Objective To evaluate the effectiveness of schistosomiasis surveillance in Jiangsu Province during the stage moving from transmission control to transmission interruption, and to analyze the current risk and challenges, so as to provide the evidence for achieving the target of schistosomiasis elimination. Methods Schistosomiasis surveillance data were collected from Jiangsu Province from 2012 to 2024, and the endemic areas, Schistosoma japonicum infections in humans and livestock, Oncomelania hupensis snail distribution and implementation of integrated interventions were descriptively analyzed. In addition, the trends in areas with snails, seroprevalence of human S. japonicum infections and numbers of advanced schistosomiasis cases were assessed using a Joinpoint regression model. Results The endemic areas of schistosomiasis continued to shrink in Jiangsu Province from 2012 to 2024, with the number of schistosomiasis-eliminated counties (cities, districts) increasing from 53 (75.71%) to 63 (96.92%), and interruption of schistosomiasis transmission was achieved across the province. A total of 4 600 300 person-times were tested for serum antibodies against S. japonicum, with 28 719 person-times positive detected; and 616 500 person-times were tested S. japonicum infections among local residents in Jiangsu Province from 2012 to 2024, with only 3 egg-positives detected, and no egg-positives found since 2017. A total of 187 600 herd-times were tested for schistosomiasis in livestock, and no S. japonicum infections were found. O. hupensis snail survey was performed covering 1 018 408.97 hm², and a total of 35 556.35 hm² was found with snail-infested habitats, including 174.40 hm2 of emerging snail-infested habitats. A total of 1 102 800 O. hupensis snails were identified for S. japonicum infections, and no infections were found. The areas of snail-infested habitats appeared a tendency towards a rise in Jiangsu Province from 2019 to 2023 (APC = 23.67%, P < 0.05), and the actual areas of snail-infested habitats appeared a tendency towards a decline from 2012 to 2015 (APC = −22.77%, P < 0.05), and towards a rise from 2015 to 2023 (APC = 9.76%, P < 0.01). The seroprevalence of anti-S. japonicum antibodies appeared a tendency towards a decline among residents in Jiangsu Province from 2017 to 2023 (APC = −14.92%, P < 0.01). In addition, the number of newly diagnosed advanced schistosomiasis cases appeared a tendency towards a decline from 2012 to 2024 (APC = −12.02%, P < 0.01), and the numbers of advanced schistosomiasis patients requiring treatment showed a tendency towards a decline from 2012 to 2021 (APC = −10.56%, P < 0.01) and from 2021 to 2023 (APC = −20.06%, P < 0.01). Conclusions Great progresses had been achieved in schistosomiasis control in Jiangsu Province following transmission control, and transmission interruption had been achieved; however, there are still snail-infested habitats. High-intensity surveillance and integrated control are required to be maintained to advance the achievement of the target of schistosomiasis elimination in Jiangsu Province.

According to traditional Chinese medicine （TCM） theory， impaired spleen transportation function disrupts nutrient distribution， causing metabolic accumulation of lipids that transform into pathogenic phlegm-dampness. These pathological factors disseminate through the San Jiao and obstruct meridian pathways， ultimately forming the pathogenesis described as "all disorders involve phlegm". Phlegm and dampness share common pathogenic origins but manifest distinct clinical manifestations. Dampness， as the precursor， may congeal into phlegm， while existing phlegm accumulation can further exacerbate dampness stagnation， thereby establishing a self-perpetuating pathological cycle. Modern medical research has confirmed that the essence of "phlegm-dampness" syndrome is closely associated with energy metabolism disorders， serving as a common pathological basis for metabolic syndrome， type 2 diabetes mellitus， atherosclerosis， and other major chronic diseases. As a crucial vehicle for medical experimental research， disease-syndrome combination animal models serve as an indispensable means to advance the modernization of TCM. Currently， based on classical theories such as "rich and greasy foods produce phlegm" and "physical coldness combined with cold consumption causes external pathogens to invade the skin and hair， thereby generating internal dampness"， researchers primarily employ two paradigms to construct animal models of phlegm-turbidity， dampness obstruction， and phlegm-dampness syndromes： the first involves simulating TCM etiological factors （through methods like dietary irregularities， imblanace between work and rest， and combined internal-external dampness exposure）， while the second combines disease with syndrome differentiation （inducing pathological changes through physical， chemical， or biological interventions）. Through comprehensive evaluation incorporating macroscopic observation and microscopic index detection， model animals undergo systematic biological and pathological assessment， with further syndrome type verification achieved via the "prescription-based syndrome detection" approach. However， existing models still exhibit significant deficiencies in both the standardization of modeling methodologies and the systematization of evaluation criteria. This paper reviews the strategies for constructing "phlegm-dampness" syndrome animal models and their corresponding evaluation indices， focusing on the pathological correlations among different modeling approaches. The aim is to provide methodological guidance for research on TCM syndromes related to "phlegm-dampness" syndrome and to support the development of TCM therapies for resolving phlegm and eliminating dampness. This study not only contributes to advancing the standardization of TCM syndrome research but also provides crucial technical support for the modernization of TCM.

Background: and Purpose Vertebrobasilar fusiform aneurysms (VBFAs) carry substantial morbidity and mortality, but optimal management for unruptured VBFAs remains unclear. We compared the safety and efficacy of conservative management (CM), stent-assisted coiling (SAC), and flow diverters (FDs) in patients with unruptured VBFAs, focusing on long-term prognosis. Methods: This study included data from a nationwide Chinese cohort of patients with vertebrobasilar dissecting aneurysms. Inverse probability of treatment weighting (IPTW) balanced confounders across groups. The primary outcome was poor prognosis (modified Rankin Scale score >2). Secondary outcomes included aneurysm rupture, ischemic stroke, compression symptoms, and VBFA-related deaths. Logistic regression estimated odds ratios (ORs) and 95% confidence intervals (CIs). Subgroup and sensitivity analyses were performed. Results: Among 1,115 patients with unruptured VBFAs, 838 (median age, 54 years; 655 men) were included. After IPTW, baseline characteristics were balanced. Median follow-up was 54 months. FD was associated with a lower risk of poor prognosis than CM (OR, 0.48 [95% CI, 0.30 to 0.77]; p=0.002), with no difference between CM and SAC. FD also reduced aneurysm rupture (OR, 0.20 [95% CI, 0.07 to 0.60]; p=0.004) and compression symptoms (OR, 0.30 [95% CI, 0.13 to 0.68]; p=0.004) versus CM. Time-to-event analyses further revealed significant differences in vertebral artery lesions and Type I–II VBFAs, whereas no significant differences were observed in basilar or vertebrobasilar junction lesions or in Type III–IV VBFAs. Conclusions Compared with CM, FD was associated with improved long-term outcomes in unruptured VBFAs, particularly in vertebral artery lesions and Type I–II VBFAs, although residual confounding cannot be excluded.

OBJECTIVE To investigate the mechanism by which Shenfukang capsule （SFK） ameliorates renal interstitial fibrosis （RIF） by regulating macrophage-fibroblast crosstalk via the signal transducer and activator of transcription 3 （STAT3）/Yes-associated protein （YAP） pathway. METHODS RAW264.7 macrophages were induced to polarize with transforming growth factor-β 1 （TGF-β 1 ）. Subsequently， a non-contact co-culture system of macrophages with renal fibroblasts NRK-49F， as well as a non-contact co-culture system of macrophages with YAP-knockdown renal fibroblasts， were established. Cells were treated with low， medium， and high concentrations （4， 8， 16 μg/mL） of SFK， as well as a STAT3 inhibitor （STAT3-I，1.64 μg/mL） and losartan potassium tablets （positive control， 0.28 μg/mL）， for 48 h. After intervention， the protein and mRNA expression levels of CD86， CD163， and STAT3 in macrophages， as well as CD86， F4/80， and STAT3 mRNA， were detected. In co-cultured renal fibroblasts， the protein and mRNA expression levels of α -smooth muscle actin （ α -SMA）， Vimentin， collagen type Ⅰ （Col-Ⅰ）， matrix metalloproteinase-1 （MMP-1）， and YAP were detected. In co-cultured YAP-knockdown renal fibroblasts， the protein and mRNA expression levels of α -SMA， Vimentin， and MMP-1 were also detected. RESULTS Following TGF-β 1 induction， the protein expression levels of CD86， CD163， and STAT3， as well as the mRNA expression levels of CD86， F4/80， and STAT3 in macrophages were significantly increased （ P ＜0.05）. The conditioned medium from polarized macrophages activated renal fibroblasts， as evidenced by significantly increased protein and mRNA expression levels of α -SMA， Vimentin， Col-Ⅰ， and YAP， and significantly decreased protein and mRNA expression levels of MMP-1 in renal fibroblasts （ P ＜0.05）. Treatment with SFK and STAT3-I reversed the changes in the above indicators， with the medium concentration SFK group showing stronge r effects on some indicators than the low and high concentration groups. In the non-contact co-culture experiment of macrophages and YAP-knockdown renal fibroblasts， there were no statistically significant differences in the protein and mRNA expression of α-SMA， Vimentin， and MMP-1 among the groups. CONCLUSIONS SFK can inhibit macrophage-renal fibroblast crosstalk by blocking the STAT3/YAP pathway， thereby delaying the progression of RIF.

[Objective] To establish a new scoring system to predict the perioperative outcomes (operation time, intraoperative blood loss, and trifecta achievement) in patients undergoing robot-assisted partial nephrectomy (RAPN) by integrating the RENAL and Mayo adhesive probability (MAP) scores. [Methods] Clinical data of 178 patients with renal cell carcinoma who underwent RAPN performed by the same surgeon in our hospital during Jan.2015 and Jan.2022 were retrospectively analyzed.The RENAL and MAP scores of all patients were calculated.Linear regression and logistic regression were used to evaluate the associations between the components of the RENAL and MAP scores (a total of 6 variables) and perioperative outcomes.The factors with significant associations were then included into logistic regression analysis to identify independent predictors for constructing an assessment system for perioperative outcomes, and the receiver operating characteristic (ROC) curve was plotted to calculate the area under the curve (AUC) to predict its efficacy. [Results] Multivariate linear regression analysis showed that tumor size (β=6.14, 95%CI: 1.93—10.34, P=0.004), exophytic rate (β=10.60, 95%CI: 3.44—17.76, P=0.004), and perinephric fat thickness (β=16.48, 95%CI: 8.52—24.45, P<0.001) were significantly associated with operation time.Tumor size (β=10.55 95%CI: 5.60—15.49, P<0.001) was associated with both intraoperative blood loss and trifecta achievement (OR=1.73, 95%CI: 1.26—2.36, P=0.001). Multivariate logistic regression analysis of these 3 factors identified tumor size (OR=9.07, 95% CI: 1.18—69.45, P=0.03) and perinephric fat thickness (OR=2.28, 95%CI: 1.86—6.04, P=0.01) as independent predictors of perioperative outcomes.Based on these findings, the tumor size and perinephric fat thickness (RP) scoring was constructed, which demonstrated better predictive ability than RENAL score or MAP score alone (RP vs.RENAL vs.MAP: 0.766 vs.0.548 vs.0.684). [Conclusion] The RP score includes fewer variables than the RENAL and MAP scores but outperforms them.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

Triclocarban (TCC) is a broad-spectrum antimicrobial widely used in various personal care products, textiles, and children's toys. TCC has potential reproductive and developmental toxicity in animals. However, little is known regarding the effect of TCC on human sperm function. In this study, an in vitro assay was used to investigate the effects of TCC on normal human spermatozoa and the possible underlying mechanisms involved. Semen from healthy male donors was collected and cultured in complete Biggers, Whitten and Whittingham (BWW) and low-sugar BWW media, followed by treatment with TCC at concentrations of 0, 0.1 µmol l -1 , 1 µmol l -1 , 10 µmol l -1 , and 100 µmol l -1 for 4 h. TCC was found to reduce the sperm total motility and progressive motility. Moreover, the sperm kinematic parameters, straight-line velocity (VSL), average path velocity (VAP), and curvilinear velocity (VCL) were affected in a dose-dependent manner. After treatment with TCC at the lowest effective concentration of 10 µmol l -1 , TCC caused a significant decrease in mitochondrial adenosine triphosphate (ATP) production and mitochondrial membrane potential (MMP) and a significant increase in reactive oxygen species (ROS), similar to the observations with the positive control carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), suggesting that TCC may decrease sperm motility by affecting the oxidative phosphorylation (OXPHOS) pathway. In a sugar-free and low-sugar BWW culture environment, TCC enhanced the damaging effect on sperm motility and ATP, MMP, and lactate decreased significantly, suggesting that TCC may also affect the glycolytic pathway that supplies energy to spermatozoa. This study demonstrates a possible mechanism of TCC toxicity in spermatozoa involving both the OXPHOS and glycolysis pathways.
Male ; Sperm Motility/drug effects* ; Humans ; Carbanilides/pharmacology* ; Oxidative Phosphorylation/drug effects* ; Glycolysis/drug effects* ; Membrane Potential, Mitochondrial/drug effects* ; Adenosine Triphosphate/metabolism* ; Spermatozoa/metabolism* ; Reactive Oxygen Species/metabolism* ; Mitochondria/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse