ObjectiveTo investigate the impact of portal vein tumor thrombus （PVTT） classification on rebleeding in hepatocellular carcinoma （HCC） patients with different PVTT subtypes and esophagogastric variceal bleeding （EGVB）， and to provide a reference for formulating rational treatment regimens for such patients. MethodsA retrospective study was performed for 130 patients with HCC and PVTT who were treated due to EGVB in Beijing Ditan Hospital， Capital Medical University， from July 2020 to January 2025， and according to whether endoscopic treatment was performed， the patients were divided into endoscopic treatment group with 97 patients and conservative treatment group with 33 patients. Demographic and clinical data were collected from all patients， and the two groups were compared in terms of hemostasis success rate and rebleeding rate. The independent-samples t test was used for comparison of normally distributed continuous data between groups， and the Mann-Whitney U test was used for comparison of non-normally distributed continuous data between groups； the chi-square test or the Fisher’s exact test was used for comparison of categorical data between groups. The Kaplan-Meier method was used to estimate the cumulative incidence rate of rebleeding in patients with different subtypes of PVTT. Propensity score matching （PSM） was performed for the endoscopic treatment group and the conservative treatment group to balance the baseline data of the two groups. The Cox proportional hazards model was used to perform univariate and multivariate analyses and identify independent risk factors for rebleeding. ResultsThe endoscopic treatment group had a significantly lower cumulative rebleeding rate within 6 months than the conservative treatment group （35.1% vs 57.6%， hazard ratio ［HR］=0.480， 95% confidence interval ［CI］： 0.272—0.851， P=0.019）. The PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate within 6 months than the PVTT Ⅱ group （52.2% vs 37.5%， HR=1.744， 95%CI： 1.008 — 3.018， P=0.022）. After PSM， there was no significant difference in rebleeding rate between the endoscopic treatment group and the conservative treatment group （38.1% vs 14.3%，HR=1.500，95%CI：0.125 — 2.002， P=0.588）， while the PVTT Ⅲ—Ⅳ group had a significantly higher cumulative rebleeding rate than the PVTT Ⅱ group （58.8% vs 12.5%，HR=1.561，95%CI：1.195 — 12.499，P=0.033）. The multivariate Cox regression analysis showed that PVTT subtype （HR=1.412， 95%CI： 0.998 — 1.997， P=0.049）， platelet count （HR=1.006， 95%CI： 1.001 — 1.010， P=0.021）， C-reactive protein （HR=1.011， 95%CI： 1.001 — 1.021， P=0.026）， and ascites （HR=1.803， 95%CI： 1.059 — 3.068， P=0.030） were independent risk factors for rebleeding. ConclusionFor HCC patients with PVTT and EGVB， endoscopic treatment can successfully achieve hemostasis， while it fails to significantly reduce rebleeding rates. PVTT classification can affect the risk of rebleeding， and patients with PVTT types Ⅲ—Ⅳ have a relatively high rebleeding rate.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Cancer is characterized by abnormal cell proliferation. Cyclins and cyclin-dependent kinases (CDKs) have been recognized as essential regulators of the intricate cell cycle, orchestrating DNA replication and transcription, RNA splicing, and protein synthesis. Dysregulation of the CDK pathway is prevalent in the development and progression of human cancers, rendering cyclins and CDKs attractive therapeutic targets. Several CDK4/6 inhibitors have demonstrated promising anti-cancer efficacy and have been successfully translated into clinical use, fueling the development of CDK-targeted therapies. With this enthusiasm for finding novel CDK-targeting anti-cancer agents, there have also been exciting advances in the field of targeted protein degradation through innovative strategies, such as using proteolysis-targeting chimera, heat shock protein 90 (HSP90)‍-mediated targeting chimera, hydrophobic tag-based protein degradation, and molecular glue. With a focus on the translational potential of cyclin- and CDK-targeting strategies in cancer, this review presents the fundamental roles of cyclins and CDKs in cancer. Furthermore, it summarizes current strategies for the proteasome-dependent targeted degradation of cyclins and CDKs, detailing the underlying mechanisms of action for each approach. A comprehensive overview of the structure and activity of existing CDK degraders is also provided. By examining the structure‍‒‍activity relationships, target profiles, and biological effects of reported cyclin/CDK degraders, this review provides a valuable reference for both CDK pathway-targeted biomedical research and cancer therapeutics.
Humans ; Neoplasms/metabolism* ; Cyclin-Dependent Kinases/antagonists & inhibitors* ; Cyclins/metabolism* ; Proteolysis ; Antineoplastic Agents/pharmacology* ; Molecular Targeted Therapy ; Proteasome Endopeptidase Complex/metabolism* ; Animals

Objective:To explore the genetic and clinical characteristics of Guizhou patients with enlarged vestibular aqueduct（EVA） syndrome through combined SLC26A4 variant analysis and clinical phenotype analysis. Methods:Seventy-two EVA patients underwent comprehensive genetic testing using a multiplex PCR-based deafness gene panel and next-generation sequencing（NGS）. The audiological and temporal bone imaging characteristics were compared across mutation subtypes. Results:A total of 27 pathogenic loci of SLC26A4 were detected in 72 patients, including c.919-2A>G in 79.2%（57/72）. A novel deletion（c.1703_1707+6del） was discovered. Among 65 cases, truncated mutations were 89.2%（58/65）, 52.3%（34/65）, 28（43.1%） and 7（10.8%）. No significant differences were observed in the midpoint diameter of the vestibular aqueduct and the incidence of incomplete partitioning typeⅡ（IP-Ⅱ） of the cochlea among the three groups of patients. Moreover, there was no difference in the midpoint diameter of different vestibular pipes or the combination with IP-Ⅱ. Conclusion:The most common mutation site of SLC26A4 in EVA patients in Guizhou is c.919-2A>G, though genotype-phenotype correlations remain elusive. The detection of 27 mutation sites and the discovery of new mutation sites suggested the precise diagnostic significance of NGS technology in EVA patients in Guizhou.
Humans ; Sulfate Transporters ; Vestibular Aqueduct/abnormalities* ; Mutation ; Membrane Transport Proteins/genetics* ; Hearing Loss, Sensorineural/genetics* ; Male ; Female ; Child ; Adolescent ; Child, Preschool ; Adult ; Young Adult ; Phenotype ; High-Throughput Nucleotide Sequencing

Alzheimer's disease (AD) is the major form of dementia in the elderly and is closely related to the toxic effects of microglia sustained activation. In AD, sustained microglial activation triggers impaired synaptic pruning, neuroinflammation, neurotoxicity, and cognitive deficits. Accumulating evidence has demonstrated that aberrant expression of deubiquitinating enzymes is associated with regulating microglia function. Here, we use RNA sequencing to identify a deubiquitinase YOD1 as a regulator of microglial function and AD pathology. Further study showed that YOD1 knockout significantly improved the migration, phagocytosis, and inflammatory response of microglia, thereby improving the cognitive impairment of AD model mice. Through LC-MS/MS analysis combined with Co-IP, we found that Myosin heavy chain 9 (MYH9), a key regulator maintaining microglia homeostasis, is an interacting protein of YOD1. Mechanistically, YOD1 binds to MYH9 and maintains its stability by removing the K48 ubiquitin chain from MYH9, thereby mediating the microglia polarization signaling pathway to mediate microglia homeostasis. Taken together, our study reveals a specific role of microglial YOD1 in mediating microglia homeostasis and AD pathology, which provides a potential strategy for targeting microglia to treat AD.

Ischemic stroke is a disease resulting from the cerebral ischemia and hypoxia caused by the blockage of brain vessels in the brain,and is characterized by the focal neurological signs.Pathologically,neuronal necrosis in the infarcted area and the neuronal degeneration or delayed death of neurons in the ischemic penumbra,contribute to the morphological basis of the disease.Ischemic stroke is regulated by multiple processes,including ferroptosis,apoptosis,and autophagy.Ferroptosis,a type of iron-dependent cell death,is closely associated with ischemic stroke.Nuclear factor erythroid 2-related factor 2(Nrf2),a key transcription factor,plays a critical role in maintaining cellular redox balance and regulating inflammatory responses.Nrf2 promotes the expression of solute carrier family 7 member 11(SLC7A11)and glutathione peroxidase 4(GPX4),thereby activating the Nrf2 signaling pathway to counteract ferroptosis and protect cells from damage.This article reviews and analyzes recent experimental studies on traditional Chinese medicine(TCM)therapy targeting the Nrf2/SLC7A11/GPX4 pathway to suppress ferroptosis.The studies have found that TCM therapy with herbal compounds,Chinese patent medicines,single herbal components and their active ingredients,and acupuncture and moxibustion can inhibit ferroptosis by activating the Nrf2/SLC7A11/GPX4 signaling pathway,which will provide novel strategies for the TCM intervention of ischemic stroke.

Gastric cancer with peritoneal metastasis (GCPM) is a common and lethal manifestation of advanced gastric cancer, with a median survival of only 5-11 months. This consensus was developed by 30 experts from Asia (China, Japan, Korea, and Singapore) using the Delphi method and the GRADE evidence grading system. A total of 29 statements were formulated, covering the diagnosis and assessment of GCPM, indications for laparoscopic exploration and NIPS (normothermic intraperitoneal and systemic treatment), treatment regimens, prevention and management of complications, criteria for conversion surgery, and postoperative intraperitoneal therapy. The consensus aims to standardize clinical practice and improve the prognosis of patients with GCPM.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*