Objective To provide a scientific basis for vector prevention and control in port areas, vector monitoring has been conducted continuously to characterize the composition, density, and seasonal fluctuations of vectors across 21 port-areas of Shandong province from 2017 to 2023. Methods In accordance with the Regional Vector Monitoring Plan for Frontier Ports, vector surveillance of mosquitoes, flies, cockroaches, rodents, and other disease vectors was performed. Data were analyzed to describe vector community composition and identify seasonal fluctuations. Results A total of 601 rodents belonging to 1 family, 4 genera, and 4 species were captured. Three dominant rodent species inhabit port areas. In addition, 88 104 mosquitoes were captured and classified into 3 subfamilies, 4 genera, and 12 species; 38 959 flies were trapped and classified into 8 families,31 genera, and 51 species, including 9 dominant fly species in port-areas; and 54 672 captured cockroaches were classified into 2 families,4 genera, and 4 species, with Blattella germanica as the dominant species. Conclusions Significant vector community changes(P＜0.005)have been identified after the epidemic. To improve the pertinence and efficacy of port health quarantine work, continuous and strong attention should be paid to vector compositions and population densities at Shandong ports.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

AIM To evaluate the quality of Tibetan medicine"Sangdi"based on HPLC fingerprints combined with chemometrics.METHODS The analysis was performed on a 30 ℃ thermostatic Welch Ultimate AQ-C18 column(250 mm × 4.6 mm,5 μm),with the mobile phase comprising of acetonitrile-0.2％phosphoric acid flowing at 1 mL/min in a gradient elution manner,and the detection wavelength was set at 245 nm,after which cluster analysis,principal component analysis and orthogonal partial least squares discriminant analysis were performed,the contents of gentiopicroside,sweroside,mangiferin,isoorientin,8-hydroxy-1,3,5-trimethoxyxanthone(R2)and 1,8-dihydroxy-3,7-dimethoxyxanthone(R3)were determined.RESULTS There were 18 common peaks in the fingerprints for 15 batches of samples with the similarities of more than 0.90.Six constituents showed good linear relationships within their own ranges(R 2 ≥ 0.999 2),whose average recoveries were 96.93％-103.58％with the RSDs of 0.82％-2.9％.Various batches of samples were clustered into 2 categories,4 principal components demonstrated the accumulative variance contribution rate of 86.404％,mangiferin,gentiopicroside and isoorientin were taken as quality difference markers.CONCLUSION This stable,reliable and reproducibe method can provide a reference for the comprehensive quality evaluation of"Sangdi".

AIM To study the chemical constituents from Citri reticulatae Pericarpium Viride and their anti-triple negative breast cancer activities in vitro.METHODS The ethanolic extract of Citri reticulatae Pericarpium Viride was isolated and purified by silica gel,polyamide,MCI,Sephadex LH-20 and semi-preparative HPLC,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The anti-triple negative breast cancer activities were screened by SRB assay,and their effects on the proliferation of triple negative breast cancer cell lines HCC1806,HCC1937 and MDA-MB-231 in vitro were evaluated.RESULTS Twenty compounds were isolated and identified as nobiletin(1),tangeritin(2),5,4'-dihydroxy-7,8-dimethoxy flavonoid(3),naringenin(4),artemetin(5),5-demethynobiletin(6),3,5,6,7,8,3',4'-pentamethoxy flavonoid(7),5,4'-dihydroxy-3,6,7,8,3'-pentamethoxyflavone(8),xanthomicrol(9),p-hydroxycinnamic acid(10),5,4'-dihydroxy-6,7,8,3'-tetramethoxyflavone(11),pectolinarigenin(12),4'-dihydroxy-5,6,7-tetramethoxyflavone(13),hispidulin(14),4',5,6,7-tetramethoxy-flavone(15),1-methyl-4-(prop-1-en-2-yl)cyclohexane-1,2-diol(16),umbelliferone(17),5-hydroxymethyl furfural(18),hydroquinone(19),1H-indole-3-carbaldehyde(20).Compound 8 showed a significant inhibitory effect with the IC50 value of(5.36±0.24)μmol/L on HCC1806 cells.CONCLUSION Compound 20 is isolated from genus Citrus for the first time,8,12-13,16-17 are isolated from this plant for the first time.Compound 8 show inhibitory effects on the proliferation of HCC1806,HCC1937 and MDA-MB-231 cells in vitro and have the strongest activities.Compounds 3-4,11-12,15,17 and 19 show strong inhibitory effect on HCC1806 cells.Compounds 15,19 also inhibit the proliferation of HCC1937 cells in vitro.

AIM To explore the effects of Dahuang Lingxian Recipe on Th1/Th2 cell immune imbalance in a rat model of cholestatic liver fibrosis(CLF).METHODS 20 SD rats were randomly divided into the normal group,the model group,the ursodeoxycholic acid group(0.063 g/kg)and the Dahuang Lingxian Recipe group(4.8 g/kg),with 5 rats in each group.Except for those of the normal group,the rats of all other groups had open surgery of common bile duct ligation,followed by the gavage of corresponding drug two days later,and the procurement of the samples after gavage in the third week.The rats had their degree of liver fibrosis observed by HE and Masson stainings;their levels of serum total bile acid(TBA),alkaline phosphatase(AKP),γ-glutamyltransferase(γ-GT),alanine aminotransferase(ALT),aspartate aminotransferase(AST)and total bilirubin(TBil)measured by the kit;their hepatic percentage of TGF-β1,p-Smad2 and p-Smad3 positive cells detected by immunofluorescence and immunohistochemical staining;their.hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA detected by Western blot and RT-qPCR;their levels of helper T cell 1(Th1)and helper T cell 2(Th2)in peripheral blood detected by flow cytometry,and their ratio of Th1/Th2 calculated as well.RESULTS Compared with the model group,the groups intervened with either ursodeoxycholic acid or Dahuang Lingxian Recipe displayed well-ordered liver cells,hepatic lobules and hepatic cords;a small amount of fatty degeneration;significantly reduced connective hyperplasia of hepatic fibers;significantly narrowed fibrous cords;a small amount of blue fibrous septa;greatly improved pathological injuries including inflammatory infiltration of central vein and portal area;decreased levels of serum TBA,TBil,AKP,γ-GT,ALT and AST(P＜0.05);decreased hepatic expressions of TGF-β1,p-Smad2 and p-Smad3(P＜0.05);decreased hepatic expressions of TGF-β1,Smad4,NF-κB p65,Collagen Ⅰ and Collagen Ⅲ protein and mRNA(P＜0.05);and increased counts of Th1 cells in peripheral blood,decreased counts of Th2 cells,resultsing increased Th1/Th2 ratio(P＜0.05).And an even better effect was observed in the Dahuang Lingxian Recipe group.CONCLUSION Dahuang Lingxian Recipe can reduce or reverse CLF by inhibiting hepatic stellate cell activation through maintaining Th1/Th2 cell immune balance via the NF-κB/TGF-β1 signaling pathway.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVE: To retrospectively analyze the characteristics and influencing factors of COVID-19 infection in patients with multiple myeloma (MM) who underwent autologous hematopoietic stem cell transplantation (AHSCT). METHODS: The clinical data of MM patients who underwent AHSCT in Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine from May 26, 2021 to December 26, 2022 were collected. The onset of COVID-19 infection, corresponding symptoms and laboratory tests were followed up in outpatient or by the means of telephone contact and online questionnaires. Related analysis was then performed. RESULTS: This study included 96 patients, and 72 cases among them were infected with COVID-19 while 24 cases were uninfected. Logistic regression analysis showed that vaccination did not significantly reduce the risk of COVID-19 infection, but patients who received two doses of the vaccine had a lower risk of developing moderate and severe disease than those who did not receive or received one dose (OR =0.06, P =0.029). Patients who received daratumumab before had a higher risk of COVID-19 infection (OR =5.78, P =0.039), while those with a history of immunomodulatory drugs (IMiDs) had the opposite effect (OR =0.31, P =0.028). The use of both drugs did not affect the severity of COVID-19 infection. CONCLUSION For MM patients undergoing AHSCT as first-line chemotherapy, COVID-19 vaccination does not significantly reduce the infection rate, but it plays a role in preventing moderate and severe cases. The application of antineoplastic drugs with different mechanisms has a certain impact on the susceptibility to the COVID-19, which should be considered comprehensively when creating treatment plans.
Humans ; Multiple Myeloma/complications* ; COVID-19/epidemiology* ; Hematopoietic Stem Cell Transplantation ; Transplantation, Autologous ; Retrospective Studies ; Risk Assessment ; Risk Factors ; Male ; Female ; Middle Aged ; SARS-CoV-2 ; Adult ; Antibodies, Monoclonal

OBJECTIVE: To evaluate the efficacy and safety of Shexiang Tongxin Dropping Pill (STDP) in treating stable angina patients with phlegm-heat and blood-stasis syndrome by exercise duration and metabolic equivalents. METHODS: This multicenter, randomized, double-blind, placebo-controlled clinical trial enrolled stable angina patients with phlegm-heat and blood-stasis syndrome from 22 hospitals. They were randomized 1:1 to STDP (35 mg/pill, 6 pills per day) or placebo for 56 days. The primary outcome was the exercise duration and metabolic equivalents (METs) assessed by the standard Bruce exercise treadmill test after 56 days of treatment. The secondary outcomes included the total angina symptom score, Chinese medicine (CM) symptom scores, Seattle Angina Questionnaire (SAQ) scores, changes in ST-T on electrocardiogram and adverse events (AEs). RESULTS: This trial enrolled 309 patients, including 155 and 154 in the STDP and placebo groups, respectively. STDP significantly prolonged exercise duration with an increase of 51.0 s, compared to a decrease of 12.0 s with placebo (change rate: -11.1% vs. 3.2%, P<0.01). The increase in METs was significantly greater in the STDP group than in the placebo group (change: -0.4 vs. 0.0, change rate: -5.0% vs. 0.0%, P<0.01). The improvement of total angina symptom scores (25.0% vs. 0.0%), CM symptom scores (38.7% vs. 11.8%), reduction of nitroglycerin consumption (100.0% vs. 11.3%), and all domains of SAQ, were significantly greater with STDP than placebo (all P<0.01). The changes in Q-T intervals at 28 and 56 days from baseline were similar between the two groups (both P>0.05). Twenty-five participants (16.3%) with STDP and 16 (10.5%) with placebo experienced AEs (P=0.131), with no serious AEs observed. CONCLUSION STDP could improve exercise tolerance in patients with stable angina and phlegm-heat and blood stasis syndrome, with a favorable safety profile. (Registration No. ChiCTR-IPR-15006020).
Humans ; Double-Blind Method ; Drugs, Chinese Herbal/adverse effects* ; Male ; Female ; Middle Aged ; Angina, Stable/physiopathology* ; Aged ; Syndrome ; Treatment Outcome ; Placebos ; Tablets