OBJECTIVE To investigate the improvement effects and mechanism of Achyranthes bidentata total saponins （ABS） extract on vascular endothelial dysfunction in spontaneously hypertensive rat （SHR） based on cytochrome P450 4A （CYP4A）/20-hydroxyeicosatetetraenoic acid （20-HETE）/G protein-coupled receptor 75 （GPR75） axis. METHODS Ten Wistar- Kyoto rats were taken as the normal control group. Forty SHR were first stratified by systolic blood pressure and then， within each stratum， randomly assigned using a random-number table to the model group （MOD group）， captopril positive control group （CAP group， 10 mg/kg）， ABS low- and high-dose extract groups （ABS-L group， ABS-H group， 60 and 120 mg/kg）， with 10 rats in each group. Animals in each group were given the corresponding drug or equal volume of pure water by gavage， once a day， for 28 consecutive days. After the last administration， systolic blood pressure of rats was measured. The levels of vasoactive substances， inflammatory factors and oxidative stress indicators in serum were measured. The pathological changes of rat thoracic aorta were observed. The level of reactive oxygen species （ROS） in aortic tissue was analyzed. The expressions of endothelial nitric oxide synthase （eNOS）， CYP4A， GPR75， nuclear factor-κB p65 （NF-κB p65）， phosphorylated NF-κB p65， p22phox， and reduced nicotinamide adenine dinucleotide phosphate oxidase 4（NOX4） in thoracic aorta tissue were detected. RESULTS After 28 d of treatment， compared with MOD group， the systolic blood pressure of rats in the ABS-L and ABS-H groups decreased significantly. The levels of 20-HETE， angiotensin Ⅱ， interleukin-1β， interleukin-6， tumor necrosis factor-α， intercellular cell adhesion molecule-1 and malondialdehyde in serum were significantly reduced （P＜0.05 or P＜0.01）， while the levels of nitric oxide， superoxide dismutase， glutathione peroxidase and catalase were significantly increased （P＜0.05 or P＜0.01）. Intimal damage of thoracic aorta was reduced， and endothelial cell morphology was improved. The expressions of ROS， CYP4A， GPR75， p22phox， NOX4 and the phosphorylation level of NF-κB p65 protein in thoracic aorta were down-regulated or reduced （P＜0.05 or P＜0.01）， while the expression of eNOS was up-regulated （P＜0.05 or P＜0.01）. CONCLUSIONS ABS extract may alleviate the inflammatory response and oxidative stress in SHR effectively by down-regulating the expression of CYP4A， reducing the production of 20-HETE， inhibiting the activation of GPR75， and subsequently suppressing the activation of downstream NF-κB and NOX4， thereby improving hypertension-related vascular endothelial dysfunction.

ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

INTRODUCTION: While traditional Chinese medicine (TCM) has a long history and continues to be widely practised, its overall clinical efficacy according to conventional scientific standards remains the topic of ongoing research and exploration. This review focuses on the potential use of acupuncture and Chinese herbal medicine (CHM) in combination with Western medicine in Singapore, based on recently published data on the clinical effectiveness and cost-effectiveness of these TCM treatments. METHOD: We collated and summarised 71 research papers published in the past decade, focusing on randomised controlled trials, systematic reviews and population-based cohort studies that had a total sample size (treatment and control arms) exceeding 60. English-language articles published between 2015 and 2025 were identified by searching PubMed/MEDLINE, the Cochrane Library and the China National Knowledge Infrastructure. The search strategy included intervention terms like "acupuncture", "Chinese medicine", "TCM", "traditional Chinese medicine", "RCT" and "randomized controlled trial"; economic evaluation terms like "cost" and "cost-effectiveness"; and disease conditions of concern. We narrowed our research to the clinical effectiveness and cost-effectiveness of CHM in which either the individual ingredients or the products were listed as Chinese Proprietary Medicines (CPMs). RESULTS: The summary tables demonstrate that the integration of acupuncture and/or CPMs with conventional Western medicine can enhance treatment outcomes across various chronic and non-chronic diseases. Their affordability and preventive focus can contribute to long-term healthcare cost savings, benefiting both patients and the healthcare system as a whole. CONCLUSION With a robust regulatory framework, scientific validation and government support, acupunc-ture and CPMs have an important role in the management of various diseases, especially chronic ones, in Singapore.
Humans ; Singapore ; Medicine, Chinese Traditional/methods* ; Acupuncture Therapy/methods* ; Drugs, Chinese Herbal/economics* ; Cost-Benefit Analysis ; Disease Management

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

The therapeutic effects of Yueju Pills on depression and cardiovascular diseases have been widely recognized. Previous studies have shown that the drug can significantly improve depressive-like behaviors induced by chronic unpredictable mild stress(CUMS) combined with atherosclerosis(AS). Given the complex pathogenesis of psychocardiac diseases, this study integrated metabolomics and network pharmacology to systematically elucidate the mechanism of Yueju Pills in alleviating depressive symptoms in psychocardiac diseases. The results demonstrate that, after Yueju Pill intervention, the levels of 9 abnormal metabolites in the hippocampus restore to normal ranges, primarily involving key pathways or signaling pathways, including the cyclic adenosine monophosphate(cAMP), mammalian target of rapamycin(mTOR), glycine/serine/threonine metabolism, and aminoacyl-tRNA biosynthesis. In a high-fat diet-induced CUMS ApoE~(-/-) mouse model, Yueju Pills significantly increases adenosine monophosphate(AMP) levels and decreases L-alanine and D-glyceric acid levels in the hippocampus. In conclusion, Yueju Pills exert antidepressant effects by regulating multiple metabolic axes, including glycine/serine/threonine metabolism and the cAMP, mTOR signaling pathways. Network pharmacology predictions reveal that the treatment of CUMS combined with AS by its core active components may be realized through modulating pathways concerning neuroinflammation and synaptic plasticity, including serine/threonine-protein kinase 1(AKT1), mitogen-activated protein kinase 1(MAPK1), and prostaglandin-endoperoxide synthase 2(PTGS2). This study provides a theoretical reference for the clinical application of Yueju Pills in alleviating the depressive symptoms of psychocardiac diseases.
Animals ; Network Pharmacology ; Mice ; Drugs, Chinese Herbal/administration & dosage* ; Metabolomics ; Male ; Depression/genetics* ; Humans ; Hippocampus/drug effects* ; Mice, Inbred C57BL ; Signal Transduction/drug effects*

Abstract In recent years, the prevalence of overweight and obesity among children and adolescents has risen rapidly, posing a serious threat to their physical and mental health. To provide scientific, systematic, and standardized weight management guidance for overweight and obese children and adolescents, the study focuses on the core concept of healthy lifestyle intervention, integrates multidisciplinary expert opinions and research findings,and proposes a comprehensive multidisciplinary intervention framework covering scientific exercise intervention, precise nutrition and diet, optimized sleep management, and standardized psychological support. It calls for the establishment of a multi agent collaborative management mechanism led by the government, implemented by families, fostered by schools, initiated by individuals, optimized by communities, reinforced by healthcare, and coordinated by multiple stakeholders. Emphasizing a child and adolescent centered approach, the consensus advocates for comprehensive, multi level, and personalized guidance strategies to promote the internalization and maintenance of a healthy lifestyle. It serves as a reference and provides recommendations for the effective prevention and control of overweight and obesity, and enhancing the health level of children and adolescents.

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To compare the efficacy of transcatheter tricuspid valve replacement (TTVR) using Lux-Valve and Lux-Valve Plus in patients with severe tricuspid regurgitation. METHODS: A total of 28 consecutive patients with severe tricuspid regurgitation who underwent TTVR with Lux-Valve (n=14) or Lux-Valve Plus (n=14) in the First Affiliated Hospital of the Air Force Medical University from August 2019 to November 2023 were enrolled. Transthoracic echocardiography was performed in all patients before and 6 months after the TTVR. The ultrasound indexes were compared before and 6 months after the TTVR in all patients and between Lux-Valve and Lux-Valve Plus groups. RESULTS: Compared with the Lux-Valve group, the Lux-Valve Plus group showed significantly reduced intraoperative bleeding and shorter postoperative hospital stays (both P<0.05). Six months after the TTVR, none of the patients exhibited more than a mild tricuspid valve regurgitation, and none of the patients had moderate or above perivalvular leakage except for one patient in the Lux-Valve Plus group who had a separation of the clamping member from the anterior tricuspid leaflet. The incidence of perivalvular leakage was significantly lower in the Lux-Valve Plus group (14.29%, 2/14) than in the Lux-Valve group (64.29%, 9/14, P<0.05). At 6 months after operation, the right chamber volume and right ventricle middle transverse diameter were reduced (both P<0.05); the peak blood flow velocity across the tricuspid valve, peak pressure gradient across the tricuspid valve, mean blood flow velocity of tricuspid valve, mean pressure gradient across the tricuspid valve and velocity time integral were increased in both groups (all P<0.05).Compared with the Lux-Valve group, the Lux-Valve Plus group showed higher left ventricular ejection fraction at 6 months postoperatively (P<0.05), while the rest of the indicators were not statistically different (all P>0.05). CONCLUSIONS The efficacy of using Lux-Valve and Lux-Valve Plus for TTVR in patients with severe tricuspid regurgitation is comparable. Six months after the TTVR, the right side of the heart has undergone reverse remodeling.While Lux-Valve Plus offers greater minimally invasive benefits, valve selection should consider device-specific characteristics and differences in individual patients.
Humans ; Tricuspid Valve Insufficiency/surgery* ; Male ; Female ; Heart Valve Prosthesis Implantation/methods* ; Middle Aged ; Aged ; Tricuspid Valve/surgery* ; Heart Valve Prosthesis ; Treatment Outcome ; Echocardiography ; Adult ; Cardiac Catheterization/methods*