Alzheimer’s disease (AD) is a prevalent neurodegenerative condition characterized by progressive cognitive decline and memory loss. As the incidence of AD continues to rise annually, researchers have shown keen interest in the active components found in natural plants and their neuroprotective effects against AD. Quercetin, a flavonol widely present in fruits and vegetables, has multiple biological effects including anticancer, anti-inflammatory, and antioxidant. Oxidative stress plays a central role in the pathogenesis of AD, and the antioxidant properties of quercetin are essential for its neuroprotective function. Quercetin can modulate multiple signaling pathways related to AD, such as Nrf2-ARE, JNK, p38 MAPK, PON2, PI3K/Akt, and PKC, all of which are closely related to oxidative stress. Furthermore, quercetin is capable of inhibiting the aggregation of β‑amyloid protein (Aβ) and the phosphorylation of tau protein, as well as the activity of β‑secretase 1 and acetylcholinesterase, thus slowing down the progression of the disease.The review also provides insights into the pharmacokinetic properties of quercetin, including its absorption, metabolism, and excretion, as well as its bioavailability challenges and clinical applications. To improve the bioavailability and enhance the targeting of quercetin, the potential of quercetin nanomedicine delivery systems in the treatment of AD is also discussed. In summary, the multifaceted mechanisms of quercetin against AD provide a new perspective for drug development. However, translating these findings into clinical practice requires overcoming current limitations and ongoing research. In this way, its therapeutic potential in the treatment of AD can be fully utilized.

Objective:To address the inefficiency, safety hazards, and resource wastage in traditional medical laboratory management, this study proposes a digital laboratory information management system (LIMS) based on Total Quality Management (TQM) principles. The LIMS has been implemented at the National Center for Geriatric Medicine (Huashan) affiliated with Fudan University.Methods:Centered on the principles of " all-staff participation, whole-process control, and comprehensive management", a multidimensional management framework was developed to integrate personnel, equipment, reagents, and safety protocols. The system incorporated IoT, digital twin, and artificial intelligence (AI) technologies to achieve end-to-end digital control. A layered architecture (physical layer, data layer, model layer, etc.) was designed to integrate functional modules such as full lifecycle equipment management, dual-authentication for hazardous chemicals, and intelligent resource scheduling. A 3D digital twin model was deployed to visualize real-time laboratory operations.Results:Post-implementation, equipment reservation frequency and usage duration at the National Center increased by 114% and 124%, respectively, with no safety incidents reported. Equipment sharing utilization reached 85%, and reagent expiration waste decreased by 30%.Conclusions:The system transforms laboratory management from experience-driven to data-driven by breaking data silos and optimizing collaboration mechanisms. It provides a replicable technical pathway and practical insights for the healthcare industry′s digital transformation. However, further improvements are needed in mobile support and system scalability.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To investigate the efficacy of radiotherapy in patients with advanced esophageal cancer receiving first-line chemoimmunotherapy.Methods:A retrospective analysis was conducted on the data of 137 patients with Stage Ⅳ esophageal squamous cell carcinoma (ESCC) treated at our hospital from January 2018 to May 2023. These patients were divided into two groups: a group treated with first-line chemoimmunotherapy combined with radiotherapy (chemoimmunotherapy + radiotherapy group, n = 43) and a group treated with only chemoimmunotherapy ( n = 94). Inverse probability of treatment weighting (IPTW) was applied to balance baseline characteristics between the groups. With overall survival (OS) and progression-free survival (PFS) as study endpoints, the survival data were analyzed using the Kaplan-Meier method, the log-rank test, and the Cox regression method. Results:Before calibration, the chemoimmunotherapy + radiotherapy group significantly outperformed the sole chemoimmunotherapy group in median PFS (13.6 months vs. 7.0 months; HR: 0.501, 95% CI: 0.309-0.811, P = 0.005). After calibration using the COX proportional-hazards model for age, gender, Eastern Cooperative Oncology Group (ECOG) performance status, smoking history, T/N/M stage, and tumor location, the chemoimmunotherapy + radiotherapy group still had significant advantages in PFS (14.7 months vs. 7.0 months; HR: 0.441, 95% CI: 0.261-0.745, P = 0.002). IPTW analysis further confirmed this trend (13.9 months vs. 7.0 months; HR: 0.492, 95% CI: 0.304-0.795, P < 0.001). Specifically, the median OS of the chemoimmunotherapy + radiotherapy group demonstrated significant improvement in all analyses: pre-calibration (29.5 months vs. 18.0 months; HR: 0.507, 95% CI: 0.297-0.867, P = 0.013), after calibration using the Cox model (27.5 months vs. 16.7 months; HR: 0.470, 95% CI: 0.266-0.830, P = 0.009), and after calibration using IPTW (29.5 months vs. 16.9 months; HR: 0.448, 95% CI: 0.262-0.764, P < 0.001). Conclusions:The combination of radiotherapy and first-line chemoimmunotherapy can significantly improve survival outcomes of patients with advanced ESCC, suggesting its potential as a standard treatment strategy.

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To explore clinical efficacy of bone cement filling combined with lower extremity arterial balloon dilation in treating Wagner grade Ⅳ diabetic foot (DF). METHODS: From January to October 2024, 9 Wagner grade Ⅳ DF patients with lower extremity vascular occlusion were admitted, including 7 males and 2 females, aged from 51 to 87 years old;5 patients on the left side and 4 patients on the right side. All patients were underwent stageⅠdebridement of the affected foot and bone cement filling, and treated with lower extremity arterial balloon dilation after operation, they were. After the formation of the induced membrane, stageⅡwound repair was performed. The wound healing time and condition were observed. Ankle-brachial index (ABI) was used to evaluate the lower extremity vascular perfusion before operation and 3 months after operation, respectively. RESULTS: The wounds of all 9 patients healed completely, and the healing time ranged from 45 to 65 days. All patients were followed up for at least 6 months without recurrence. The skin of the affected foot wound healed with keratinization, and there was mild scar hyperplasia locally (1 patient had necrosis of the adjacent toe after stageⅠsurgery and was debridement and toe amputation again). The narrowed or occluded blood vessels of the lower extremities were all recanalized. ABI recovered from 0.3 to 0.5 before operation to 1.0 to 1.1 at 3 months after operation. CONCLUSION Bone cement filling combined with lower extremity arterial balloon dilation for the treatment of grade Wagner Ⅳ DF is conducive to promoting healing of the affected foot, effectively preventing secondary ulceration of the affected foot, and clinical therapeutic effect is satisfactory.
Humans ; Male ; Female ; Middle Aged ; Diabetic Foot/surgery* ; Aged ; Bone Cements/therapeutic use* ; Aged, 80 and over ; Lower Extremity/blood supply*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients. METHODS: We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables. RESULTS: During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively). CONCLUSIONS CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.

Purpose To investigate the clinicopathological features and prognostic factors of follicular dendritic cell carcinoma(FDCS).Methods Hospital records of 23 patients diagnosed with FDCS were retrospectively re-viewed.The morphological,immunohistochemical features,including the detection of CD21,CD23,and CD35 using the EnVision method,and in-situ hybridization for Epstein-Barr virus encoded nuclear RNA(EBER)were evaluated.Clinicopathological characteristics were analyzed for the evaluation of prognosis.Results The median age of all 23 pa-tients was 50 years(range:27 to 72)and the female to male ratio was 1.3.The median maximum diameter of tumor was 7.0 cm(range:0.5 to 20.0 cm).One case was located in cervical lymph node,while another 22 were discovered in extranodal sites.20 cases were single organ and 3 cases were multiple organs involvement.Microscopically,tumor cells exhibited spindle,oval,or markedly pleomorphic morphology,accompanied by variable lymphoplasmacytic infil-tration in the stroma.CD21,CD35 and CD23 were positive in 22 of 23(95.6％),23 of 23(100.0％)and 4 of 15(26.7％)patients,respectively.EBER in-situ hybridization was positive in 9 of 23 patients(39.1％).The median follow-up time was 84.0(95％CI:50.7-117.3)months,and the 5-year survival rate was 80.2％(95％CI:62.8-97.6).Twelve(52.2％)patients were alive,5(21.7％)were dead,and 6(26.1％)were lost of follow-up.We es-tablished a pathological scoring system containing 5 indexes,i.e.,tumor maximum diameter,mitotic figures,tumor necrosis,cellular pleomorphism and histologic types.Patients with greater than 4 points had a significant poor progno-sis.Conclusion FDCS features a broad spectrum of histologic appearances and behavior.Combined morphological observations(HE staining),applications of a panel of follicular dendritic cell markers and EBER in-situ hybridization are helpful for accurate diagnosis.FDCS poses risks for recurrence,metastasis and death,and those with greater than 4 points in the scoring system have a significant poor prognosis.Long-term follow up is needed.