ObjectiveTo explore the effect of oral sodium butyrate on skeletal muscle atrophy in CT26 tumor mice through the gut microbiota-skeletal muscle axis and its potential mechanism. MethodsSixty SPF BALB/c male mice aged 8 weeks were randomly divided into a normal control group (NC, n=18) and a ABX-depleted group (ABX, n=42). The ABX mice were pretreated with a quadruple antibiotic cocktail via oral gavage (0.2 ml per administration, once daily, 6 d per week, for 2 weeks), whereas NC received an equal volume of sterile water. The quadruple antibiotic cocktail consisted of metronidazole (1 g/L), vancomycin (0.5 g/L), ampicillin (1 g/L), and gentamicin (1 g/L). Following successful pretreatment, six mice from each group were randomly selected for gut microbiota sequencing analysis and designated as the Abx group and the NC0 group, respectively. Theremaining mice in ABX were subcutaneously inoculated in the dorsum with 0.2 ml of CT26 cell suspension (at a cell density of 1×10⁷/ml). Then these mice were randomly allocated into three subgroups: a control tumor bearing model group (0_NaB, n=12), a tumor-bearing model group receiving low-dose oral sodium butyrate (L_NaB, n=12), a tumor-bearing model group receiving high-dose oral sodium butyrate (H_NaB, n=12). And mice in NC were inoculated at the same site with 0.2 ml of normal saline. The administration dose for L_NaB was 0.3 g/(kg·d), that for H_NaB was 0.5 g/(kg·d), while NC and 0_NaB were given the same volume of normal saline (0.2ml per time, once daily, 6 d per week, for 4 weeks). The general condition of mice was monitored, and forelimb grip strength gastrocnemius muscle mass and its muscle fiber cross-sectional area were measured for each group. The structural changes in gut microbiota were assessed by 16S rRNA sequencing of cecal contents. Pathological alterations in the intestinal wall were examined via HE staining. Serum and gastrocnemius muscle levels of TNF‑α, IL-6, IL-1β, and LPS were quantified using ELISA. The protein expression of ZO-1 and occludin in the small intestine, as well as proteins associated with the TLR4/MyD88/NF-κB signaling pathway in the gastrocnemius muscle, were detected by Western blot analysis. Results(1) The alpha-diversity in Abx was significantly lower than that in NC0 (P<0.01), a significant decrease of the mass and muscle fiber cross-sectional area of the gastrocnemius (P<0.01), with the majority of gut microbiota being effectively depleted. (2) Compared with NC, the subcutaneous tumors of mice in 0_NaB were prominent, a significant increase of the mass and muscle fiber cross-sectional area of the gastrocnemius, accompanied by a significant decrease in body weight at the end of the 3th and 4th week (P<0.05), and a significant weakening of the forelimb grasping strength at the 5th and 6th week (P<0.01). Compared with 0_NaB, the tumor mass of mice in L_NaB and H_NaB showed a significant decreasing trend, and the grip strength of the forelimbs significantly increased at the 5th and 6th week (P<0.05, P<0.01). (3) Compared with 0_NaB, the Shannon and Observed species indices in α diversity of L_NaB and H_NaB were significantly increased (P<0.05). At the genus level, compared with 0_NaB, L_NaB exhibited a significant decrease in the relative abundance of Parasutterella (P< 0.01), while H_NaB showed significant reductions in the relative abundances of both Escherichia-Shigella and Parasutterella (P < 0.01). (4) Compared with 0_NaB, the small intestinal tissue structure in L_NaB and H_NaB was more intact, the infiltration of inflammatory cells was significantly reduced, and the capillaries were slightly dilated. The expression levels of ZO-1 and occludin proteins in L_NaB were significantly increased (P<0.01). (5) The LPS concentration in the gastrocnemius muscle and the protein expression levels of TLR4, MyD88, p-IκBα, and p-NF‑κB p65 in L_NaB and H_NaB were significantly lower than those in 0_NaB (P<0.05). The serum TNF‑α concentration in H_NaB and TNF-α concentration in the gastrocnemius muscle of the L_NaB and H_NaB were significantly lower than those in 0_NaB (P<0.05, P<0.01, P<0.01). ConclusionOral administration of NaB can improve gut microbiota α diversity, adjusting its composition, improving intestinal mucosal barrier function, reducing the LPS-induced pro-inflammatory response, and delaying skeletal muscle atrophy. The underlying mechanism may involve down regulation of TLR4/MyD88/NF-κB signaling in skeletal muscle.

According to traditional Chinese medicine （TCM） theory， impaired spleen transportation function disrupts nutrient distribution， causing metabolic accumulation of lipids that transform into pathogenic phlegm-dampness. These pathological factors disseminate through the San Jiao and obstruct meridian pathways， ultimately forming the pathogenesis described as "all disorders involve phlegm". Phlegm and dampness share common pathogenic origins but manifest distinct clinical manifestations. Dampness， as the precursor， may congeal into phlegm， while existing phlegm accumulation can further exacerbate dampness stagnation， thereby establishing a self-perpetuating pathological cycle. Modern medical research has confirmed that the essence of "phlegm-dampness" syndrome is closely associated with energy metabolism disorders， serving as a common pathological basis for metabolic syndrome， type 2 diabetes mellitus， atherosclerosis， and other major chronic diseases. As a crucial vehicle for medical experimental research， disease-syndrome combination animal models serve as an indispensable means to advance the modernization of TCM. Currently， based on classical theories such as "rich and greasy foods produce phlegm" and "physical coldness combined with cold consumption causes external pathogens to invade the skin and hair， thereby generating internal dampness"， researchers primarily employ two paradigms to construct animal models of phlegm-turbidity， dampness obstruction， and phlegm-dampness syndromes： the first involves simulating TCM etiological factors （through methods like dietary irregularities， imblanace between work and rest， and combined internal-external dampness exposure）， while the second combines disease with syndrome differentiation （inducing pathological changes through physical， chemical， or biological interventions）. Through comprehensive evaluation incorporating macroscopic observation and microscopic index detection， model animals undergo systematic biological and pathological assessment， with further syndrome type verification achieved via the "prescription-based syndrome detection" approach. However， existing models still exhibit significant deficiencies in both the standardization of modeling methodologies and the systematization of evaluation criteria. This paper reviews the strategies for constructing "phlegm-dampness" syndrome animal models and their corresponding evaluation indices， focusing on the pathological correlations among different modeling approaches. The aim is to provide methodological guidance for research on TCM syndromes related to "phlegm-dampness" syndrome and to support the development of TCM therapies for resolving phlegm and eliminating dampness. This study not only contributes to advancing the standardization of TCM syndrome research but also provides crucial technical support for the modernization of TCM.

OBJECTIVE: This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study. METHODS: A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants. RESULTS: Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m ²) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m ²) and obesity (≥ 28.0 kg/m ²) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m ² ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses. CONCLUSION This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans ; Body Mass Index ; China/epidemiology* ; Male ; Female ; Middle Aged ; Prospective Studies ; Rural Population/statistics & numerical data* ; Aged ; Follow-Up Studies ; Adult ; Mortality ; Cause of Death ; Obesity/mortality* ; Overweight/mortality*

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.