Alzheimer’s disease (AD) is a prevalent neurodegenerative condition characterized by progressive cognitive decline and memory loss. As the incidence of AD continues to rise annually, researchers have shown keen interest in the active components found in natural plants and their neuroprotective effects against AD. Quercetin, a flavonol widely present in fruits and vegetables, has multiple biological effects including anticancer, anti-inflammatory, and antioxidant. Oxidative stress plays a central role in the pathogenesis of AD, and the antioxidant properties of quercetin are essential for its neuroprotective function. Quercetin can modulate multiple signaling pathways related to AD, such as Nrf2-ARE, JNK, p38 MAPK, PON2, PI3K/Akt, and PKC, all of which are closely related to oxidative stress. Furthermore, quercetin is capable of inhibiting the aggregation of β‑amyloid protein (Aβ) and the phosphorylation of tau protein, as well as the activity of β‑secretase 1 and acetylcholinesterase, thus slowing down the progression of the disease.The review also provides insights into the pharmacokinetic properties of quercetin, including its absorption, metabolism, and excretion, as well as its bioavailability challenges and clinical applications. To improve the bioavailability and enhance the targeting of quercetin, the potential of quercetin nanomedicine delivery systems in the treatment of AD is also discussed. In summary, the multifaceted mechanisms of quercetin against AD provide a new perspective for drug development. However, translating these findings into clinical practice requires overcoming current limitations and ongoing research. In this way, its therapeutic potential in the treatment of AD can be fully utilized.

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

OBJECTIVE: To explore clinical efficacy of bone cement filling combined with lower extremity arterial balloon dilation in treating Wagner grade Ⅳ diabetic foot (DF). METHODS: From January to October 2024, 9 Wagner grade Ⅳ DF patients with lower extremity vascular occlusion were admitted, including 7 males and 2 females, aged from 51 to 87 years old;5 patients on the left side and 4 patients on the right side. All patients were underwent stageⅠdebridement of the affected foot and bone cement filling, and treated with lower extremity arterial balloon dilation after operation, they were. After the formation of the induced membrane, stageⅡwound repair was performed. The wound healing time and condition were observed. Ankle-brachial index (ABI) was used to evaluate the lower extremity vascular perfusion before operation and 3 months after operation, respectively. RESULTS: The wounds of all 9 patients healed completely, and the healing time ranged from 45 to 65 days. All patients were followed up for at least 6 months without recurrence. The skin of the affected foot wound healed with keratinization, and there was mild scar hyperplasia locally (1 patient had necrosis of the adjacent toe after stageⅠsurgery and was debridement and toe amputation again). The narrowed or occluded blood vessels of the lower extremities were all recanalized. ABI recovered from 0.3 to 0.5 before operation to 1.0 to 1.1 at 3 months after operation. CONCLUSION Bone cement filling combined with lower extremity arterial balloon dilation for the treatment of grade Wagner Ⅳ DF is conducive to promoting healing of the affected foot, effectively preventing secondary ulceration of the affected foot, and clinical therapeutic effect is satisfactory.
Humans ; Male ; Female ; Middle Aged ; Diabetic Foot/surgery* ; Aged ; Bone Cements/therapeutic use* ; Aged, 80 and over ; Lower Extremity/blood supply*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients. METHODS: We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables. RESULTS: During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively). CONCLUSIONS CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.

Abstract In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.

Objective To analyze the diversity and composition of gut microbiota in individuals with circadian rhythm disruption and their correlation with cognition.Methods Night shift workers and regular shift workers were subjected from our hospital during August 2022 and October 2024.The participants with circadian rhythm disorders were assigned into an experimental group(n=24),and those with normal circadian rhythms were into a control group(n=24).Their height,weight,age,gender,body mass index(BMI)and fresh fecal samples were collected,and Montreal Cognitive Assessment(MoCA)and Mini-Mental State Examination(MMSE)were used to evaluate their mental status.Metagenomics,Alpha and Beta diversity analyses,Linear Discriminant Analysis Effect Size(LEfSe),and Kyoto Encyclopedia of Genes and Genomes(KEGG)analysis were employed to investigate the diversity and function characteristics of gut microbiota in the participants.Results There were no statistical differences between the 2 groups in baseline data,such as height,weight,gender,age,and BMI(P>0.05).Alpha diversity analysis indicated that no statistical differences were observed in the ACE,Chao1,Shannon,or Simpson indices between the 2 groups,while beta diversity analysis revealed significant differences(P<0.01),suggesting different structure of gut microbiota between them.In the experimental group,the abundance of Faecalibacterium prausnitzii and Agathobacter rectalis was decreased,while that of Escherichia coli and Phocaeicola vulgaratus was increased,with significant differences when compared with the control group(P<0.05).Additionally,KEGG functional analysis showed that the experimental group had obviously higher expression levels in Th17 cell differentiation and the IL-17 signaling pathway than the control group(P<0.05).Agathobacter rectalis and Faecalibacterium prausnitzii were positively correlated with MoCA score and MMSE score(P<0.05,P<0.01).Agathobacter rectalis was negatively correlated with the IL-17 signaling pathway and Th17 cell differentiation.Conclusion Individuals with circadian rhythm disorders have significant changes in the structure and function of gut microbiota when compared to those with normal circadian rhythms.Agathobacter rectalis may be involved in the regulation of the IL-17 signaling pathway and differentiation of Th17 cells,thereby possibly impacting the increases of cognitive score related to circadian rhythm disorders.

Objective To explore the relationship between postoperative defecation dysfunction and quality of life in children with anorectal malformation(ARM)complicated with spinal cord anomalies(SCA)and analyze the impact of different types of SCA on ARM patients in order to provide a reference for the early clinical identification of high-risk children with poor prognosis.Methods A retrospective analysis was conducted on 282 ARM neonates admitted to our department between June 2015 and April 2021.Radiological examinations were applied to evaluate the development of the spinal cord,and Rintala score and the PedsQL 4.0 scale were employed to assess postoperative defecation function and quality of life,respectively.According to their SCA types and other complications,the patients were grouped.The relationship between these factors and defecation function as well as quality of life was then analyzed.Results Among the 282 subjected children,104(36.9%)had SCA.The incidence of SCA varied significantly across different types of ARM(P=0.002),with the highest incidence observed in vaginal fistula patients(100.0%)and the lowest in children without fistula(13.6%).Radiological findings revealed that sacral bone anomalies were common,with absent coccyx(62.7%)and vertebral anomalies(69.8%)being the most prevalent.The SCA group had significantly lower Rintala bowel function score(12.70±3.24)and PedsQL 4.0 quality of life score(81.42±5.03)than the non-SCA group(P<0.001).As the increment of SCA types,both the Rintala score and PedsQL 4.0 score were in a significant downward trend(P<0.001).Among the children with different types of SCA,those with tethered cord syndrome had the statistically lowest Rintala score(8.05±2.35,P<0.05).Meanwhile,their PedsQL 4.0 score(75.90±3.35)was significantly lower than those of other types except syrinx(P<0.05).Multiple linear regression analysis indicated that both SCA and sacral bone anomalies exerted notably negative impacts on the Rintala score and PedsQL 4.0 score(P≤0.001),with SCA having the most pronounced effect.Conclusion SCA is closely associated with postoperative defecation dysfunction and diminished quality of life in ARM children.The greater the type and number of SCAs,the worse the postoperative defecation function and quality of life.Early identification of concomitant SCAs holds significant clinical value for predicting postoperative outcomes in ARM patients.