultimate AQ-C18 column(250 mm × 4.6 mm,5 μm),with the mobile phase comprising of acetonitrile-0.2%phosphoric acid flowing at 1 mL/min in a gradient elution manner,and the detection wavelength was set at 245 nm,after which cluster analysis,principal component analysis and orthogonal partial least squares discriminant analysis were performed,the contents of gentiopicroside,sweroside,mangiferin,isoorientin,8-hydroxy-1,3,5-trimethoxyxanthone(R2)and 1,8-dihydroxy-3,7-dimethoxyxanthone(R3)were determined.RESULTS There were 18 common peaks in the fingerprints for 15 batches of samples with the similarities of more than 0.90.Six constituents showed good linear relationships within their own ranges(R 2 ≥ 0.999 2),whose average recoveries were 96.93%-103.58%with the RSDs of 0.82%-2.9%.Various batches of samples were clustered into 2 categories,4 principal components demonstrated the accumulative variance contribution rate of 86.404%,mangiferin,gentiopicroside and isoorientin were taken as quality difference markers.CONCLUSION This stable,reliable and reproducibe method can provide a reference for the comprehensive quality evaluation of"Sangdi".
7.Regulatory effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis via NF-κB/TGF-β1 signaling pathway
Cao NING ; Jiao-an PANG ; Xi TAN ; Yan-ping LUO ; Hui-yi WEI ; Bo HUANG ; Jia-guan WANG
Chinese Traditional Patent Medicine 2025;47(5):1477-1486
AIM To explore the effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis(CLF).METHODS 20 SD rats were randomly divided into the normal group,the model group,the ursodeoxycholic acid group(0.063 g/kg)and the Dahuang Lingxian Recipe group(4.8 g/kg),with 5 rats in each group.Except for those of the normal group,the rats of all other groups had open surgery of common bile duct ligation,followed by the gavage of corresponding drug two days later,and the procurement of the samples after gavage in the third week.The rats had their degree of liver fibrosis observed by HE and Masson stainings;their levels of serum total bile acid(TBA),alkaline phosphatase(AKP),γ-glutamyltransferase(γ-GT),alanine aminotransferase(ALT),aspartate aminotransferase(AST)and total bilirubin(TBil)measured by the kit;their hepatic percentage of TGF-β1,p-Smad2 and p-Smad3 positive cells detected by immunofluorescence and immunohistochemical staining;their.hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA detected by Western blot and RT-qPCR;their levels of helper T cell 1(Th1)and helper T cell 2(Th2)in peripheral blood detected by flow cytometry,and their ratio of Th1/Th2 calculated as well.RESULTS Compared with the model group,the groups intervened with either ursodeoxycholic acid or Dahuang Lingxian Recipe displayed well-ordered liver cells,hepatic lobules and hepatic cords;a small amount of fatty degeneration;significantly reduced connective hyperplasia of hepatic fibers;significantly narrowed fibrous cords;a small amount of blue fibrous septa;greatly improved pathological injuries including inflammatory infiltration of central vein and portal area;decreased levels of serum TBA,TBil,AKP,γ-GT,ALT and AST(P<0.05);decreased hepatic expressions of TGF-β1,p-Smad2 and p-Smad3(P<0.05);decreased hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA(P<0.05);and increased counts of Th1 cells in peripheral blood,decreased counts of Th2 cells,resultsing increased Th1/Th2 ratio(P<0.05).And an even better effect was observed in the Dahuang Lingxian Recipe group.CONCLUSION Dahuang Lingxian Recipe can reduce or reverse CLF by inhibiting hepatic stellate cell activation through maintaining Th1/Th2 cell immune balance via the NF-κB/TGF-β1 signaling pathway.
8.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.
9.Effects of repetitive transcranial magnetic stimulation on sleep disorder and examination results of recruits
Yanbin ZHAN ; Yijie ZHAO ; Hui YUAN ; Longjuan YU ; Lei CHEN ; Benqiang DENG ; Wei WANG ; Shudan LUO ; Ping ZHANG
Journal of Navy Medicine 2025;46(5):440-445
Objective To explore the effect of repetitive transcranial magnetic stimulation(rTMS)on the sleep disorder and examination results of recruits.Methods At a training base,the Pittsburgh Sleep Quality Index(PSQI)was used to screen the recruits with sleep disorders(total score of PSQI>7).The recruits were randomly assigned to rTMS group or sham rTMS group.Both groups received cognitive and behavioral intervention therapy,including sleep health education and relaxation training.Moreover,the rTMS group was treated with rTMS at the right posterior parietal lobe by continuous theta burst stimulation(cTBS)twice a day at an interval of at least 50 min for 5 consecutive days as a course of treatment with an interval of 2 days for a total of 2 courses of treatment.The coil position and stimulus intensity of sham rTMS group were consistent with the rTMS group,but the head of subjects was perpendicular to the coil plane and there was no effective stimulation.Before and after treatment,PSQI,self-rating depression scale,generalized anxiety disorder-7 and health questionnaire-15 were used to evaluate the sleep,mood and physical state of the recruits.The training result was assessed one month after treatment.The total effective rate of PSQI improvement and examination results were compared between the two groups.The independent influencing factors of excellent examination result were analyzed.Results Among 351 recruits,83 with sleep disorders completed treatment and follow-up.There were 40 patients in the rTMS group and 43 patients in the sham rTMS group.There was no significant difference between the two groups at baseline.After treatment,the total effective rate of PSQI improvement in the rTMS group was higher than that in the sham rTMS group(77.50%vs 53.49%,P=0.022).The average examination score and excellent rate of the rTMS group were higher than those of the sham rTMS group(91.58±3.19 vs 89.47±4.67,P=0.020;85%vs 65.12%,P=0.037).Logistic regression analysis showed that the treatment mode(rTMS group)was the independent influencing factor of excellent examination results(P=0.032).Conclusion rTMS can effectively and safely improve the sleep disorders and examination results of recruits.rTMS may play a positive role in improving the learning and training effect of recruits,which needs to be further proved.
10.Preliminary clinical exploration of endoscopic ultrasound combined with modified endoscopic mucosal resection in the treatment of rectal neuroendocrine tumors
Ping LUO ; Aimin LIU ; Zhiqiang YI ; Qiaomu LUO ; Sha WEI ; Jing KUANG ; Jing TANG
Chongqing Medicine 2025;54(4):893-897
Objective To investigate the clinical feasibility and safety of endoscopic ultrasonography(EUS)combined with modified endoscopic mucosal resection(EMR)in the treatment of rectal neuroendo-crine tumors(RNETs).Methods A total of 48 patients diagnosed with RNETs by colonoscopy in the depart-ment of gastroenterology in this hospital from December 2021 to June 2023 were selected as the study objects.Patients were randomly divided into the study group(EUS combined with modified EMR,n=16),the control 1 group(traditional EMR,n=16)and the control 2 group[endoscopic submucosal dissection(ESD),n=16].The operation time,R0 resection rate and postoperative complications of each group were observed.Endoscop-ic ultrasonography was followed up 3 and 6 months after surgery to determine whether there was any recur-rence.Results The operative time of the study group[(17.813±0.379)min]was significantly shorter than that of the control 2 group[(36.250±3.296)min],the difference was statistically significant(P<0.05),but compared with the control 1 group[(16.375±1.996)min],there was no significant difference(P>0.05).The incidence of complications in the study group(6.2%)was significantly lower than that in the control 2 group(37.5%),the difference was statistically significant(P<0.05).while the incidence of complications in the study group was not significantly higher than that in the control 1 group(12.5%,P>0.05).R0 removal rate in the study group(93.8%)was significantly higher than that in the control 1 group(62.5%)and the control 2 group(75.0%),the difference was statistically significant(P<0.05).Conclusion EUS combined with modified EMR has more advantages than EMR and ESD in the treatment of RNETs,and has certain fea-sibility and safety,which is convenient for clinical application.

Result Analysis
Print
Save
E-mail