Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Cancer is characterized by abnormal cell proliferation. Cyclins and cyclin-dependent kinases (CDKs) have been recognized as essential regulators of the intricate cell cycle, orchestrating DNA replication and transcription, RNA splicing, and protein synthesis. Dysregulation of the CDK pathway is prevalent in the development and progression of human cancers, rendering cyclins and CDKs attractive therapeutic targets. Several CDK4/6 inhibitors have demonstrated promising anti-cancer efficacy and have been successfully translated into clinical use, fueling the development of CDK-targeted therapies. With this enthusiasm for finding novel CDK-targeting anti-cancer agents, there have also been exciting advances in the field of targeted protein degradation through innovative strategies, such as using proteolysis-targeting chimera, heat shock protein 90 (HSP90)‍-mediated targeting chimera, hydrophobic tag-based protein degradation, and molecular glue. With a focus on the translational potential of cyclin- and CDK-targeting strategies in cancer, this review presents the fundamental roles of cyclins and CDKs in cancer. Furthermore, it summarizes current strategies for the proteasome-dependent targeted degradation of cyclins and CDKs, detailing the underlying mechanisms of action for each approach. A comprehensive overview of the structure and activity of existing CDK degraders is also provided. By examining the structure‍‒‍activity relationships, target profiles, and biological effects of reported cyclin/CDK degraders, this review provides a valuable reference for both CDK pathway-targeted biomedical research and cancer therapeutics.
Humans ; Neoplasms/metabolism* ; Cyclin-Dependent Kinases/antagonists & inhibitors* ; Cyclins/metabolism* ; Proteolysis ; Antineoplastic Agents/pharmacology* ; Molecular Targeted Therapy ; Proteasome Endopeptidase Complex/metabolism* ; Animals

Objective:To explore the genetic and clinical characteristics of Guizhou patients with enlarged vestibular aqueduct（EVA） syndrome through combined SLC26A4 variant analysis and clinical phenotype analysis. Methods:Seventy-two EVA patients underwent comprehensive genetic testing using a multiplex PCR-based deafness gene panel and next-generation sequencing（NGS）. The audiological and temporal bone imaging characteristics were compared across mutation subtypes. Results:A total of 27 pathogenic loci of SLC26A4 were detected in 72 patients, including c.919-2A>G in 79.2%（57/72）. A novel deletion（c.1703_1707+6del） was discovered. Among 65 cases, truncated mutations were 89.2%（58/65）, 52.3%（34/65）, 28（43.1%） and 7（10.8%）. No significant differences were observed in the midpoint diameter of the vestibular aqueduct and the incidence of incomplete partitioning typeⅡ（IP-Ⅱ） of the cochlea among the three groups of patients. Moreover, there was no difference in the midpoint diameter of different vestibular pipes or the combination with IP-Ⅱ. Conclusion:The most common mutation site of SLC26A4 in EVA patients in Guizhou is c.919-2A>G, though genotype-phenotype correlations remain elusive. The detection of 27 mutation sites and the discovery of new mutation sites suggested the precise diagnostic significance of NGS technology in EVA patients in Guizhou.
Humans ; Sulfate Transporters ; Vestibular Aqueduct/abnormalities* ; Mutation ; Membrane Transport Proteins/genetics* ; Hearing Loss, Sensorineural/genetics* ; Male ; Female ; Child ; Adolescent ; Child, Preschool ; Adult ; Young Adult ; Phenotype ; High-Throughput Nucleotide Sequencing

Alzheimer's disease (AD) is the major form of dementia in the elderly and is closely related to the toxic effects of microglia sustained activation. In AD, sustained microglial activation triggers impaired synaptic pruning, neuroinflammation, neurotoxicity, and cognitive deficits. Accumulating evidence has demonstrated that aberrant expression of deubiquitinating enzymes is associated with regulating microglia function. Here, we use RNA sequencing to identify a deubiquitinase YOD1 as a regulator of microglial function and AD pathology. Further study showed that YOD1 knockout significantly improved the migration, phagocytosis, and inflammatory response of microglia, thereby improving the cognitive impairment of AD model mice. Through LC-MS/MS analysis combined with Co-IP, we found that Myosin heavy chain 9 (MYH9), a key regulator maintaining microglia homeostasis, is an interacting protein of YOD1. Mechanistically, YOD1 binds to MYH9 and maintains its stability by removing the K48 ubiquitin chain from MYH9, thereby mediating the microglia polarization signaling pathway to mediate microglia homeostasis. Taken together, our study reveals a specific role of microglial YOD1 in mediating microglia homeostasis and AD pathology, which provides a potential strategy for targeting microglia to treat AD.

Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans ; Dental Cementum/injuries* ; Consensus ; Diagnosis, Differential ; Cone-Beam Computed Tomography ; Tooth Fractures/therapy*

Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans ; Stomach Neoplasms/diagnostic imaging* ; Contrast Media ; Ultrasonography/methods*

Refined operational management is crucial to enhance hospital operational efficiency and achieve sustainable and high-quality development.A large tertiary comprehensive hospital,selected as an observation subject in this study,has har-nessed the value inherent in its extensive operational data,thereby constructing a data-driven operational management framework.Through measures such as developing an operational management system,setting up an operational data hub,and optimizing re-source allocation based on data modeling,this hospital has conducted comprehensive operational analysis at the hospital,depart-ment,and project levels,established a performance management system grounded in data,and enhanced risk prevention and con-trol capabilities,investigating the refined operational management.These efforts have led to incremental improvements in hospital quality,continuous enhancements in operational efficiency,and significant increases in patient and employee satisfaction.

Ischemic stroke is a disease resulting from the cerebral ischemia and hypoxia caused by the blockage of brain vessels in the brain,and is characterized by the focal neurological signs.Pathologically,neuronal necrosis in the infarcted area and the neuronal degeneration or delayed death of neurons in the ischemic penumbra,contribute to the morphological basis of the disease.Ischemic stroke is regulated by multiple processes,including ferroptosis,apoptosis,and autophagy.Ferroptosis,a type of iron-dependent cell death,is closely associated with ischemic stroke.Nuclear factor erythroid 2-related factor 2(Nrf2),a key transcription factor,plays a critical role in maintaining cellular redox balance and regulating inflammatory responses.Nrf2 promotes the expression of solute carrier family 7 member 11(SLC7A11)and glutathione peroxidase 4(GPX4),thereby activating the Nrf2 signaling pathway to counteract ferroptosis and protect cells from damage.This article reviews and analyzes recent experimental studies on traditional Chinese medicine(TCM)therapy targeting the Nrf2/SLC7A11/GPX4 pathway to suppress ferroptosis.The studies have found that TCM therapy with herbal compounds,Chinese patent medicines,single herbal components and their active ingredients,and acupuncture and moxibustion can inhibit ferroptosis by activating the Nrf2/SLC7A11/GPX4 signaling pathway,which will provide novel strategies for the TCM intervention of ischemic stroke.

Objective:To investigate the efficacy of two types of micro-focused ultrasound devices combined with botulinum toxin type A (BoNT-A) injection for facial rejuvenation.Methods:A retrospective study was conducted, including 60 female patients aged 28-70 (41.3±7.9) years, who received facial rejuvenation treatment at the Department of Plastic and Reconstructive Surgery, Zhongnan Hospital of Wuhan University, from April 2023 to April 2024. Patients were divided into two groups based on the treatment method: the control group (received only micro-focused ultrasound treatment, n=30) and the combined group (received both micro-focused ultrasound and BoNT-A injection, n=30). Additionally, patients were further categorized into four subgroups based on the type of micro-focused ultrasound device used: Peninsula Microultra? (PM) device group ( n=15), Intelligent Ultrasound? (IU) device group ( n=15), PM device + BoNT-A injection group ( n=15), and IU device + BoNT-A injection group ( n=15). The severity of facial wrinkles was assessed using the wrinkle severity rating scale (WSRS), the Merz aesthetic scale (MAS), and the global aesthetic improvement scale (GAIS) at baseline and 6 months post-treatment. Adverse event rates were also recorded. Results:At 6 months post-treatment, the combined group showed significantly lower WSRS and MAS scores than the control group (both P<0.001). No significant differences were found between the PM and IU device groups, or between the PM + BoNT-A and IU + BoNT-A groups regarding WSRS and MAS scores (all P>0.05). Self-reported GAIS improvement was 56.7% (17/30) for the control group and 80.0% (24/30) for the combined group, with the combined group showing superior results ( P=0.015). The physician-assessed GAIS improvement was 70.0% (21/30) for the control group and 96.7% (29/30) for the combined group, again with the combined group showing superior results ( P=0.007). No significant differences were found in self-reported or physician-assessed GAIS improvement between the PM and IU device groups, or between the PM + BoNT-A and IU + BoNT-A groups (all P>0.05). No severe adverse reactions, such as blisters, scabbing, purpura, bruising, scarring, peripheral facial paralysis, allergies, muscle weakness, dysphagia, or dysphonia, were observed in any patient. Conclusion:The combination of micro-focused ultrasound and BoNT-A injection for facial rejuvenation is more effective than micro-focused ultrasound alone, while there are no significant differences in efficacy between the two micro-focused ultrasound devices.