OBJECTIVE To investigate the improvement effects and mechanism of Achyranthes bidentata total saponins （ABS） extract on vascular endothelial dysfunction in spontaneously hypertensive rat （SHR） based on cytochrome P450 4A （CYP4A）/20-hydroxyeicosatetetraenoic acid （20-HETE）/G protein-coupled receptor 75 （GPR75） axis. METHODS Ten Wistar- Kyoto rats were taken as the normal control group. Forty SHR were first stratified by systolic blood pressure and then， within each stratum， randomly assigned using a random-number table to the model group （MOD group）， captopril positive control group （CAP group， 10 mg/kg）， ABS low- and high-dose extract groups （ABS-L group， ABS-H group， 60 and 120 mg/kg）， with 10 rats in each group. Animals in each group were given the corresponding drug or equal volume of pure water by gavage， once a day， for 28 consecutive days. After the last administration， systolic blood pressure of rats was measured. The levels of vasoactive substances， inflammatory factors and oxidative stress indicators in serum were measured. The pathological changes of rat thoracic aorta were observed. The level of reactive oxygen species （ROS） in aortic tissue was analyzed. The expressions of endothelial nitric oxide synthase （eNOS）， CYP4A， GPR75， nuclear factor-κB p65 （NF-κB p65）， phosphorylated NF-κB p65， p22phox， and reduced nicotinamide adenine dinucleotide phosphate oxidase 4（NOX4） in thoracic aorta tissue were detected. RESULTS After 28 d of treatment， compared with MOD group， the systolic blood pressure of rats in the ABS-L and ABS-H groups decreased significantly. The levels of 20-HETE， angiotensin Ⅱ， interleukin-1β， interleukin-6， tumor necrosis factor-α， intercellular cell adhesion molecule-1 and malondialdehyde in serum were significantly reduced （P＜0.05 or P＜0.01）， while the levels of nitric oxide， superoxide dismutase， glutathione peroxidase and catalase were significantly increased （P＜0.05 or P＜0.01）. Intimal damage of thoracic aorta was reduced， and endothelial cell morphology was improved. The expressions of ROS， CYP4A， GPR75， p22phox， NOX4 and the phosphorylation level of NF-κB p65 protein in thoracic aorta were down-regulated or reduced （P＜0.05 or P＜0.01）， while the expression of eNOS was up-regulated （P＜0.05 or P＜0.01）. CONCLUSIONS ABS extract may alleviate the inflammatory response and oxidative stress in SHR effectively by down-regulating the expression of CYP4A， reducing the production of 20-HETE， inhibiting the activation of GPR75， and subsequently suppressing the activation of downstream NF-κB and NOX4， thereby improving hypertension-related vascular endothelial dysfunction.

ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

ObjectiveTo investigate the impact of portal vein tumor thrombus （PVTT） classification on rebleeding in hepatocellular carcinoma （HCC） patients with different PVTT subtypes and esophagogastric variceal bleeding （EGVB）， and to provide a reference for formulating rational treatment regimens for such patients. MethodsA retrospective study was performed for 130 patients with HCC and PVTT who were treated due to EGVB in Beijing Ditan Hospital， Capital Medical University， from July 2020 to January 2025， and according to whether endoscopic treatment was performed， the patients were divided into endoscopic treatment group with 97 patients and conservative treatment group with 33 patients. Demographic and clinical data were collected from all patients， and the two groups were compared in terms of hemostasis success rate and rebleeding rate. The independent-samples t test was used for comparison of normally distributed continuous data between groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to estimate the cumulative incidence rate of rebleeding in patients with different subtypes of PVTT. Propensity score matching （PSM） was performed for the endoscopic treatment group and the conservative treatment group to balance the baseline data of the two groups. The Cox proportional hazards model was used to perform univariate and multivariate analyses and identify independent risk factors for rebleeding. ResultsThe endoscopic treatment group had a significantly lower cumulative rebleeding rate within 6 months than the conservative treatment group （35.1% vs 57.6%， hazard ratio ［HR］=0.480， 95% confidence interval ［CI］： 0.272—0.851， P=0.019）. The PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate within 6 months than the PVTT Ⅱ group （52.2% vs 37.5%， HR=1.744， 95%CI： 1.008 — 3.018， P=0.022）. After PSM， there was no significant difference in rebleeding rate between the endoscopic treatment group and the conservative treatment group （38.1% vs 14.3%，HR=1.500，95%CI：0.125 — 2.002， P=0.588）， while the PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate than the PVTT Ⅱ group （58.8% vs 12.5%，HR=1.561，95%CI：1.195 — 12.499，P=0.033）. The multivariate Cox regression analysis showed that PVTT subtype （HR=1.412， 95%CI： 0.998 — 1.997， P=0.049）， platelet count （HR=1.006， 95%CI： 1.001 — 1.010， P=0.021）， C-reactive protein （HR=1.011， 95%CI： 1.001 — 1.021， P=0.026）， and ascites （HR=1.803， 95%CI： 1.059 — 3.068， P=0.030） were independent risk factors for rebleeding. ConclusionFor HCC patients with PVTT and EGVB， endoscopic treatment can successfully achieve hemostasis， while it fails to significantly reduce rebleeding rates. PVTT classification can affect the risk of rebleeding， and patients with PVTT types Ⅲ—Ⅳ have a relatively high rebleeding rate.

Colorectal cancer (CRC) is a common malignant tumor. The treatment of patients with advanced disease still faces severe challenges. Among patients with metastatic colorectal cancer (mCRC), most of those with microsatellite stable (MSS)/proficient mismatch repair (pMMR) tumors are highly insensitive to monotherapy with immune checkpoint inhibitors. With in-depth investigations into the mechanisms of the tumor immune microenvironment in MSS/pMMR CRC, the combination strategies of immunotherapy and targeted therapy have become a key direction to break through the treatment bottleneck in this population. These strategies include combinations of immunotherapy with antiangiogenic agents, epidermal growth factor receptor inhibitors, histone deacetylase inhibitors, and MAPK pathway inhibitors. Although the current relevant evidence is mainly derived from early-phase clinical trials, a number of studies demonstrated that immunotherapy combined with targeted therapy can improve the objective response rate and survival benefit in patients with MSS/pMMR mCRC and shows remarkable efficacy advantages in specific subgroups. This article systematically reviews the biological basis and clinical research progress of relevant combination therapeutic strategies, discusses potential beneficiary subgroups, and prospects future research directions. It aims to provide theoretical evidence and clinical references for optimizing the individualized treatment paradigm for this large patient population.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Objective:To study the correlation between osteoporosis and the joint of small articular process of lumbar vertebra,and the correlation between bone mineral density(BMD)and various parameters of small joint based on quantitative computed tomography(QCT),so as to provide scientific basis for formulating clinically treatment strategies.Methods:This study included 63 patients who admitted to orthopedics of The Second Affiliated Hospital of Liaoning University of Traditional Chinese Medicine from December 2023 to March 2024 due to waist discomfort and lower limb pain.According to BMD standard of CT examination for lumbar vertebra,these patients were divided into normal BMD group(31 cases),osteopenia group(21 cases)and osteoporosis group(11 cases).All patients underwent CT scan on lumbar vertebra.The mode with body membrane were adopted to measure BMD,the area of left and right articular process,CT value,height after the scan was completed.Whether existed osteophytes,endplate inflammation and intervertebral disc herniation in each group were checked.Univariate Analysis of Variance(ANOVA)was employed to assess the differences among different BMD groups in age,gender,area of articular process,CT value and height.The Pathria grading system was adopted to assess the degeneration degree of intervertebral joint,and the Fisher's exact test was used to analyze the differences in degeneration scores of articular process among three groups.At the same time,the pairwise comparison between groups also was conducted.Spearman's rank correlation analysis was conducted to explore the correlation between BMD and the degeneration degree of intervertebral joint.Results:The BMD value of normal BMD group was(165.14±30.11)mg/cm3,and that of osteopenia group was(98.98±10.14)mg/cm3,and that of osteoporosis group was(58.62±18.73)mg/cm3.There was a statistically significant difference in BMD value among three groups(F=103.121,P＜0.001),and there was a statistically significant difference in BMD value between normal BMD group and osteopenia group as the result of pairwise comparison between groups(t=10.018,P＜0.001).There was statistically significant difference in BMD value between normal BMD group and osteoporosis group(t=12.989,P＜0.001),and there was statistically significant difference in BMD value between osteopenia group and osteoporosis group(t=4.641,P＜0.001).The areas of left and right upper articular process of normal BMD group were less than that of other two groups,and the differences of CT value and height of left and right upper articular process among three groups were significant(F=27.350,24.458,P＜0.05),respectively.The CT value of normal BMD group was higher than that of other two groups,and CT values of right upper articular process of osteopenia group was significantly lower than that of osteoporosis group,and the difference was statistical significance(t=2.191,P＜0.05).The heights of left and right upper articular processes of normal BMD group were lower than those of osteoporosis group,and the height of right upper articular process was lower than that of osteopenia group(t=2.331,-2.798,-2.618,P＜0.05).There was a negative correlation between osteoporosis degree and the degeneration of articular process joints(r=-0.745,P＜0.001).With the decreasing of BMD value,the degeneration of articular process joint gradually aggravated,and the ratios of osteophytes,endplate inflammation and intervertebral discs increased.Conclusion:There is a certain correlation between the osteoporosis and the degeneration of articular process joints of lumbar intervertebral disc.The ratios of osteophytes,endplate inflammation and intervertebral disc herniation increase,and both the area and height of the left and right articular process increase when the reduction of bone mass reaches to a serious degree.

Peroxynitrite anion(ONOO-),which is originated from the reaction of nitric oxide(NO)and superoxide anion(O2-),plays a pivotal role in immune defense and signal regulation.Excessive levels of ONOO-may induce the occurrence of various diseases such as Alzheimer's disease,inflammation,cardiovascular disease and cancer,etc.Existing detection methods for ONOO-have limitations such as complexity,time consumption,and low cell biocompatibility.In this study,a novel fluorescent probe QFPD was developed using quinoline and diphenylphosphinamide as fluorescent keleton and recognition group,respectively.The strong oxidizing property of ONOO-triggerd the cleavage of phosphoramide bond,leading to fluorescence quenching and a visible color change of the solution from yellow to purple,thereby enabling"ON-OFF"type recognition of ONOO-.QFPD exhibited excellent characteristics including good selectivity and high sensitivity in fluorescence detection(Limit of detection of 1.37 μmol/L),large Stokes shift(130 nm),rapid response(10 min),and strong anti-interference ability.Additionally,QFPD demonstrated good biocompatibility and could realize real-time dynamic monitoring of endogenous ONOO-.Furthermore,QFPD was successfully applied to environmental toxicology research by visualizing the oxidative stress effects induced by microplastics polymethyl methacrylate(PMMA)and Hg2+exposure,which might be a novel tool for the mechanism research on oxidative stress associated with microplastic pollution and heavy metal exposure.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To compare the efficacy of transcatheter tricuspid valve replacement (TTVR) using Lux-Valve and Lux-Valve Plus in patients with severe tricuspid regurgitation. METHODS: A total of 28 consecutive patients with severe tricuspid regurgitation who underwent TTVR with Lux-Valve (n=14) or Lux-Valve Plus (n=14) in the First Affiliated Hospital of the Air Force Medical University from August 2019 to November 2023 were enrolled. Transthoracic echocardiography was performed in all patients before and 6 months after the TTVR. The ultrasound indexes were compared before and 6 months after the TTVR in all patients and between Lux-Valve and Lux-Valve Plus groups. RESULTS: Compared with the Lux-Valve group, the Lux-Valve Plus group showed significantly reduced intraoperative bleeding and shorter postoperative hospital stays (both P<0.05). Six months after the TTVR, none of the patients exhibited more than a mild tricuspid valve regurgitation, and none of the patients had moderate or above perivalvular leakage except for one patient in the Lux-Valve Plus group who had a separation of the clamping member from the anterior tricuspid leaflet. The incidence of perivalvular leakage was significantly lower in the Lux-Valve Plus group (14.29%, 2/14) than in the Lux-Valve group (64.29%, 9/14, P<0.05). At 6 months after operation, the right chamber volume and right ventricle middle transverse diameter were reduced (both P<0.05); the peak blood flow velocity across the tricuspid valve, peak pressure gradient across the tricuspid valve, mean blood flow velocity of tricuspid valve, mean pressure gradient across the tricuspid valve and velocity time integral were increased in both groups (all P<0.05).Compared with the Lux-Valve group, the Lux-Valve Plus group showed higher left ventricular ejection fraction at 6 months postoperatively (P<0.05), while the rest of the indicators were not statistically different (all P>0.05). CONCLUSIONS The efficacy of using Lux-Valve and Lux-Valve Plus for TTVR in patients with severe tricuspid regurgitation is comparable. Six months after the TTVR, the right side of the heart has undergone reverse remodeling.While Lux-Valve Plus offers greater minimally invasive benefits, valve selection should consider device-specific characteristics and differences in individual patients.
Humans ; Tricuspid Valve Insufficiency/surgery* ; Male ; Female ; Heart Valve Prosthesis Implantation/methods* ; Middle Aged ; Aged ; Tricuspid Valve/surgery* ; Heart Valve Prosthesis ; Treatment Outcome ; Echocardiography ; Adult ; Cardiac Catheterization/methods*