ObjectiveTo investigate the safety and efficacy of puncture cyanoacrylate selective seal （PCSS） under endoscopic ultrasound in the treatment of gastroesophageal varices （GOV）. MethodsA total of 100 patients with liver cirrhosis who underwent endoscopic therapy for the secondary prevention of GOV bleeding in Beijing Ditan Hospital， Capital Medical University， from March 1 to December 31， 2023 were enrolled and randomly divided into PCSS group and traditional endoscopy group. The patients were followed up for 6 months after surgery， and the two groups were compared in terms of clinical outcome and complications. The primary outcome measure was the rate of alleviation or disappearance of GOV， and the secondary outcome measure was variceal rebleeding and death. The independent-samples t test was used for comparison of normally distributed or approximately normally distributed quantitative data between two groups， and the Wilcoxon non-parametric test was used for comparison of non-normally distributed quantitative data between two groups； the chi-square test or the Fisher’s exact test was used for comparison of qualitative data between two groups. ResultsThere were 50 patients in the PCSS group， among whom 1 patient was lost to follow-up， and there were 50 patients in the traditional endoscopy group， among whom 3 patients were lost to follow-up. There were no significant differences between the two groups in baseline data such as age， sex， Child-Pugh class， varices grade， and GOV typing （all P>0.05）. Compared with the traditional endoscopy group， the PCSS group had significantly better results of the number of endoscopic treatment sessions （t=-15.671， P=0.001）， the total amount of tissue adhesive used （t=-2.830， P=0.006）， and the rate of alleviation or eradication of varices sclerosis （χ²=7.078， P=0.029）. Both groups had low rates of postoperative rebleeding， adverse reactions， and complications， and there were no significant differences between the two groups （all P>0.05）. ConclusionCompared with traditional endoscopy， PCSS can significantly enhance treatment outcome while maintaining safety standards.

INTRODUCTION: While traditional Chinese medicine (TCM) has a long history and continues to be widely practised, its overall clinical efficacy according to conventional scientific standards remains the topic of ongoing research and exploration. This review focuses on the potential use of acupuncture and Chinese herbal medicine (CHM) in combination with Western medicine in Singapore, based on recently published data on the clinical effectiveness and cost-effectiveness of these TCM treatments. METHOD: We collated and summarised 71 research papers published in the past decade, focusing on randomised controlled trials, systematic reviews and population-based cohort studies that had a total sample size (treatment and control arms) exceeding 60. English-language articles published between 2015 and 2025 were identified by searching PubMed/MEDLINE, the Cochrane Library and the China National Knowledge Infrastructure. The search strategy included intervention terms like "acupuncture", "Chinese medicine", "TCM", "traditional Chinese medicine", "RCT" and "randomized controlled trial"; economic evaluation terms like "cost" and "cost-effectiveness"; and disease conditions of concern. We narrowed our research to the clinical effectiveness and cost-effectiveness of CHM in which either the individual ingredients or the products were listed as Chinese Proprietary Medicines (CPMs). RESULTS: The summary tables demonstrate that the integration of acupuncture and/or CPMs with conventional Western medicine can enhance treatment outcomes across various chronic and non-chronic diseases. Their affordability and preventive focus can contribute to long-term healthcare cost savings, benefiting both patients and the healthcare system as a whole. CONCLUSION With a robust regulatory framework, scientific validation and government support, acupunc-ture and CPMs have an important role in the management of various diseases, especially chronic ones, in Singapore.
Humans ; Singapore ; Medicine, Chinese Traditional/methods* ; Acupuncture Therapy/methods* ; Drugs, Chinese Herbal/economics* ; Cost-Benefit Analysis ; Disease Management

Guided by the concept of quality by design(QbD), this study optimizes the calcination and quenching process of calcined Magnetitum and establishes the XRD characteristic spectra of calcined Magnetitum, providing a scientific basis for the formulation of quality standards. Based on the processing methods and quality requirements of Magnetitum in the Chinese Pharmacopoeia, the critical process parameters(CPPs) identified were calcination temperature, calcination time, particle size, laying thickness, and the number of vinegar quenching cycles. The critical quality attributes(CQAs) included Fe mass fraction, Fe~(2+) dissolution, and surface color. The weight coefficients were determined by combining Analytic Hierarchy Process(AHP) and the criteria importance though intercrieria correlation(CRITIC) method, and the calcination process was optimized using orthogonal experimentation. Surface color was selected as a CQA, and based on the principle of color value, the surface color of calcined Magnetitum was objectively quantified. The vinegar quenching process was then optimized to determine the best processing conditions. X-ray diffraction(XRD) was used to establish the characteristic spectra of calcined Magnetitum, and methods such as similarity evaluation, cluster analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) were used to evaluate the quality of the spectra. The optimized calcined Magnetitum preparation process was found to be calcination at 750 ℃ for 1 h, with a laying thickness of 4 cm, a particle size of 0.4-0.8 cm, and one vinegar quenching cycle(Magnetitum-vinegar ratio 10∶3), which was stable and feasible. The XRD characteristic spectra analysis method, featuring 9 common peaks as fingerprint information, was established. The average correlation coefficient ranged from 0.839 5-0.988 1, and the average angle cosine ranged from 0.914 4 to 0.995 6, indicating good similarity. Cluster analysis results showed that Magnetitum and calcined Magnetitum could be grouped together, with similar compositions. OPLS-DA discriminant analysis identified three key characteristic peaks, with Fe_2O_3 being the distinguishing component between the two. The final optimized processing method is stable and feasible, and the XRD characteristic spectra of calcined Magnetitum was initially established, providing a reference for subsequent quality control and the formulation of quality standards for calcined Magnetitum.
X-Ray Diffraction/methods* ; Drugs, Chinese Herbal/chemistry* ; Quality Control ; Particle Size

The therapeutic effects of Yueju Pills on depression and cardiovascular diseases have been widely recognized. Previous studies have shown that the drug can significantly improve depressive-like behaviors induced by chronic unpredictable mild stress(CUMS) combined with atherosclerosis(AS). Given the complex pathogenesis of psychocardiac diseases, this study integrated metabolomics and network pharmacology to systematically elucidate the mechanism of Yueju Pills in alleviating depressive symptoms in psychocardiac diseases. The results demonstrate that, after Yueju Pill intervention, the levels of 9 abnormal metabolites in the hippocampus restore to normal ranges, primarily involving key pathways or signaling pathways, including the cyclic adenosine monophosphate(cAMP), mammalian target of rapamycin(mTOR), glycine/serine/threonine metabolism, and aminoacyl-tRNA biosynthesis. In a high-fat diet-induced CUMS ApoE~(-/-) mouse model, Yueju Pills significantly increases adenosine monophosphate(AMP) levels and decreases L-alanine and D-glyceric acid levels in the hippocampus. In conclusion, Yueju Pills exert antidepressant effects by regulating multiple metabolic axes, including glycine/serine/threonine metabolism and the cAMP, mTOR signaling pathways. Network pharmacology predictions reveal that the treatment of CUMS combined with AS by its core active components may be realized through modulating pathways concerning neuroinflammation and synaptic plasticity, including serine/threonine-protein kinase 1(AKT1), mitogen-activated protein kinase 1(MAPK1), and prostaglandin-endoperoxide synthase 2(PTGS2). This study provides a theoretical reference for the clinical application of Yueju Pills in alleviating the depressive symptoms of psychocardiac diseases.
Animals ; Network Pharmacology ; Mice ; Drugs, Chinese Herbal/administration & dosage* ; Metabolomics ; Male ; Depression/genetics* ; Humans ; Hippocampus/drug effects* ; Mice, Inbred C57BL ; Signal Transduction/drug effects*

Insulin-like growth factor 2 (IGF2) is a critical endocrine mediator implicated in male reproductive physiology. To investigate the correlation between IGF2 protein levels and various aspects of male infertility, specifically focusing on sperm quality, inflammation, and DNA damage, a cohort of 320 male participants was recruited from the Women's Hospital, Zhejiang University School of Medicine (Hangzhou, China) between 1 st January 2024 and 1 st March 2024. The relationship between IGF2 protein concentrations and sperm parameters was assessed, and Spearman correlation and linear regression analysis were employed to evaluate the independent associations between IGF2 protein levels and risk factors for infertility. Enzyme-linked immunosorbent assay (ELISA) was used to measure IGF2 protein levels in seminal plasma, alongside markers of inflammation (tumor necrosis factor-alpha [TNF-α] and interleukin-1β [IL-1β]). The relationship between seminal plasma IGF2 protein levels and DNA damage marker phosphorylated histone H2AX (γ-H2AX) was also explored. Our findings reveal that IGF2 protein expression decreased notably in patients with asthenospermia and teratospermia. Correlation analysis revealed nuanced associations between IGF2 protein levels and specific sperm parameters, and low IGF2 protein concentrations correlated with increased inflammation and DNA damage in sperm. The observed correlations between IGF2 protein levels and specific sperm parameters, along with its connection to inflammation and DNA damage, underscore the importance of IGF2 in the broader context of male reproductive health. These findings lay the groundwork for future research and potential therapeutic interventions targeting IGF2-related pathways to enhance male fertility.
Humans ; Male ; Insulin-Like Growth Factor II/metabolism* ; Infertility, Male/genetics* ; DNA Damage ; Adult ; Inflammation/metabolism* ; Spermatozoa/metabolism* ; Semen Analysis ; Semen/metabolism* ; Tumor Necrosis Factor-alpha/metabolism* ; Histones/metabolism* ; Interleukin-1beta/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To compare the efficacy of transcatheter tricuspid valve replacement (TTVR) using Lux-Valve and Lux-Valve Plus in patients with severe tricuspid regurgitation. METHODS: A total of 28 consecutive patients with severe tricuspid regurgitation who underwent TTVR with Lux-Valve (n=14) or Lux-Valve Plus (n=14) in the First Affiliated Hospital of the Air Force Medical University from August 2019 to November 2023 were enrolled. Transthoracic echocardiography was performed in all patients before and 6 months after the TTVR. The ultrasound indexes were compared before and 6 months after the TTVR in all patients and between Lux-Valve and Lux-Valve Plus groups. RESULTS: Compared with the Lux-Valve group, the Lux-Valve Plus group showed significantly reduced intraoperative bleeding and shorter postoperative hospital stays (both P<0.05). Six months after the TTVR, none of the patients exhibited more than a mild tricuspid valve regurgitation, and none of the patients had moderate or above perivalvular leakage except for one patient in the Lux-Valve Plus group who had a separation of the clamping member from the anterior tricuspid leaflet. The incidence of perivalvular leakage was significantly lower in the Lux-Valve Plus group (14.29%, 2/14) than in the Lux-Valve group (64.29%, 9/14, P<0.05). At 6 months after operation, the right chamber volume and right ventricle middle transverse diameter were reduced (both P<0.05); the peak blood flow velocity across the tricuspid valve, peak pressure gradient across the tricuspid valve, mean blood flow velocity of tricuspid valve, mean pressure gradient across the tricuspid valve and velocity time integral were increased in both groups (all P<0.05).Compared with the Lux-Valve group, the Lux-Valve Plus group showed higher left ventricular ejection fraction at 6 months postoperatively (P<0.05), while the rest of the indicators were not statistically different (all P>0.05). CONCLUSIONS The efficacy of using Lux-Valve and Lux-Valve Plus for TTVR in patients with severe tricuspid regurgitation is comparable. Six months after the TTVR, the right side of the heart has undergone reverse remodeling.While Lux-Valve Plus offers greater minimally invasive benefits, valve selection should consider device-specific characteristics and differences in individual patients.
Humans ; Tricuspid Valve Insufficiency/surgery* ; Male ; Female ; Heart Valve Prosthesis Implantation/methods* ; Middle Aged ; Aged ; Tricuspid Valve/surgery* ; Heart Valve Prosthesis ; Treatment Outcome ; Echocardiography ; Adult ; Cardiac Catheterization/methods*

Ovarian tumor (OT) is the most lethal form of gynecologic malignancy, with minimal improvements in patient outcomes over the past several decades. Metastasis is the leading cause of ovarian cancer-related deaths, yet the underlying mechanisms remain poorly understood. Psychological stress is known to activate the glucocorticoid receptor (NR3C1), a factor associated with poor prognosis in OT patients. However, the precise mechanisms linking NR3C1 signaling and metastasis have yet to be fully elucidated. In this study, we demonstrate that chronic restraint stress accelerates epithelial-mesenchymal transition (EMT) and metastasis in OT through an NR3C1-dependent mechanism involving nuclear protein 1 (NUPR1). Mechanistically, NR3C1 directly regulates the transcription of NUPR1, which in turn increases the expression of snail family transcriptional repressor 2 (SNAI2), a key driver of EMT. Clinically, elevated NR3C1 positively correlates with NUPR1 expression in OT patients, and both are positively associated with poorer prognosis. Overall, our study identified the NR3C1/NUPR1 axis as a critical regulatory pathway in psychological stress-induced OT metastasis, suggesting a potential therapeutic target for intervention in OT metastasis.