1.Cost-effectiveness analysis between sodium valproate and levetiracetam in the treatment of childhood epilepsy
Wei SHAO ; Ni YUAN ; Ye LIU ; Fei YU ; Ying LIU ; Feng WANG
Journal of Pharmaceutical Practice and Service 2025;43(8):410-413
Objective To compare the cost-effectiveness between sodium valproate and levetiracetam in the treatment of childhood epilepsy and provide an economic basis for clinical medication choices. Methods A cost-effectiveness analysis was conducted using a decision tree model to compare the effectiveness and drug costs of sodium valproate and levetiracetam in treating childhood epilepsy. Single-factor sensitivity analysis and probabilistic sensitivity analysis were used to assess the impact of parameter variations on the study results. Results The treatment cost of levetiracetam was significantly higher than that of sodium valproate. The incremental cost-effectiveness ratio (ICER) of levetiracetam compared to sodium valproate was ¥8 628.43. Sensitivity analysis results were consistent with the base-case analysis. The probabilistic sensitivity analysis showed that, over a 6-month treatment period, levetiracetam became a more cost-effective option when the willingness-to-pay (WTP) threshold was ¥9,000 or higher. One-way sensitivity analysis revealed that the price of levetiracetam was the most influential factor affecting the ICER. Conclusion When the WTP per effective pediatric epilepsy case is ¥9,000 or higher, levetiracetam demonstrates a cost-effectiveness advantage.
2.The Sequential Mediating Roles of Body Pain and Self-Reported Health Status in the Relationship between Sleep Duration and Life Satisfaction.
Jia Feng LI ; Xue Wei FU ; Dan YANG ; Ye WANG ; Ting CHEN ; Yang PENG ; Feng Hao YANG ; Yu Chen ZHAN ; Yu WANG ; Xiang Dong TANG
Biomedical and Environmental Sciences 2025;38(1):47-55
OBJECTIVE:
This study examines the sequential mediating roles of body pain and self-reported health in the association between sleep duration and self-reported life satisfaction among elderly Chinese adults.
METHODS:
Data from the fifth wave of the China Health and Retirement Longitudinal Survey (CHARLS) were used to analyse the relationships between sleep duration and body pain, self-reported health, and life satisfaction through logistic regression and Restricted Cubic Spline (RCS) analyses. The sequential mediation effects of body pain and self-reported health status were examined via chain mediation analysis.
RESULTS:
Logistic regression analysis showed that sleeping fewer than 6 hours or 6-7 hours was linked to higher risks of body pain, poor health, and dissatisfaction with life compared to sleeping 7-8 hours (all P < 0.05). Additionally, those sleeping more than 9 hours also had increased risks of poor health and dissatisfaction with life compared to those sleeping 7-8 hours (all P < 0.05). Chain mediation analysis showed that body pain and self-reported health status sequentially mediated 46.15% of the association between sleep duration and life satisfaction.
CONCLUSION
Body pain and self-reported health may shape the relationship between sleep duration and life satisfaction in elderly Chinese adults.
Humans
;
Male
;
Female
;
Aged
;
Personal Satisfaction
;
Sleep
;
Health Status
;
Self Report
;
China
;
Middle Aged
;
Longitudinal Studies
;
Pain/psychology*
;
Sleep Duration
3.Role and mechanism of nicotinamide adenine dinucleotide in rotenone-induced damage in dopaminergic neurons
Wei GE ; Haoyin LIU ; Xunhu DONG ; Wenqi YE ; Xiaogang WANG ; Feng YE ; Yuanpeng ZHAO ; Yan SAI
Journal of Army Medical University 2025;47(18):2163-2173
Objective To explore the effect of rotenone exposure on the metabolic homeostasis of nicotinamide adenine dinucleotide(NAD+)in dopaminergic neurons of the rat mid-brain striatum,and investigate the effect of exogenous NAD+intervention on the cellular damage response of dopaminergic neurons induced by rotenone.Methods Male SD rats(8 weeks old,200~250 g)were divided into a control group using a table of random numbers,a rotenone exposure group,an NAD+-intervention group,and an NAD+group.An intoxication model was established in the rotenone exposure group.NAD+(250 mg/kg)was administered simultaneously with rotenone exposure in the NAD+-intervention group.The NAD+group was only given NAD+,while the control group received no intervention.After modeling,open field test was performed to evaluate behavioral changes.After scarification,serum samples and mid-brain striatal tissues were collected.HE staining was used to observe the morphology of dopaminergic neurons in the striatum.The NAD+content in the tissues was detected with NAD+/NADH kit.Western blotting was employed to determine the contents of tyrosine hydroxylase(TH),nicotinamide phosphoribosyltransferase(NAMPT),nicotinamide mononucleotide adenylyltransferase(NMNAT),and solute carrier family 25 member A51(SLC25A51).ELISA was utilized to measure the content of dopamine in the striatal tissues.Immunohistochemical staining was applied to observe the distribution and contents of TH proteins in the striatal tissues of each group.Results Rotenone exposure significantly affected the vital signs and motor abilities of rats,induced disorderly-arranged,atrophy and deformed neurons in the striatal tissue,decreased the content of TH,rate-limiting enzyme for dopamine synthesis,by approximately 29%(P<0.01),the content of dopamine by about 42%,and that of NAD+by almost 50%(P<0.01),while increased the NADH/NAD+ratio(P<0.01).After exposure,the content of NAMPT,an enzyme related to NAD+synthesis,was decreased by 26%(P<0.05),the contents of NMNAT1-3 and SLC25A51,mitochondrial transporters of NAD+by approximately 21%,38%,43%,and 21%,respectively(P<0.01).Exogenous NAD+intervention improved the motor function of exposure rats and the morphology of dopaminergic neurons in the mid-brain striatal tissue,and restored the content of TH in the striatal tissue significantly by 12.8%(P<0.05),and the content of dopamine by 20.9%(P<0.05).Conclusion Rotenone disrupts the NAD+homeostasis in dopaminergic neurons by inhibiting the NAD+synthesis and transport pathways in the mid-brain striatal tissues,while exogenous NAD+intervention can effectively alleviate the dopaminergic neuron damage induced by rotenone exposure.
4.Expert consensus on evaluation index system construction for new traditional Chinese medicine(TCM) from TCM clinical practice in medical institutions.
Li LIU ; Lei ZHANG ; Wei-An YUAN ; Zhong-Qi YANG ; Jun-Hua ZHANG ; Bao-He WANG ; Si-Yuan HU ; Zu-Guang YE ; Ling HAN ; Yue-Hua ZHOU ; Zi-Feng YANG ; Rui GAO ; Ming YANG ; Ting WANG ; Jie-Lai XIA ; Shi-Shan YU ; Xiao-Hui FAN ; Hua HUA ; Jia HE ; Yin LU ; Zhong WANG ; Jin-Hui DOU ; Geng LI ; Yu DONG ; Hao YU ; Li-Ping QU ; Jian-Yuan TANG
China Journal of Chinese Materia Medica 2025;50(12):3474-3482
Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards*
;
Humans
;
Consensus
;
Drugs, Chinese Herbal/therapeutic use*
;
Surveys and Questionnaires
5.Study on protective effect of arbutin in yam on acute lung injury and its metabolic regulation mechanism.
Kai-Li YE ; Meng-Nan ZENG ; Feng-Xiao HAO ; Peng-Li GUO ; Yu-Han ZHANG ; Wei-Sheng FENG ; Xiao-Ke ZHENG
China Journal of Chinese Materia Medica 2025;50(15):4100-4109
This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals
;
Acute Lung Injury/chemically induced*
;
Mice
;
Mice, Inbred BALB C
;
Arbutin/administration & dosage*
;
Male
;
Toll-Like Receptor 4/immunology*
;
Apoptosis/drug effects*
;
Lung/metabolism*
;
Signal Transduction/drug effects*
;
Protective Agents/administration & dosage*
;
Humans
;
Macrophages/immunology*
;
Drugs, Chinese Herbal/administration & dosage*
6.Dislocations deteriorate postoperative functional outcomes in supination-external rotation ankle fractures.
Sheng-Ye HU ; Mu-Min CAO ; Yuan-Wei ZHANG ; Liu SHI ; Guang-Chun DAI ; Ya-Kuan ZHAO ; Tian XIE ; Hui CHEN ; Yun-Feng RUI
Chinese Journal of Traumatology 2025;28(2):124-129
PURPOSE:
To assess the relationship between dislocation and functional outcomes in supination-external rotation (SER) ankle fractures.
METHODS:
A retrospective case series study was performed on patients with ankle fractures treated surgically at a large trauma center from January 2015 to December 2021. The inclusion criteria were young and middle-aged patients of 18 - 65 years with SER ankle fractures that can be classified by Lauge-Hansen classification and underwent surgery at our trauma center. Exclusion criteria were serious life-threatening diseases, open fractures, fractures delayed for more than 3 weeks, fracture sites ≥ 2, etc. Then patients were divided into dislocation and no-dislocation groups. Patient demographics, injury characteristics, surgery-related outcomes, and postoperative functional outcomes were collected and analyzed. The functional outcomes of SER ankle fractures were assessed postoperatively at 1-year face-to-face follow-up using the foot and ankle outcome score (FAOS) and American Orthopedic Foot and Ankle Society ankle hindfoot score and by 2 experienced orthopedic physicians. Relevant data were analyzed using SPSS version 22.0 by Chi-square or t-test.
RESULTS:
During the study period, there were 371 ankle fractures. Among them, 190 (51.2%) were SER patterns with 69 (36.3%) combined with dislocations. Compared with the no-dislocation group, the dislocation group showed no statistically significant differences in gender, age composition, fracture type, diabetes, or smoking history, preoperative waiting time, operation time, and length of hospital stay (all p > 0.05), but a significantly higher Lauge-Hansen injury grade (p < 0.001) and syndesmotic screw fixation rate (p = 0.033). Moreover, the functional recovery was poorer, revealing a significantly lower FAOS in the sport/rec scale (p < 0.001). Subgroup analysis showed that among SER IV ankle fracture patients, FAOS was much lower in pain (p = 0.042) and sport/rec scales (p < 0.001) for those with dislocations. American Orthopedic Foot and Ankle Society ankle hindfoot score revealed no significant difference between dislocation and no-dislocation patients.
CONCLUSION
Dislocation in SER ankle fractures suggests more severe injury and negatively affects functional recovery, mainly manifested as more pain and poorer motor function, especially in SER IV ankle cases.
Humans
;
Ankle Fractures/physiopathology*
;
Male
;
Female
;
Retrospective Studies
;
Adult
;
Middle Aged
;
Supination
;
Aged
;
Young Adult
;
Rotation
;
Joint Dislocations/surgery*
;
Fracture Fixation, Internal/methods*
;
Adolescent
;
Recovery of Function
;
Treatment Outcome
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Early screening and diagnosis of prostate cancer based on the innovative care for chronic conditions framework.
Han-Jing ZHU ; Liang DONG ; Bin ZHAO ; Feng ZHANG ; Rong LI ; Cheng-Ye ZHU ; Jia MAO ; Zhen-Ying YANG ; Yin-Jie ZHU ; Wei XUE
National Journal of Andrology 2025;31(3):229-233
OBJECTIVE:
To construct an integrated management model for early screening and diagnosis of PCa based on the Innovative Care for Chronic Conditions Framework (ICCC) and the 1+1 contract-based tiered diagnosis and treatment system (TDTS) in China.
METHODS:
Based on the 1+1 contract-based TDTS platform, we conducted PCa screening for the male residents aged 60 years and above during health check-ups in Pujin Community Health Center from January 1, 2023 to December 31, 2023. For those with abnormal total prostate-specific antigen (tPSA) ≥ 4 μg/L, we promptly referred them to higher-level hospitals for further diagnosis and treatment via the two-way referral green channel platform and information sharing service using the 1+1 contract model. We further analyzed the relevant data on screening and diagnosis.
RESULTS:
A total of 4 080 males aged 71.39±5.059 years received PCa screening from January to December 2023. PSA screening was performed in 43.96% of the male residents, revealing 654 cases of PSA abnormality, with a PSA positivity rate of 16.03%, which was higher than that found in the previous large-scale PCa screenings in other regions of China. Among the males with PSA abnormality, 292 (44.65%) expressed their willingness for medical referral, while the others did not seek further medical attention for reasons of being asymptomatic, low awareness of the disease, no accompany for medical visits, and concerns about further costs of diagnosis and treatment. Prostate biopsy was recommended to 154 cases after further examinations, which was accepted by 92 (59.74%). Fifty-eight cases were diagnosed with Pa, and thedetection rate reached 63.04%.
CONCLUSION
The integrated management model for PSA examination-based early screening and diagnosis of PCa using the 1+1 contract-based TDTS platform is plays a significant role in enhancing people's awareness and knowledge of PCa and improving the early detection rate of the malignancy.
Humans
;
Male
;
Prostatic Neoplasms/diagnosis*
;
Early Detection of Cancer
;
Prostate-Specific Antigen/blood*
;
Aged
;
China
;
Mass Screening
;
Middle Aged
;
Chronic Disease
9.Expert consensus on the application of nasal cavity filling substances in nasal surgery patients(2025, Shanghai).
Keqing ZHAO ; Shaoqing YU ; Hongquan WEI ; Chenjie YU ; Guangke WANG ; Shijie QIU ; Yanjun WANG ; Hongtao ZHEN ; Yucheng YANG ; Yurong GU ; Tao GUO ; Feng LIU ; Meiping LU ; Bin SUN ; Yanli YANG ; Yuzhu WAN ; Cuida MENG ; Yanan SUN ; Yi ZHAO ; Qun LI ; An LI ; Luo BA ; Linli TIAN ; Guodong YU ; Xin FENG ; Wen LIU ; Yongtuan LI ; Jian WU ; De HUAI ; Dongsheng GU ; Hanqiang LU ; Xinyi SHI ; Huiping YE ; Yan JIANG ; Weitian ZHANG ; Yu XU ; Zhenxiao HUANG ; Huabin LI
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(4):285-291
This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans
;
Nasal Cavity/surgery*
;
Nasal Surgical Procedures
;
China
;
Consensus
;
Sinusitis/surgery*
;
Dermal Fillers
10.Chinese expert consensus on the evaluation of allergen-specific immunotherapy outcomes(Wuhan, 2025).
Yuqin DENG ; Xi LUO ; Zhuofu LIU ; Shuguang SUN ; Jing YE ; Tiansheng WANG ; Jianjun CHEN ; Meiping LU ; Yin YAO ; Ying WANG ; Wei ZHOU ; Bei LIU ; Qingxiang ZENG ; Yuanteng XU ; Qintai YANG ; Yucheng YANG ; Feng LIU ; Chengli XU ; Yanan SUN ; Haiyu HONG ; Haibo YE ; Liqiang ZHANG ; Fenghong CHEN ; Huabin LI ; Hongtian WANG ; Yuncheng LI ; Wenlong LIU ; Yu XU ; Hongfei LOU
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(11):1075-1085
Allergen-specific immunotherapy(AIT) remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis(AR). Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group(CRRCG) convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans
;
Allergens/immunology*
;
China
;
Consensus
;
Desensitization, Immunologic
;
Immunoglobulin E
;
Quality of Life
;
Rhinitis, Allergic/therapy*
;
Treatment Outcome
;
East Asian People

Result Analysis
Print
Save
E-mail