ObjectiveHepatocellular carcinoma (HCC) represents 90% of all primary liver cancers. The main risk factors associated with HCC include viral hepatitis (B and/or C), alcohol abuse, and metabolic dysfunction-associated steatotic liver disease (MASLD), which progressively advance to liver fibrosis, cirrhosis, and ultimately evolve into HCC. Surgical resection represents the most effective treatment for HCC, while recent advances in immunotherapy, including immune checkpoint inhibitors and adoptive cell therapies, have provided improved treatment prospects for patients with unresectable HCC. However, the complex metabolic heterogeneity of HCC limits the therapeutic efficacy. Metabolic intermediates acyl-CoA not only provide energy and substrates for numerous biochemical reactions but also serve as donors for protein lysine acylation, a major class of post-translational modification (PTM). Therefore, a deeper understanding of the molecular mechanisms underlying protein lysine acylation and hepatocarcinogenesis is urgently needed. MethodsThe levels of protein lysine acylation and silence information regulator 5 (SIRT5) expression levels in clinical HCC samples were analyzed by Western blot. Quantitative malonylome and succinylome of HCC samples were analyzed by antibody-based affinity enrichment coupled with tandem mass spectrometry. The proliferation of HCC cells was analyzed with Cell Counting Kit-8 (CCK-8) assays, the apoptosis was quantified by Annexin V-FITC/propidium iodide (PI) staining coupled with flow cytometry, and the ability of cells to migrate was assayed by Transwell assays. The enzymatic activity of glutathione S-transferase Mu 1 (GSTM1) was quantified. Transgenic mice with hepatic overexpression of SIRT5 were constructed using CRISPR-Cas9, and primary hepatocarcinogenesis was induced by administration of diethylnitrosamine. ResultsWestern blot analysis indicated that the expression level of SIRT5 was elevated in clinical samples from HCC patients, and the levels of lysine malonylation, glutarylation, and succinylation were significantly reduced in HCC tissues. Knockout of SIRT5 in MHCC-97H and MHCC-97L hepatoma cells suppressed cell proliferation, and increased the percentage of apoptotic cells significantly. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the differentially malonylome and succinylome of HCC samples revealed significant enrichment in two major classes of biological processes: core energy metabolism (e.g., glycolysis/gluconeogenesis, tricarboxylic acid metabolic process, fatty acid beta oxidation) and detoxification and oxidative stress response (e.g., response to toxic substance, chemical carcinogenesis, reactive oxygen species (ROS)). SIRT5 removes malonylation from lysine residues in GSTM1 and restores its detoxification activity, which is crucial for the survival of hepatocytes under stressed conditions. More importantly, in vivo experiment indicated that hepatic-specific overexpression of SIRT5 in mice accelerated diethylnitrosamine-induced liver fibrosis and hepatocarcinogenesis, indicating the critical role of SIRT5 in HCC progression. ConclusionThis study highlights the previously unrecognized SIRT5-GSTM1 axis as a key regulator in hepatocarcinogenesis, and suggests a potential target for the treatment of patients with HCC.

This paper reported a type 1 diabetes patient who had severe diabetic nephropathy, retinopathy, hypertension, and hypothyroidism before pregnancy. The patient's blood glucose control was poor before pregnancy, and the complications were not properly treated. This was an unintended pregnancy, with a pre-pregnancy glycated hemoglobin A1c of 7.8% and early pregnancy urine protein of 3.81-4.53 g/24 h. Considering the patient's poor blood glucose control before pregnancy and the lack of proper treatment for multiple complications including nephropathy, a multidisciplinary consultation at an external hospital recommended termination of the pregnancy. However, the patient was determined to continue the pregnancy and was referred to Peking University First Hospital. Through strict blood glucose control, monitoring and evaluation of complications, and comprehensive management, the patient's blood glucose and blood pressure were well controlled during pregnancy. Regular monitoring of urine protein, renal function, and ocular fundus was conducted. At 31 weeks and 4 days of gestation, the patient's 24-hour urine protein significantly increased. After promoting fetal lung maturity, a cesarean section was performed at 34 weeks and 1 day of gestation, resulting in a successful delivery with good maternal and neonatal outcomes. At the 42-day postpartum follow-up, the patient's blood glucose and blood pressure were stable, urine protein returned to pre-pregnancy levels, and the infant was in good general condition.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

Objective:To explore the safety and efficacy of intraosseous regional administration (IORA) of vancomycin for preventing infection in primary total knee arthroplasty (TKA).Methods:A total of 124 patients with knee osteoarthritis undergoing TKA between February 2024 and May 2024 at nine hospitals were enrolled. Preoperative infection prophylaxis involved either IORA (0.5 g vancomycin administered via intraosseous regional infusion before incision) or intravenous infusion (1 g vancomycin via peripheral vein). The IORA group included 15 males and 47 females with a median age of 66.5 years (range, 60.0-70.0 years), while the intravenous group included 14 males and 48 females with a median age of 66.0 years (range, 61.8-70.3 years) years. Intraoperative samples were collected including fat and synovium tissues after incision, before prosthesis placement, and after tourniquet release; distal femoral cancellous bone during femoral osteotomy; proximal tibial cancellous bone during tibial osteotomy; proximal intercondylar cancellous bone before prosthesis placement; and peripheral blood from non-infused arms at surgery initiation and after tourniquet release. Vancomycin concentrations were measured using liquid chromatography-tandem mass spectrometry. Vital sign changes were recorded from admission to 5~10 minutes post-IORA (IORA group) or post-incision (intravenous group). Follow-ups were conducted on postoperative day 1 and 3, and at 1 and 3 months, to document complications including IORA-related adverse events, periprosthetic joint infections, surgical site infections, red man syndrome, acute kidney injury, deep vein thrombosis and so on.Results:Vancomycin concentrations in bone, fat, and synovial tissue samples were significantly higher in the IORA group than in the intravenous group ( P<0.05), while vancomycin concentrations in blood samples were significantly lower in the IORA group than in the intravenous group ( P<0.05). Only 7.3%(41/558) of tissue samples in the IORA group had vancomycin concentrations below 2.0 μg/g (the minimum inhibitory concentration of vancomycin against coagulase-negative staphylococcus), compared to 59.3%(331/558) in the intravenous group (χ 2=11.285, P<0.001). In the intravenous group, 16.9%(21/124) of blood samples had vancomycin concentrations exceeding 15.0 mg/L (the threshold associated with a significantly increased risk of nephrotoxicity), while all concentrations in the IORA group were below this threshold, the difference was statistically significant (χ 2=22.943, P<0.001). There were no statistically significant difference ( P>0.05) in vital signs changes before and after vancomycin administration between the two groups. Two patients in the intravenous group experienced incision exudate, while no other related complications occurred in either group. Conclusions:Compared to the traditional intravenous infusion of 1 g vancomycin, intraosseous injection of a low dose (0.5 g) of vancomycin achieves higher local tissue concentrations in the knee joint with a lower incidence of adverse reactions and is safe for infection prophylaxis. Despite guidelines not recommending the routine use of vancomycin for preventing infection after primary TKA, intraosseous injection of 0.5 g vancomycin may be considered intraoperatively for primary TKA in the following scenarios: patients in medical institutions with a high prevalence of methicillin-resistant staphylococcus aureus (MRSA) infections, patients with potential preoperative MRSA colonization, or patients with cephalosporin allergy.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective To explore the effect of rotenone exposure on the metabolic homeostasis of nicotinamide adenine dinucleotide(NAD+)in dopaminergic neurons of the rat mid-brain striatum,and investigate the effect of exogenous NAD+intervention on the cellular damage response of dopaminergic neurons induced by rotenone.Methods Male SD rats(8 weeks old,200～250 g)were divided into a control group using a table of random numbers,a rotenone exposure group,an NAD+-intervention group,and an NAD+group.An intoxication model was established in the rotenone exposure group.NAD+(250 mg/kg)was administered simultaneously with rotenone exposure in the NAD+-intervention group.The NAD+group was only given NAD+,while the control group received no intervention.After modeling,open field test was performed to evaluate behavioral changes.After scarification,serum samples and mid-brain striatal tissues were collected.HE staining was used to observe the morphology of dopaminergic neurons in the striatum.The NAD+content in the tissues was detected with NAD+/NADH kit.Western blotting was employed to determine the contents of tyrosine hydroxylase(TH),nicotinamide phosphoribosyltransferase(NAMPT),nicotinamide mononucleotide adenylyltransferase(NMNAT),and solute carrier family 25 member A51(SLC25A51).ELISA was utilized to measure the content of dopamine in the striatal tissues.Immunohistochemical staining was applied to observe the distribution and contents of TH proteins in the striatal tissues of each group.Results Rotenone exposure significantly affected the vital signs and motor abilities of rats,induced disorderly-arranged,atrophy and deformed neurons in the striatal tissue,decreased the content of TH,rate-limiting enzyme for dopamine synthesis,by approximately 29%(P<0.01),the content of dopamine by about 42%,and that of NAD+by almost 50%(P<0.01),while increased the NADH/NAD+ratio(P<0.01).After exposure,the content of NAMPT,an enzyme related to NAD+synthesis,was decreased by 26%(P<0.05),the contents of NMNAT1-3 and SLC25A51,mitochondrial transporters of NAD+by approximately 21%,38%,43%,and 21%,respectively(P<0.01).Exogenous NAD+intervention improved the motor function of exposure rats and the morphology of dopaminergic neurons in the mid-brain striatal tissue,and restored the content of TH in the striatal tissue significantly by 12.8%(P<0.05),and the content of dopamine by 20.9%(P<0.05).Conclusion Rotenone disrupts the NAD+homeostasis in dopaminergic neurons by inhibiting the NAD+synthesis and transport pathways in the mid-brain striatal tissues,while exogenous NAD+intervention can effectively alleviate the dopaminergic neuron damage induced by rotenone exposure.

PURPOSE: To assess the relationship between dislocation and functional outcomes in supination-external rotation (SER) ankle fractures. METHODS: A retrospective case series study was performed on patients with ankle fractures treated surgically at a large trauma center from January 2015 to December 2021. The inclusion criteria were young and middle-aged patients of 18 - 65 years with SER ankle fractures that can be classified by Lauge-Hansen classification and underwent surgery at our trauma center. Exclusion criteria were serious life-threatening diseases, open fractures, fractures delayed for more than 3 weeks, fracture sites ≥ 2, etc. Then patients were divided into dislocation and no-dislocation groups. Patient demographics, injury characteristics, surgery-related outcomes, and postoperative functional outcomes were collected and analyzed. The functional outcomes of SER ankle fractures were assessed postoperatively at 1-year face-to-face follow-up using the foot and ankle outcome score (FAOS) and American Orthopedic Foot and Ankle Society ankle hindfoot score and by 2 experienced orthopedic physicians. Relevant data were analyzed using SPSS version 22.0 by Chi-square or t-test. RESULTS: During the study period, there were 371 ankle fractures. Among them, 190 (51.2%) were SER patterns with 69 (36.3%) combined with dislocations. Compared with the no-dislocation group, the dislocation group showed no statistically significant differences in gender, age composition, fracture type, diabetes, or smoking history, preoperative waiting time, operation time, and length of hospital stay (all p > 0.05), but a significantly higher Lauge-Hansen injury grade (p < 0.001) and syndesmotic screw fixation rate (p = 0.033). Moreover, the functional recovery was poorer, revealing a significantly lower FAOS in the sport/rec scale (p < 0.001). Subgroup analysis showed that among SER IV ankle fracture patients, FAOS was much lower in pain (p = 0.042) and sport/rec scales (p < 0.001) for those with dislocations. American Orthopedic Foot and Ankle Society ankle hindfoot score revealed no significant difference between dislocation and no-dislocation patients. CONCLUSION Dislocation in SER ankle fractures suggests more severe injury and negatively affects functional recovery, mainly manifested as more pain and poorer motor function, especially in SER IV ankle cases.
Humans ; Ankle Fractures/physiopathology* ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Supination ; Aged ; Young Adult ; Rotation ; Joint Dislocations/surgery* ; Fracture Fixation, Internal/methods* ; Adolescent ; Recovery of Function ; Treatment Outcome

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test