1.Body fat distribution and semen quality in 4304 Chinese sperm donors.
Si-Han LIANG ; Qi-Ling WANG ; Dan LI ; Gui-Fang YE ; Ying-Xin LI ; Wei ZHOU ; Rui-Jun XU ; Xin-Yi DENG ; Lu LUO ; Si-Rong WANG ; Xin-Zong ZHANG ; Yue-Wei LIU
Asian Journal of Andrology 2025;27(4):524-530
Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans
;
Male
;
Adult
;
Semen Analysis
;
China
;
Body Fat Distribution
;
Longitudinal Studies
;
Sperm Count
;
Sperm Motility
;
Body Mass Index
;
Tissue Donors
;
Obesity/complications*
;
Spermatozoa
;
Young Adult
;
Middle Aged
;
East Asian People
2.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
3.Clinical Characteristics and Prognosis Analysis of Patients with Extranasal NK/T-Cell Lymphoma: A Multicenter Retrospective Study of Huaihai Lymphoma Working Group.
Hui-Rong SHAN ; Qing ZHANG ; Ling WANG ; Yu-Ye SHI ; Yu-Qing MIAO ; Tai-Gang ZHU ; Jing-Jing YE ; Xu-Dong ZHANG ; Liang WANG ; Zi-Yuan SHEN ; Wei SANG
Journal of Experimental Hematology 2025;33(1):93-100
OBJECTIVE:
To explore the clinical characteristics and prognostic factors of patients with extranasal NK/T-cell lymphoma (NKTCL).
METHODS:
The clinical data of 138 patients with NKTCL diagnosed in 10 medical centers of Huaihai Lymphoma Working Group from June 2015 to April 2021 were collected and analyzed retrospectively. The differences in clinicopathological characteristics of patients with different involvement and efficacy of pegaspargase regimen were compared, as well as perform survival analysis.
RESULTS:
A total of 138 extranasal NKTCL patients were included, with a median age of 46 years, and the ratio of males to females was approximately 2∶1. There were 39 patients with gastrointestinal involvement, 32 patients with oropharyngeal involvement, 17 patients with skin involvement, 11 patients with lymph node involvement, 11 patients with orbital involvement, and 28 patients with other parts involvement. Patients with skin involvement had a higher proportion of advanced disease and a lower proportion of CD56 positive rate compared to those with oropharyngeal involvement. Among the patients with gastrointestinal involvement, the survival rate of patients who received pegaspargase regimen was significantly higher than those who were treated without pegaspargase (P < 0.01). Multivariate analysis showed that serum creatinine was an independent prognostic factor for patients with skin involvement ( HR =1.027, 95%CI : 1.001-1.054, P =0.040), ECOG PS and EBV DNA were independent prognostic factors for patients with gastrointestinal involvement ( HR =2.635, 95%CI : 1.096-6.338, P =0.030; HR =4.772, 95% CI : 1.092-20.854, P =0.038), and ECOG PS and CA stage were independent prognostic factors for patients with oropharyngeal involvement ( HR =13.875, 95%CI : 2.517-76.496, P =0.002; HR =20.261, 95%CI : 2.466-166.470, P =0.005).
CONCLUSION
The clinicopathological characteristics of extranasal NKTCL patients with different sites of involvement are vary, and effective individualized treatment need to be further explored.
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Asparaginase/therapeutic use*
;
Lymphoma, Extranodal NK-T-Cell/pathology*
;
Prognosis
;
Retrospective Studies
;
Survival Rate
;
Polyethylene Glycols
4.Early screening and diagnosis of prostate cancer based on the innovative care for chronic conditions framework.
Han-Jing ZHU ; Liang DONG ; Bin ZHAO ; Feng ZHANG ; Rong LI ; Cheng-Ye ZHU ; Jia MAO ; Zhen-Ying YANG ; Yin-Jie ZHU ; Wei XUE
National Journal of Andrology 2025;31(3):229-233
OBJECTIVE:
To construct an integrated management model for early screening and diagnosis of PCa based on the Innovative Care for Chronic Conditions Framework (ICCC) and the 1+1 contract-based tiered diagnosis and treatment system (TDTS) in China.
METHODS:
Based on the 1+1 contract-based TDTS platform, we conducted PCa screening for the male residents aged 60 years and above during health check-ups in Pujin Community Health Center from January 1, 2023 to December 31, 2023. For those with abnormal total prostate-specific antigen (tPSA) ≥ 4 μg/L, we promptly referred them to higher-level hospitals for further diagnosis and treatment via the two-way referral green channel platform and information sharing service using the 1+1 contract model. We further analyzed the relevant data on screening and diagnosis.
RESULTS:
A total of 4 080 males aged 71.39±5.059 years received PCa screening from January to December 2023. PSA screening was performed in 43.96% of the male residents, revealing 654 cases of PSA abnormality, with a PSA positivity rate of 16.03%, which was higher than that found in the previous large-scale PCa screenings in other regions of China. Among the males with PSA abnormality, 292 (44.65%) expressed their willingness for medical referral, while the others did not seek further medical attention for reasons of being asymptomatic, low awareness of the disease, no accompany for medical visits, and concerns about further costs of diagnosis and treatment. Prostate biopsy was recommended to 154 cases after further examinations, which was accepted by 92 (59.74%). Fifty-eight cases were diagnosed with Pa, and thedetection rate reached 63.04%.
CONCLUSION
The integrated management model for PSA examination-based early screening and diagnosis of PCa using the 1+1 contract-based TDTS platform is plays a significant role in enhancing people's awareness and knowledge of PCa and improving the early detection rate of the malignancy.
Humans
;
Male
;
Prostatic Neoplasms/diagnosis*
;
Early Detection of Cancer
;
Prostate-Specific Antigen/blood*
;
Aged
;
China
;
Mass Screening
;
Middle Aged
;
Chronic Disease
5.Exploiting targeted degradation of cyclins and cyclin-dependent kinases for cancer therapeutics: a review.
Suya ZHENG ; Ye CHEN ; Zhipeng ZHU ; Nan LI ; Chunyu HE ; H Phillip KOEFFLER ; Xin HAN ; Qichun WEI ; Liang XU
Journal of Zhejiang University. Science. B 2025;26(8):713-739
Cancer is characterized by abnormal cell proliferation. Cyclins and cyclin-dependent kinases (CDKs) have been recognized as essential regulators of the intricate cell cycle, orchestrating DNA replication and transcription, RNA splicing, and protein synthesis. Dysregulation of the CDK pathway is prevalent in the development and progression of human cancers, rendering cyclins and CDKs attractive therapeutic targets. Several CDK4/6 inhibitors have demonstrated promising anti-cancer efficacy and have been successfully translated into clinical use, fueling the development of CDK-targeted therapies. With this enthusiasm for finding novel CDK-targeting anti-cancer agents, there have also been exciting advances in the field of targeted protein degradation through innovative strategies, such as using proteolysis-targeting chimera, heat shock protein 90 (HSP90)-mediated targeting chimera, hydrophobic tag-based protein degradation, and molecular glue. With a focus on the translational potential of cyclin- and CDK-targeting strategies in cancer, this review presents the fundamental roles of cyclins and CDKs in cancer. Furthermore, it summarizes current strategies for the proteasome-dependent targeted degradation of cyclins and CDKs, detailing the underlying mechanisms of action for each approach. A comprehensive overview of the structure and activity of existing CDK degraders is also provided. By examining the structure‒activity relationships, target profiles, and biological effects of reported cyclin/CDK degraders, this review provides a valuable reference for both CDK pathway-targeted biomedical research and cancer therapeutics.
Humans
;
Neoplasms/metabolism*
;
Cyclin-Dependent Kinases/antagonists & inhibitors*
;
Cyclins/metabolism*
;
Proteolysis
;
Antineoplastic Agents/pharmacology*
;
Molecular Targeted Therapy
;
Proteasome Endopeptidase Complex/metabolism*
;
Animals
6.Analysis and clinical characteristics of SLC26A4 gene mutations in 72 cases of large vestibular aqueduct syndrome.
Yuqing LIU ; Wenyu XIONG ; Yu LU ; Lisong LIANG ; Kejie YANG ; Li LAN ; Wei HAN ; Qing YE ; Min WANG ; Yuan ZHANG ; Fangying TAO ; Zuwei CAO ; Wei HUANG ; Xue YANG
Journal of Clinical Otorhinolaryngology Head and Neck Surgery 2025;39(7):603-609
Objective:To explore the genetic and clinical characteristics of Guizhou patients with enlarged vestibular aqueduct(EVA) syndrome through combined SLC26A4 variant analysis and clinical phenotype analysis. Methods:Seventy-two EVA patients underwent comprehensive genetic testing using a multiplex PCR-based deafness gene panel and next-generation sequencing(NGS). The audiological and temporal bone imaging characteristics were compared across mutation subtypes. Results:A total of 27 pathogenic loci of SLC26A4 were detected in 72 patients, including c.919-2A>G in 79.2%(57/72). A novel deletion(c.1703_1707+6del) was discovered. Among 65 cases, truncated mutations were 89.2%(58/65), 52.3%(34/65), 28(43.1%) and 7(10.8%). No significant differences were observed in the midpoint diameter of the vestibular aqueduct and the incidence of incomplete partitioning typeⅡ(IP-Ⅱ) of the cochlea among the three groups of patients. Moreover, there was no difference in the midpoint diameter of different vestibular pipes or the combination with IP-Ⅱ. Conclusion:The most common mutation site of SLC26A4 in EVA patients in Guizhou is c.919-2A>G, though genotype-phenotype correlations remain elusive. The detection of 27 mutation sites and the discovery of new mutation sites suggested the precise diagnostic significance of NGS technology in EVA patients in Guizhou.
Humans
;
Sulfate Transporters
;
Vestibular Aqueduct/abnormalities*
;
Mutation
;
Membrane Transport Proteins/genetics*
;
Hearing Loss, Sensorineural/genetics*
;
Male
;
Female
;
Child
;
Adolescent
;
Child, Preschool
;
Adult
;
Young Adult
;
Phenotype
;
High-Throughput Nucleotide Sequencing
7.YOD1 regulates microglial homeostasis by deubiquitinating MYH9 to promote the pathogenesis of Alzheimer's disease.
Jinfeng SUN ; Fan CHEN ; Lingyu SHE ; Yuqing ZENG ; Hao TANG ; Bozhi YE ; Wenhua ZHENG ; Li XIONG ; Liwei LI ; Luyao LI ; Qin YU ; Linjie CHEN ; Wei WANG ; Guang LIANG ; Xia ZHAO
Acta Pharmaceutica Sinica B 2025;15(1):331-348
Alzheimer's disease (AD) is the major form of dementia in the elderly and is closely related to the toxic effects of microglia sustained activation. In AD, sustained microglial activation triggers impaired synaptic pruning, neuroinflammation, neurotoxicity, and cognitive deficits. Accumulating evidence has demonstrated that aberrant expression of deubiquitinating enzymes is associated with regulating microglia function. Here, we use RNA sequencing to identify a deubiquitinase YOD1 as a regulator of microglial function and AD pathology. Further study showed that YOD1 knockout significantly improved the migration, phagocytosis, and inflammatory response of microglia, thereby improving the cognitive impairment of AD model mice. Through LC-MS/MS analysis combined with Co-IP, we found that Myosin heavy chain 9 (MYH9), a key regulator maintaining microglia homeostasis, is an interacting protein of YOD1. Mechanistically, YOD1 binds to MYH9 and maintains its stability by removing the K48 ubiquitin chain from MYH9, thereby mediating the microglia polarization signaling pathway to mediate microglia homeostasis. Taken together, our study reveals a specific role of microglial YOD1 in mediating microglia homeostasis and AD pathology, which provides a potential strategy for targeting microglia to treat AD.
8.Expert consensus on the diagnosis and treatment of cemental tear.
Ye LIANG ; Hongrui LIU ; Chengjia XIE ; Yang YU ; Jinlong SHAO ; Chunxu LV ; Wenyan KANG ; Fuhua YAN ; Yaping PAN ; Faming CHEN ; Yan XU ; Zuomin WANG ; Yao SUN ; Ang LI ; Lili CHEN ; Qingxian LUAN ; Chuanjiang ZHAO ; Zhengguo CAO ; Yi LIU ; Jiang SUN ; Zhongchen SONG ; Lei ZHAO ; Li LIN ; Peihui DING ; Weilian SUN ; Jun WANG ; Jiang LIN ; Guangxun ZHU ; Qi ZHANG ; Lijun LUO ; Jiayin DENG ; Yihuai PAN ; Jin ZHAO ; Aimei SONG ; Hongmei GUO ; Jin ZHANG ; Pingping CUI ; Song GE ; Rui ZHANG ; Xiuyun REN ; Shengbin HUANG ; Xi WEI ; Lihong QIU ; Jing DENG ; Keqing PAN ; Dandan MA ; Hongyu ZHAO ; Dong CHEN ; Liangjun ZHONG ; Gang DING ; Wu CHEN ; Quanchen XU ; Xiaoyu SUN ; Lingqian DU ; Ling LI ; Yijia WANG ; Xiaoyuan LI ; Qiang CHEN ; Hui WANG ; Zheng ZHANG ; Mengmeng LIU ; Chengfei ZHANG ; Xuedong ZHOU ; Shaohua GE
International Journal of Oral Science 2025;17(1):61-61
Cemental tear is a rare and indetectable condition unless obvious clinical signs present with the involvement of surrounding periodontal and periapical tissues. Due to its clinical manifestations similar to common dental issues, such as vertical root fracture, primary endodontic diseases, and periodontal diseases, as well as the low awareness of cemental tear for clinicians, misdiagnosis often occurs. The critical principle for cemental tear treatment is to remove torn fragments, and overlooking fragments leads to futile therapy, which could deteriorate the conditions of the affected teeth. Therefore, accurate diagnosis and subsequent appropriate interventions are vital for managing cemental tear. Novel diagnostic tools, including cone-beam computed tomography (CBCT), microscopes, and enamel matrix derivatives, have improved early detection and management, enhancing tooth retention. The implementation of standardized diagnostic criteria and treatment protocols, combined with improved clinical awareness among dental professionals, serves to mitigate risks of diagnostic errors and suboptimal therapeutic interventions. This expert consensus reviewed the epidemiology, pathogenesis, potential predisposing factors, clinical manifestations, diagnosis, differential diagnosis, treatment, and prognosis of cemental tear, aiming to provide a clinical guideline and facilitate clinicians to have a better understanding of cemental tear.
Humans
;
Dental Cementum/injuries*
;
Consensus
;
Diagnosis, Differential
;
Cone-Beam Computed Tomography
;
Tooth Fractures/therapy*
9.Advances in Clinical Application of Gastric Contrast-Enhanced Ultrasound for Gastric Cancer.
Guan-Mo LIU ; Hua LIANG ; Yang GUI ; Jie LI ; Xin YE ; Wei-Ming KANG
Acta Academiae Medicinae Sinicae 2025;47(5):716-724
Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans
;
Stomach Neoplasms/diagnostic imaging*
;
Contrast Media
;
Ultrasonography/methods*
10.Asian consensus on normothermic intraperitoneal and systemic treatment for gastric cancer with peritoneal metastasis
Zhenggang ZHU ; Kitayama Joji ; Hyung-Ho Kim ; Jimmy Bok-Yan So ; Hui CAO ; Lin CHEN ; Xiangdong CHENG ; Jiankun HU ; Imano Motohiro ; Ishigami Hironori ; Ye Seob Jee ; Jong-Han Kim ; Yasuhiro Kodera ; Han LIANG ; Xiaowen LIU ; Sheng LU ; Yiping MOU ; Mingming NIE ; Won Jun Seo ; Yanong WANG ; Dan WU ; Zekuan XU ; Yamaguchi Hironori ; Chao YAN ; Zhongyin YANG ; Kai YIN ; Yonemura Yutaka ; Wei-Peng Yong ; Jiren YU ; Jun ZHANG ; Asian Gastric Cancer NIPS Treatment Collaborative Group ; Shanghai Anticancer Association, Committee of Peritoneal Tumor
Journal of Surgery Concepts & Practice 2025;30(4):277-294
Gastric cancer with peritoneal metastasis (GCPM) is a common and lethal manifestation of advanced gastric cancer, with a median survival of only 5-11 months. This consensus was developed by 30 experts from Asia (China, Japan, Korea, and Singapore) using the Delphi method and the GRADE evidence grading system. A total of 29 statements were formulated, covering the diagnosis and assessment of GCPM, indications for laparoscopic exploration and NIPS (normothermic intraperitoneal and systemic treatment), treatment regimens, prevention and management of complications, criteria for conversion surgery, and postoperative intraperitoneal therapy. The consensus aims to standardize clinical practice and improve the prognosis of patients with GCPM.

Result Analysis
Print
Save
E-mail