Alzheimer’s disease (AD) is a prevalent neurodegenerative condition characterized by progressive cognitive decline and memory loss. As the incidence of AD continues to rise annually, researchers have shown keen interest in the active components found in natural plants and their neuroprotective effects against AD. Quercetin, a flavonol widely present in fruits and vegetables, has multiple biological effects including anticancer, anti-inflammatory, and antioxidant. Oxidative stress plays a central role in the pathogenesis of AD, and the antioxidant properties of quercetin are essential for its neuroprotective function. Quercetin can modulate multiple signaling pathways related to AD, such as Nrf2-ARE, JNK, p38 MAPK, PON2, PI3K/Akt, and PKC, all of which are closely related to oxidative stress. Furthermore, quercetin is capable of inhibiting the aggregation of β‑amyloid protein (Aβ) and the phosphorylation of tau protein, as well as the activity of β‑secretase 1 and acetylcholinesterase, thus slowing down the progression of the disease.The review also provides insights into the pharmacokinetic properties of quercetin, including its absorption, metabolism, and excretion, as well as its bioavailability challenges and clinical applications. To improve the bioavailability and enhance the targeting of quercetin, the potential of quercetin nanomedicine delivery systems in the treatment of AD is also discussed. In summary, the multifaceted mechanisms of quercetin against AD provide a new perspective for drug development. However, translating these findings into clinical practice requires overcoming current limitations and ongoing research. In this way, its therapeutic potential in the treatment of AD can be fully utilized.

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To explore clinical efficacy of bone cement filling combined with lower extremity arterial balloon dilation in treating Wagner grade Ⅳ diabetic foot (DF). METHODS: From January to October 2024, 9 Wagner grade Ⅳ DF patients with lower extremity vascular occlusion were admitted, including 7 males and 2 females, aged from 51 to 87 years old;5 patients on the left side and 4 patients on the right side. All patients were underwent stageⅠdebridement of the affected foot and bone cement filling, and treated with lower extremity arterial balloon dilation after operation, they were. After the formation of the induced membrane, stageⅡwound repair was performed. The wound healing time and condition were observed. Ankle-brachial index (ABI) was used to evaluate the lower extremity vascular perfusion before operation and 3 months after operation, respectively. RESULTS: The wounds of all 9 patients healed completely, and the healing time ranged from 45 to 65 days. All patients were followed up for at least 6 months without recurrence. The skin of the affected foot wound healed with keratinization, and there was mild scar hyperplasia locally (1 patient had necrosis of the adjacent toe after stageⅠsurgery and was debridement and toe amputation again). The narrowed or occluded blood vessels of the lower extremities were all recanalized. ABI recovered from 0.3 to 0.5 before operation to 1.0 to 1.1 at 3 months after operation. CONCLUSION Bone cement filling combined with lower extremity arterial balloon dilation for the treatment of grade Wagner Ⅳ DF is conducive to promoting healing of the affected foot, effectively preventing secondary ulceration of the affected foot, and clinical therapeutic effect is satisfactory.
Humans ; Male ; Female ; Middle Aged ; Diabetic Foot/surgery* ; Aged ; Bone Cements/therapeutic use* ; Aged, 80 and over ; Lower Extremity/blood supply*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients. METHODS: We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables. RESULTS: During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively). CONCLUSIONS CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.

Abstract In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.

Endo-beta-N-acetylglucosaminidase (ENGase) is widely distributed in various organisms. The first reported ENGase activity was detected in Diplococcus pneumoniae in 1971. The protein (Endo D) was purified and its peptide sequence was determined in 1974. Three ENGases (Endo F1-F3) were discovered in Flavobacterium meningosepticum from 1982 to 1993. After that, the activity was detected from different species of bacteria, yeast, fungal, plant, mice, human, etc. Multiple ENGases were detected in some species, such as Arabidopsis thaliana and Trichoderma atroviride. The first preliminary crystallographic analysis of ENGase was conducted in 1994. But to date, only a few ENGases structures have been obtained, and the structure of human ENGase is still missing. The currently identified ENGases were distributed in the GH18 or GH85 families in Carbohydrate-Active enZyme (CAZy) database. GH18 ENGase only has hydrolytic activity, but GH85 ENGase has both hydrolytic and transglycosylation activity. Although ENGases of the two families have similar (β/α)8-TIM barrel structures, the active sites are slightly different. ENGase is an effective tool for glycan detection andglycan editing. Biochemically, ENGase can specifically hydrolyze β‑1,4 glycosidic bond between the twoN-acetylglucosamines (GlcNAc) on core pentasaccharide presented on glycopeptides and/or glycoproteins. Different ENGases may have different substrate specificity. The hydrolysis products are oligosaccharide chains and a GlcNAc or glycopeptides or glycoproteins with a GlcNAc. Conditionally, it can use the two products to produce a new glycopeptides or glycoprotein. Although ENGase is a common presentation in cell, its biological function remains unclear. Accumulated evidences demonstrated that ENGase is a none essential gene for living and a key regulator for differentiation. No ENGase gene was detected in the genomes of Saccharomyces cerevisiae and three other yeast species. Its expression was extremely low in lung. As glycoproteins are not produced by prokaryotic cells, a role for nutrition and/or microbial-host interaction was predicted for bacterium produced enzymes. In the embryonic lethality phenotype of the Ngly1-deficient mice can be partially rescued by Engase knockout, suggesting down regulation of Engase might be a solution for stress induced adaptation. Potential impacts of ENGase regulation on health and disease were presented. Rabeprazole, a drug used for stomach pain as a proton inhibitor, was identified as an inhibitor for ENGase. ENGases have been applied in vitro to produce antibodies with a designated glycan. The two step reactions were achieved by a pair of ENGase dominated for hydrolysis of substrate glycoprotein and synthesis of new glycoprotein with a free glycan of designed structure, respectively. In addition, ENGase was also been used in cell surface glycan editing. New application scenarios and new detection methods for glycobiological engineering are quickly opened up by the two functions of ENGase, especially in antibody remodeling and antibody drug conjugates. The discovery, distribution, structure property, enzymatic characteristics and recent researches in topical model organisms of ENGase were reviewed in this paper. Possible biological functions and mechanisms of ENGase, including differentiation, digestion of glycoproteins for nutrition and stress responding were hypothesised. In addition, the role of ENGase in glycan editing and synthetic biology was discussed. We hope this paper may provide insights for ENGase research and lay a solid foundation for applied and translational glycomics.

Osteoporotic proximal humeral fracture (OPHF) is one of the common osteoporotic fractures in the aged, with an incidence only lower than vertebral compression fracture, hip fracture, and distal radius fracture. OPHF, secondary to osteoporosis and characterized by poor bone quality, comminuted fracture pattern, slow healing, and severely impaired shoulder joint function, poses a big challenge to the current clinical diagnosis and treatment. In the field of diagnosis, treatment, and rehabilitation of OPHF, traditional Chinese and Western medicine have accumulated rich experience and evidence from evidence-based medicine and achieved favorable outcomes. However, there is still a lack of guidance from a relevant consensus as to how to integrate the advantages of the two medical systems and achieve the integrated diagnosis and treatment. To promote the diagnosis and treatment of OPHF with integrated traditional Chinese and Western medicine, relevant experts from Orthopedic Expert Committee of Geriatric Branch of Chinese Association of Gerontology and Geriatrics, Youth Osteoporosis Group of Orthopedic Branch of Chinese Medical Association, Osteoporosis Group of Orthopedic Surgeon Branch of Chinese Medical Doctor Association, and Osteoporosis Committee of Shanghai Association of Integrated Traditional Chinese and Western Medicine have been organized to formulate Expert consensus on the diagnosis and treatment of osteoporotic proximal humeral fracture with integrated traditional Chinese and Western medicine ( version 2024) by searching related literatures and based on the evidences from evidence-based medicine. This consensus consists of 13 recommendations about the diagnosis, treatment and rehabilitation of OPHF with integrated traditional Chinese medicine and Western medicine, aimed at standardizing, systematizing, and personalizing the diagnosis and treatment of OPHF with integrated traditional Chinse and Western medicine to improve the patients ′ function.