Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

Objective To compare the cost-effectiveness between sodium valproate and levetiracetam in the treatment of childhood epilepsy and provide an economic basis for clinical medication choices. Methods A cost-effectiveness analysis was conducted using a decision tree model to compare the effectiveness and drug costs of sodium valproate and levetiracetam in treating childhood epilepsy. Single-factor sensitivity analysis and probabilistic sensitivity analysis were used to assess the impact of parameter variations on the study results. Results The treatment cost of levetiracetam was significantly higher than that of sodium valproate. The incremental cost-effectiveness ratio （ICER） of levetiracetam compared to sodium valproate was ¥8 628.43. Sensitivity analysis results were consistent with the base-case analysis. The probabilistic sensitivity analysis showed that, over a 6-month treatment period, levetiracetam became a more cost-effective option when the willingness-to-pay （WTP） threshold was ¥9,000 or higher. One-way sensitivity analysis revealed that the price of levetiracetam was the most influential factor affecting the ICER. Conclusion When the WTP per effective pediatric epilepsy case is ¥9,000 or higher, levetiracetam demonstrates a cost-effectiveness advantage.

PURPOSE: To assess the relationship between dislocation and functional outcomes in supination-external rotation (SER) ankle fractures. METHODS: A retrospective case series study was performed on patients with ankle fractures treated surgically at a large trauma center from January 2015 to December 2021. The inclusion criteria were young and middle-aged patients of 18 - 65 years with SER ankle fractures that can be classified by Lauge-Hansen classification and underwent surgery at our trauma center. Exclusion criteria were serious life-threatening diseases, open fractures, fractures delayed for more than 3 weeks, fracture sites ≥ 2, etc. Then patients were divided into dislocation and no-dislocation groups. Patient demographics, injury characteristics, surgery-related outcomes, and postoperative functional outcomes were collected and analyzed. The functional outcomes of SER ankle fractures were assessed postoperatively at 1-year face-to-face follow-up using the foot and ankle outcome score (FAOS) and American Orthopedic Foot and Ankle Society ankle hindfoot score and by 2 experienced orthopedic physicians. Relevant data were analyzed using SPSS version 22.0 by Chi-square or t-test. RESULTS: During the study period, there were 371 ankle fractures. Among them, 190 (51.2%) were SER patterns with 69 (36.3%) combined with dislocations. Compared with the no-dislocation group, the dislocation group showed no statistically significant differences in gender, age composition, fracture type, diabetes, or smoking history, preoperative waiting time, operation time, and length of hospital stay (all p > 0.05), but a significantly higher Lauge-Hansen injury grade (p < 0.001) and syndesmotic screw fixation rate (p = 0.033). Moreover, the functional recovery was poorer, revealing a significantly lower FAOS in the sport/rec scale (p < 0.001). Subgroup analysis showed that among SER IV ankle fracture patients, FAOS was much lower in pain (p = 0.042) and sport/rec scales (p < 0.001) for those with dislocations. American Orthopedic Foot and Ankle Society ankle hindfoot score revealed no significant difference between dislocation and no-dislocation patients. CONCLUSION Dislocation in SER ankle fractures suggests more severe injury and negatively affects functional recovery, mainly manifested as more pain and poorer motor function, especially in SER IV ankle cases.
Humans ; Ankle Fractures/physiopathology* ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Supination ; Aged ; Young Adult ; Rotation ; Joint Dislocations/surgery* ; Fracture Fixation, Internal/methods* ; Adolescent ; Recovery of Function ; Treatment Outcome

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Allergen-specific immunotherapy（AIT） remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis（AR）. Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group（CRRCG） convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans ; Allergens/immunology* ; China ; Consensus ; Desensitization, Immunologic ; Immunoglobulin E ; Quality of Life ; Rhinitis, Allergic/therapy* ; Treatment Outcome ; East Asian People

Objective:Based on the activities of Helicobacter pylori ( HP) screening in Jiangsu Province in 2024, to evaluate the overall management ability in HP screening, testing, treatment and follow-up in primary medical facilities. Methods:From May 15 to October 18, 2024, the data of HP screening and treatment were retrospectively collected from 79 township health centers, community hospitals, and community health service centers in Jiangsu Province. The rates of screening completion, urea breath test (UBT) completion, treatment rate, UBT follow-up completion, and HP eradication were analyzed. Chi-square test was used for statistical analysis. Results:The completion rate of HP screening was 94.45% (15 489/16 400). There were 6 604 cases (42.64%) with serum HP antibody positive among the 15 489 individuals who completed screening. The positive rate of serum HP antibody in males was higher than that in females (44.77%, 2 643/5 904 vs. 41.32%, 3 961/9 585), and the difference was statistically significant ( χ2=17.69, P<0.001). The positive rates of serum HP antibody in screened individuals aged 18 to 19, 20 to 39, 40 to 59, and 60 to 75 years old were 22.38% (32/143), 36.12% (1 168/3 234), 45.01% (3 240/7 199), and 44.05% (2 164/4 913), respectively, and the difference was statistically significant( χ2=100.73, P<0.001). Among the 6 604 HP antibody-positive individuals, 4 381 cases completed UBT, with a UBT completion rate of 66.34% (4 381/6 604). There were 3 197 individuals with both HP serum antibody and UBT positive, the consistency rate of the 2 tests was 72.97% (3 197/4 381). Totally 2 737 cases received treatment, with a treatment completion rate of 85.61% (2 737/3 197); 2 327 individuals underwent UBT follow-up, with a follow-up completion rate of 85.02% (2 327/2 737). During follow-up, the result of UBT was negative in 1 982 individuals, and the HP eradication rate was 85.17% (1 982/2 327). Conclusions:There are deficiencies in the completion rate of HP screening, testing, treatment, and follow-up in primary hospitals, especially in the completion rate of UBT, which may be related to cognitive insufficiency for HP in residents. It is necessary to strengthen the training of physicians′ abilities in primary hospitals, optimize the allocation of drug resources, enhance health education, and increase residents′ participation and compliance.

Objective To develop a deep learning model based on fundus retinal images to improve the detection rate of mild cognitive impairment(MCI)in patients with coronary heart disease,achieve early intervention and improve prognosis.Methods The study was a single-center cross-sectional study that retrospectively included patients diagnosed with coronary heart disease(CHD)by coronary angiography(≥50％ stenosis of at least one coronary vessel)from Beijing Anzhen Hospital between November 2021 and December 2022.The whole data set was randomly divided into the training set and the testing set according to the ratio of 8∶2 for model development.After that,the patient data of the same center from January 2023 to April 2023 were included in the time verification method to verify the model.The diagnostic criteria for MCI were MMSE＜27 or MoCA＜26.Four kinds of convolutional neural network(CNN)architectures were used to train fundus images,and a comprehensive vision model of MCI detection was established through model integration.The area under the curve(AUC),sensitivity and specificity of the receiver operating curve(ROC)were used to evaluate the performance of the AI model.Results We collected 5 880 eligible fundus images from 3 368 CHD patients.Based on the results of the MMSE scale,the algorithm was labeled,including 2 898 males and 527 MCI patients.The AUC of the deep learning model in the test group is 0.733(95％CI 0.688-0.778),and the sensitivity of the algorithm in the test group is 0.577(95％CI 0.528-0.625)by using the operating point with the maximum sum of sensitivity and specificity.With a specificity of 0.758(95％CI 0.714-0.802),corresponding to a validated AUC of 0.710(95％CI 0.601-0.818).Based on the results of the MoCA scale,the algorithm labels 2 437 males and 1 626 MCI patients.The AUC of the deep learning model in the test group was 0.702(95％CI 0.671-0.733).The operating point with the maximum sum of sensitivity and specificity was selected,and the sensitivity of the algorithm was 0.749(95％CI 0.719-0.778)and the specificity was 0.561(95％CI 0.527-0.595),corresponding to the AUC value of the verification group was 0.674(95％CI 0.622-0.726).Conclusions The deep learning algorithm model based on fundus images has good diagnostic performance,and may be used as a new non-invasive,convenient and rapid screening method for MCI in CHD population.

Objective To investigate the clinical characteristics of preoperative intestinal symptoms in patients with bowel endometriosis and to compare the effects of shaving versus segmental bowel resection on postoperative intestinal function.Methods A total of 105 patients diagnosed with bowel endometriosis and treated by the same surgical team at the Obstetrics and Gynecology Hospital,Fudan University between Aug 1,2013 and Dec 30,2017 were prospectively enrolled in this study.Clinical data were collected via outpatient visits and telephone follow-ups at four time points:preoperative(T0)and postoperative(T1:Nov 2018;T2:Nov 2020;T3:Apr 2024).The primary outcome was bowel symptoms and gastrointestinal function scores;secondary outcome was pain scores.A generalized estimating equation(GEE)model was used to analyze the interaction effect of surgical approach and follow-up time on outcomes.Results Ultimately,a total of 89 patients were included(15.24%loss to follow-up),among whom 79 patients(88.76%)underwent shaving excision.Preoperatively,46 patients(51.68%)presented with bowel symptoms,primarily anus bulge(21 cases,46.65%)and diarrhea(15 cases,32.61%)during menstruation.Postoperatively,there was a significant increase in constipation rates(T1:71.43%;T2:50.00%;T3:72.00%).Both surgical groups exhibited significant improvements in dysmenorrhea,gastrointestinal discomfort scores as well as gastrointestinal quality of life index(P<0.000 5).However,the segmental resection group had significantly higher scores for low anterior resection syndrome,constipation compared with the shaving excision group(P=0.02 and P=0.05).Conclusion Approximately half of the patients with bowel endometriosis exhibit typical bowel symptoms preoperatively,such as anus bulge and diarrhea.Both shaving excision and segmental resection effectively alleviate pain;however,shaving excision demonstrates an advantage regarding preservation of bowel function,whereas segmental resection may elevate risks associated with postoperative constipation or altered defecation patterns due to structural changes.The selection of surgical approach should carefully balance lesion removal and functional preservation,moreover,be sure that potential risks are thoroughly informed to patients prior to surgery.