Objective To compare the cost-effectiveness between sodium valproate and levetiracetam in the treatment of childhood epilepsy and provide an economic basis for clinical medication choices. Methods A cost-effectiveness analysis was conducted using a decision tree model to compare the effectiveness and drug costs of sodium valproate and levetiracetam in treating childhood epilepsy. Single-factor sensitivity analysis and probabilistic sensitivity analysis were used to assess the impact of parameter variations on the study results. Results The treatment cost of levetiracetam was significantly higher than that of sodium valproate. The incremental cost-effectiveness ratio （ICER） of levetiracetam compared to sodium valproate was ¥8 628.43. Sensitivity analysis results were consistent with the base-case analysis. The probabilistic sensitivity analysis showed that, over a 6-month treatment period, levetiracetam became a more cost-effective option when the willingness-to-pay （WTP） threshold was ¥9,000 or higher. One-way sensitivity analysis revealed that the price of levetiracetam was the most influential factor affecting the ICER. Conclusion When the WTP per effective pediatric epilepsy case is ¥9,000 or higher, levetiracetam demonstrates a cost-effectiveness advantage.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

PURPOSE: To assess the relationship between dislocation and functional outcomes in supination-external rotation (SER) ankle fractures. METHODS: A retrospective case series study was performed on patients with ankle fractures treated surgically at a large trauma center from January 2015 to December 2021. The inclusion criteria were young and middle-aged patients of 18 - 65 years with SER ankle fractures that can be classified by Lauge-Hansen classification and underwent surgery at our trauma center. Exclusion criteria were serious life-threatening diseases, open fractures, fractures delayed for more than 3 weeks, fracture sites ≥ 2, etc. Then patients were divided into dislocation and no-dislocation groups. Patient demographics, injury characteristics, surgery-related outcomes, and postoperative functional outcomes were collected and analyzed. The functional outcomes of SER ankle fractures were assessed postoperatively at 1-year face-to-face follow-up using the foot and ankle outcome score (FAOS) and American Orthopedic Foot and Ankle Society ankle hindfoot score and by 2 experienced orthopedic physicians. Relevant data were analyzed using SPSS version 22.0 by Chi-square or t-test. RESULTS: During the study period, there were 371 ankle fractures. Among them, 190 (51.2%) were SER patterns with 69 (36.3%) combined with dislocations. Compared with the no-dislocation group, the dislocation group showed no statistically significant differences in gender, age composition, fracture type, diabetes, or smoking history, preoperative waiting time, operation time, and length of hospital stay (all p > 0.05), but a significantly higher Lauge-Hansen injury grade (p < 0.001) and syndesmotic screw fixation rate (p = 0.033). Moreover, the functional recovery was poorer, revealing a significantly lower FAOS in the sport/rec scale (p < 0.001). Subgroup analysis showed that among SER IV ankle fracture patients, FAOS was much lower in pain (p = 0.042) and sport/rec scales (p < 0.001) for those with dislocations. American Orthopedic Foot and Ankle Society ankle hindfoot score revealed no significant difference between dislocation and no-dislocation patients. CONCLUSION Dislocation in SER ankle fractures suggests more severe injury and negatively affects functional recovery, mainly manifested as more pain and poorer motor function, especially in SER IV ankle cases.
Humans ; Ankle Fractures/physiopathology* ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Supination ; Aged ; Young Adult ; Rotation ; Joint Dislocations/surgery* ; Fracture Fixation, Internal/methods* ; Adolescent ; Recovery of Function ; Treatment Outcome

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To construct an integrated management model for early screening and diagnosis of PCa based on the Innovative Care for Chronic Conditions Framework (ICCC) and the 1+1 contract-based tiered diagnosis and treatment system (TDTS) in China. METHODS: Based on the 1+1 contract-based TDTS platform, we conducted PCa screening for the male residents aged 60 years and above during health check-ups in Pujin Community Health Center from January 1, 2023 to December 31, 2023. For those with abnormal total prostate-specific antigen (tPSA) ≥ 4 μg/L, we promptly referred them to higher-level hospitals for further diagnosis and treatment via the two-way referral green channel platform and information sharing service using the 1+1 contract model. We further analyzed the relevant data on screening and diagnosis. RESULTS: A total of 4 080 males aged 71.39±5.059 years received PCa screening from January to December 2023. PSA screening was performed in 43.96% of the male residents, revealing 654 cases of PSA abnormality, with a PSA positivity rate of 16.03%, which was higher than that found in the previous large-scale PCa screenings in other regions of China. Among the males with PSA abnormality, 292 (44.65%) expressed their willingness for medical referral, while the others did not seek further medical attention for reasons of being asymptomatic, low awareness of the disease, no accompany for medical visits, and concerns about further costs of diagnosis and treatment. Prostate biopsy was recommended to 154 cases after further examinations, which was accepted by 92 (59.74%). Fifty-eight cases were diagnosed with Pa, and thedetection rate reached 63.04%. CONCLUSION The integrated management model for PSA examination-based early screening and diagnosis of PCa using the 1+1 contract-based TDTS platform is plays a significant role in enhancing people's awareness and knowledge of PCa and improving the early detection rate of the malignancy.
Humans ; Male ; Prostatic Neoplasms/diagnosis* ; Early Detection of Cancer ; Prostate-Specific Antigen/blood* ; Aged ; China ; Mass Screening ; Middle Aged ; Chronic Disease

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers