ObjectiveTo explore the effect of oral sodium butyrate on skeletal muscle atrophy in CT26 tumor mice through the gut microbiota-skeletal muscle axis and its potential mechanism. MethodsSixty SPF BALB/c male mice aged 8 weeks were randomly divided into a normal control group (NC, n=18) and a ABX-depleted group (ABX, n=42). The ABX mice were pretreated with a quadruple antibiotic cocktail via oral gavage (0.2 ml per administration, once daily, 6 d per week, for 2 weeks), whereas NC received an equal volume of sterile water. The quadruple antibiotic cocktail consisted of metronidazole (1 g/L), vancomycin (0.5 g/L), ampicillin (1 g/L), and gentamicin (1 g/L). Following successful pretreatment, six mice from each group were randomly selected for gut microbiota sequencing analysis and designated as the Abx group and the NC0 group, respectively. Theremaining mice in ABX were subcutaneously inoculated in the dorsum with 0.2 ml of CT26 cell suspension (at a cell density of 1×10⁷/ml). Then these mice were randomly allocated into three subgroups: a control tumor bearing model group (0_NaB, n=12), a tumor-bearing model group receiving low-dose oral sodium butyrate (L_NaB, n=12), a tumor-bearing model group receiving high-dose oral sodium butyrate (H_NaB, n=12). And mice in NC were inoculated at the same site with 0.2 ml of normal saline. The administration dose for L_NaB was 0.3 g/(kg·d), that for H_NaB was 0.5 g/(kg·d), while NC and 0_NaB were given the same volume of normal saline (0.2ml per time, once daily, 6 d per week, for 4 weeks). The general condition of mice was monitored, and forelimb grip strength gastrocnemius muscle mass and its muscle fiber cross-sectional area were measured for each group. The structural changes in gut microbiota were assessed by 16S rRNA sequencing of cecal contents. Pathological alterations in the intestinal wall were examined via HE staining. Serum and gastrocnemius muscle levels of TNF‑α, IL-6, IL-1β, and LPS were quantified using ELISA. The protein expression of ZO-1 and occludin in the small intestine, as well as proteins associated with the TLR4/MyD88/NF-κB signaling pathway in the gastrocnemius muscle, were detected by Western blot analysis. Results(1) The alpha-diversity in Abx was significantly lower than that in NC0 (P<0.01), a significant decrease of the mass and muscle fiber cross-sectional area of the gastrocnemius (P<0.01), with the majority of gut microbiota being effectively depleted. (2) Compared with NC, the subcutaneous tumors of mice in 0_NaB were prominent, a significant increase of the mass and muscle fiber cross-sectional area of the gastrocnemius, accompanied by a significant decrease in body weight at the end of the 3th and 4th week (P<0.05), and a significant weakening of the forelimb grasping strength at the 5th and 6th week (P<0.01). Compared with 0_NaB, the tumor mass of mice in L_NaB and H_NaB showed a significant decreasing trend, and the grip strength of the forelimbs significantly increased at the 5th and 6th week (P<0.05, P<0.01). (3) Compared with 0_NaB, the Shannon and Observed species indices in α diversity of L_NaB and H_NaB were significantly increased (P<0.05). At the genus level, compared with 0_NaB, L_NaB exhibited a significant decrease in the relative abundance of Parasutterella (P< 0.01), while H_NaB showed significant reductions in the relative abundances of both Escherichia-Shigella and Parasutterella (P < 0.01). (4) Compared with 0_NaB, the small intestinal tissue structure in L_NaB and H_NaB was more intact, the infiltration of inflammatory cells was significantly reduced, and the capillaries were slightly dilated. The expression levels of ZO-1 and occludin proteins in L_NaB were significantly increased (P<0.01). (5) The LPS concentration in the gastrocnemius muscle and the protein expression levels of TLR4, MyD88, p-IκBα, and p-NF‑κB p65 in L_NaB and H_NaB were significantly lower than those in 0_NaB (P<0.05). The serum TNF‑α concentration in H_NaB and TNF-α concentration in the gastrocnemius muscle of the L_NaB and H_NaB were significantly lower than those in 0_NaB (P<0.05, P<0.01, P<0.01). ConclusionOral administration of NaB can improve gut microbiota α diversity, adjusting its composition, improving intestinal mucosal barrier function, reducing the LPS-induced pro-inflammatory response, and delaying skeletal muscle atrophy. The underlying mechanism may involve down regulation of TLR4/MyD88/NF-κB signaling in skeletal muscle.

According to traditional Chinese medicine （TCM） theory， impaired spleen transportation function disrupts nutrient distribution， causing metabolic accumulation of lipids that transform into pathogenic phlegm-dampness. These pathological factors disseminate through the San Jiao and obstruct meridian pathways， ultimately forming the pathogenesis described as "all disorders involve phlegm". Phlegm and dampness share common pathogenic origins but manifest distinct clinical manifestations. Dampness， as the precursor， may congeal into phlegm， while existing phlegm accumulation can further exacerbate dampness stagnation， thereby establishing a self-perpetuating pathological cycle. Modern medical research has confirmed that the essence of "phlegm-dampness" syndrome is closely associated with energy metabolism disorders， serving as a common pathological basis for metabolic syndrome， type 2 diabetes mellitus， atherosclerosis， and other major chronic diseases. As a crucial vehicle for medical experimental research， disease-syndrome combination animal models serve as an indispensable means to advance the modernization of TCM. Currently， based on classical theories such as "rich and greasy foods produce phlegm" and "physical coldness combined with cold consumption causes external pathogens to invade the skin and hair， thereby generating internal dampness"， researchers primarily employ two paradigms to construct animal models of phlegm-turbidity， dampness obstruction， and phlegm-dampness syndromes： the first involves simulating TCM etiological factors （through methods like dietary irregularities， imblanace between work and rest， and combined internal-external dampness exposure）， while the second combines disease with syndrome differentiation （inducing pathological changes through physical， chemical， or biological interventions）. Through comprehensive evaluation incorporating macroscopic observation and microscopic index detection， model animals undergo systematic biological and pathological assessment， with further syndrome type verification achieved via the "prescription-based syndrome detection" approach. However， existing models still exhibit significant deficiencies in both the standardization of modeling methodologies and the systematization of evaluation criteria. This paper reviews the strategies for constructing "phlegm-dampness" syndrome animal models and their corresponding evaluation indices， focusing on the pathological correlations among different modeling approaches. The aim is to provide methodological guidance for research on TCM syndromes related to "phlegm-dampness" syndrome and to support the development of TCM therapies for resolving phlegm and eliminating dampness. This study not only contributes to advancing the standardization of TCM syndrome research but also provides crucial technical support for the modernization of TCM.

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

Objective:To investigate the efficacy of two types of micro-focused ultrasound devices combined with botulinum toxin type A (BoNT-A) injection for facial rejuvenation.Methods:A retrospective study was conducted, including 60 female patients aged 28-70 (41.3±7.9) years, who received facial rejuvenation treatment at the Department of Plastic and Reconstructive Surgery, Zhongnan Hospital of Wuhan University, from April 2023 to April 2024. Patients were divided into two groups based on the treatment method: the control group (received only micro-focused ultrasound treatment, n=30) and the combined group (received both micro-focused ultrasound and BoNT-A injection, n=30). Additionally, patients were further categorized into four subgroups based on the type of micro-focused ultrasound device used: Peninsula Microultra? (PM) device group ( n=15), Intelligent Ultrasound? (IU) device group ( n=15), PM device + BoNT-A injection group ( n=15), and IU device + BoNT-A injection group ( n=15). The severity of facial wrinkles was assessed using the wrinkle severity rating scale (WSRS), the Merz aesthetic scale (MAS), and the global aesthetic improvement scale (GAIS) at baseline and 6 months post-treatment. Adverse event rates were also recorded. Results:At 6 months post-treatment, the combined group showed significantly lower WSRS and MAS scores than the control group (both P<0.001). No significant differences were found between the PM and IU device groups, or between the PM + BoNT-A and IU + BoNT-A groups regarding WSRS and MAS scores (all P>0.05). Self-reported GAIS improvement was 56.7% (17/30) for the control group and 80.0% (24/30) for the combined group, with the combined group showing superior results ( P=0.015). The physician-assessed GAIS improvement was 70.0% (21/30) for the control group and 96.7% (29/30) for the combined group, again with the combined group showing superior results ( P=0.007). No significant differences were found in self-reported or physician-assessed GAIS improvement between the PM and IU device groups, or between the PM + BoNT-A and IU + BoNT-A groups (all P>0.05). No severe adverse reactions, such as blisters, scabbing, purpura, bruising, scarring, peripheral facial paralysis, allergies, muscle weakness, dysphagia, or dysphonia, were observed in any patient. Conclusion:The combination of micro-focused ultrasound and BoNT-A injection for facial rejuvenation is more effective than micro-focused ultrasound alone, while there are no significant differences in efficacy between the two micro-focused ultrasound devices.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

This study explores whether the current external quality assessment (EQA) level and acceptable bias for basic semen analysis in China are clinically useful. We collected data of semen EQA from Andrology laboratories in the Hunan Province (China) in 2022 and searched for data in the published literature from January 2000 to December 2023 in China. On the basis of these data, we analyzed the coefficients of variation and acceptable biases of different quality control materials for basic semen analysis through robust statistics. We compared these findings with quality specifications based on biological variation from optimal, desirable, and minimum levels of bias to seek a unified and more suitable semen EQA bias evaluation standard for China's national conditions. Different sources of semen quality control material exhibited considerable variation in acceptable biases among laboratories, ranging from 8.2% to 56.9%. A total of 50.0% of the laboratories met the minimum quality specifications for progressive motility (PR), whereas 100.0% and 75.0% of laboratories met only the minimum quality specifications for sperm concentration and total motility (nonprogressive [NP] + PR), respectively. The Z value for sperm concentration and PR+NP was equivalent to the desirable performance specification, whereas the Z value for PR was equivalent only to the minimum performance specification. This study highlights the feasibility of operating external quality assessment schemes for basic semen analysis using quality specifications based on biological variation. These specifications should be unified among external quality control (EQC) centers based on biological variation.
Semen Analysis/standards* ; Humans ; China ; Male ; Quality Control ; Sperm Motility ; Sperm Count/standards*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test