Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

OBJECTIVE: This study examines the sequential mediating roles of body pain and self-reported health in the association between sleep duration and self-reported life satisfaction among elderly Chinese adults. METHODS: Data from the fifth wave of the China Health and Retirement Longitudinal Survey (CHARLS) were used to analyse the relationships between sleep duration and body pain, self-reported health, and life satisfaction through logistic regression and Restricted Cubic Spline (RCS) analyses. The sequential mediation effects of body pain and self-reported health status were examined via chain mediation analysis. RESULTS: Logistic regression analysis showed that sleeping fewer than 6 hours or 6-7 hours was linked to higher risks of body pain, poor health, and dissatisfaction with life compared to sleeping 7-8 hours (all P < 0.05). Additionally, those sleeping more than 9 hours also had increased risks of poor health and dissatisfaction with life compared to those sleeping 7-8 hours (all P < 0.05). Chain mediation analysis showed that body pain and self-reported health status sequentially mediated 46.15% of the association between sleep duration and life satisfaction. CONCLUSION Body pain and self-reported health may shape the relationship between sleep duration and life satisfaction in elderly Chinese adults.
Humans ; Male ; Female ; Aged ; Personal Satisfaction ; Sleep ; Health Status ; Self Report ; China ; Middle Aged ; Longitudinal Studies ; Pain/psychology* ; Sleep Duration

PURPOSE: To assess the relationship between dislocation and functional outcomes in supination-external rotation (SER) ankle fractures. METHODS: A retrospective case series study was performed on patients with ankle fractures treated surgically at a large trauma center from January 2015 to December 2021. The inclusion criteria were young and middle-aged patients of 18 - 65 years with SER ankle fractures that can be classified by Lauge-Hansen classification and underwent surgery at our trauma center. Exclusion criteria were serious life-threatening diseases, open fractures, fractures delayed for more than 3 weeks, fracture sites ≥ 2, etc. Then patients were divided into dislocation and no-dislocation groups. Patient demographics, injury characteristics, surgery-related outcomes, and postoperative functional outcomes were collected and analyzed. The functional outcomes of SER ankle fractures were assessed postoperatively at 1-year face-to-face follow-up using the foot and ankle outcome score (FAOS) and American Orthopedic Foot and Ankle Society ankle hindfoot score and by 2 experienced orthopedic physicians. Relevant data were analyzed using SPSS version 22.0 by Chi-square or t-test. RESULTS: During the study period, there were 371 ankle fractures. Among them, 190 (51.2%) were SER patterns with 69 (36.3%) combined with dislocations. Compared with the no-dislocation group, the dislocation group showed no statistically significant differences in gender, age composition, fracture type, diabetes, or smoking history, preoperative waiting time, operation time, and length of hospital stay (all p > 0.05), but a significantly higher Lauge-Hansen injury grade (p < 0.001) and syndesmotic screw fixation rate (p = 0.033). Moreover, the functional recovery was poorer, revealing a significantly lower FAOS in the sport/rec scale (p < 0.001). Subgroup analysis showed that among SER IV ankle fracture patients, FAOS was much lower in pain (p = 0.042) and sport/rec scales (p < 0.001) for those with dislocations. American Orthopedic Foot and Ankle Society ankle hindfoot score revealed no significant difference between dislocation and no-dislocation patients. CONCLUSION Dislocation in SER ankle fractures suggests more severe injury and negatively affects functional recovery, mainly manifested as more pain and poorer motor function, especially in SER IV ankle cases.
Humans ; Ankle Fractures/physiopathology* ; Male ; Female ; Retrospective Studies ; Adult ; Middle Aged ; Supination ; Aged ; Young Adult ; Rotation ; Joint Dislocations/surgery* ; Fracture Fixation, Internal/methods* ; Adolescent ; Recovery of Function ; Treatment Outcome

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

This consensus will introduce the characteristics of fillers used in the surgical cavities of domestic nasal surgery patients based on relevant literature and expert opinions. It will also provide recommendations for the selection of cavity fillers for different nasal diseases, with chronic sinusitis as a representative example.
Humans ; Nasal Cavity/surgery* ; Nasal Surgical Procedures ; China ; Consensus ; Sinusitis/surgery* ; Dermal Fillers

Allergen-specific immunotherapy（AIT） remains the only therapeutic approach with the potential to modify the natural course of allergic rhinitis（AR）. Nevertheless, considerable inter-individual variability exists in patients'responses to AIT. To facilitate more reliable assessment of treatment efficacy, the China Rhinopathy Research Cooperation Group（CRRCG） convened young and middle-aged nasal experts in China to formulate the present consensus. The recommended subjective outcome measures for AIT comprise symptom scores, medication scores, combined symptom and medication scores, quality-of-life assessments, evaluation of disease control, and assessment of comorbidities. Objective indicators may supplement these measures. Currently available objective approaches include skin prick testing, nasal provocation testing, and allergen exposure chambers. However, these methods remain constrained by practical limitations and are not yet appropriate for routine implementation in clinical efficacy evaluation. In addition, several biomarkers, including sIgE and the sIgE/tIgE ratio, sIgG4, serum IgE-blocking activity, IgA, cytokines and chemokines, as well as immune cell surface molecules and their functional activity, have been shown to have associations with AIT outcomes. While these biomarkers may complement subjective assessments, they are subject to significant limitations. Consequently, large-scale multicenter trials and real-world evidence are required to strengthen the evidence base. The present consensus underscores the necessity of integrating patients'subjective experiences with objective testing throughout the treatment process, thereby providing a more comprehensive and accurate framework for efficacy evaluation. Looking forward, future investigations should prioritize the incorporation of multi-omics data and artificial intelligence methodologies, which hold promise for overcoming current limitations in assessment strategies and for advancing both the standardization and personalization of AIT.
Humans ; Allergens/immunology* ; China ; Consensus ; Desensitization, Immunologic ; Immunoglobulin E ; Quality of Life ; Rhinitis, Allergic/therapy* ; Treatment Outcome ; East Asian People