1.Ancient and Modern Application and Key Information Analysis of Classic Formula Erchentang
Qing TANG ; Lyuyuan LIANG ; Jialei CAO ; Lan LIU ; Hejia WAN ; Chengxin LUO ; Bingqi WEI ; Yamin KONG ; Bingxiang MA ; Wenli SHI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(1):262-270
Erchentang is a classic formula widely used by medical practitioners throughout history. In this paper,ancient and modern literature of Erchentang were collected, and bibliometrics was employed to analyze its historic evolution,prescription meaning,herbs origin, processing method,preparation methods, and clinical application. A total of 84 pieces of data were collected, and 58 pieces of data involving 53 ancient medical Chinese books were screened, sorted, and processed. Combined with research of modern scholars,the research has found that the Erchentang originated from the Taiping Huimin Huiye Shijie Fang compiled by the Imperial Medical Bureau of the Song Dynasty. The basic information about the origin of the drugs is quite clear. Pinelliae rhizoma in the formula is the dried tuber of Pinellia ternata. Citri exocarpium rubrum is the dried mature peel of Citrus reticulata and its cultivated varieties, with the inner white membrane removed. Poria is the whitest dry sclerotia of Poria cocos; Glycyrrhizae radix et rhizoma is the dried root and rhizome of the Glycyrrhiza uralensis. The dosage is 5.70 g Pinelliae rhizome and Citri exocarpium rubrum, 3.43 g Poria, and 1.69 g Glycyrrhizae radix et rhizoma praeparata cum melle. During the decoction process, the above-mentioned herbs should be chopped, with 300 mL water, 7 g ginger in thick slices, and 2 g Mume fructus added, and it was then simmered together to 180 mL. After removing the medicinal residue, it can be taken warmly. Erchentang has the effect of drying dampness and resolving phlegm, regulating Qi and harmonizing the middle. It can be used in treating the syndrome of phlegm and dampness,as well as symptoms such as frequent cough,white phlegm,fullness in chest and diaphragm,nausea and vomiting,limb drowsiness,anorexia,dizziness,palpitations,white and greasy tongue coating, and slippery pulse. The above results provide reference for future research and development of Erchentang.
2.Material Basis of Anti-Inflammatory Efficacy and Mechanism of Action of Bushen Tongdu Prescription Based on UPLC-LTQ-Orbitrap-MS and Network Pharmacology
Yan RONG ; Lulu JING ; Hongping HOU ; Huijun WANG ; Lihua CHEN ; Yunxin CHEN ; Liang LI ; Li LIN ; Xiaoqin LUO ; Haiyu ZHAO ; Xiaolu WEI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(10):152-161
ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription (BSTDP). MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry (UPLC-LIT-Orbitrap-MS). Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction (PPI) network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg (mpx: GFP). At three days post-fertilization (3 dpf), larvae of zebrafish were randomly assigned to blank group, model group, positive drug dexamethasone acetate group (75 μmol·L-1), and BSTDP groups with low, medium, and high doses (500, 1 000, and 2 000 mg·L-1). The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 (TLR4)/myeloid differentiation factor 88 (MyD88)/nuclear factor kappa-B (NF-κB) signaling pathway and inflammatory factors including interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) were detected by Real-time quantitative polymerase chain reaction (Real-time PCR). ResultsA total of 120 chemical components were identified in BSTDP, among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis (RA) and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine, vomicine, sinapine, rehmannioside, cinnamyl alcohol glycoside, and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 (Akt1), signal transducer and activator of transcription 3 (STAT3), tumor necrosis factor (TNF), TLR4, mitogen-activated protein kinase 14 (MAPK14), and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α (PIK3CA), thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L-1. Compared to those in the blank group, zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region (P<0.01) and rising mRNA levels of TLR4, MyD88, NF-κB, TNF-α, IL-6, and IL-1β (P<0.01). Compared to that in the model group, the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses, as well as the dexamethasone acetate group (P<0.05, P<0.01). There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4, MyD88, NF-κB, TNF-α, IL-6, and IL-1β were significantly down-regulated (P<0.05, P<0.01). ConclusionThis paper identifies the material basis of the efficacy of BSTDP, demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.
3.Material Basis of Anti-Inflammatory Efficacy and Mechanism of Action of Bushen Tongdu Prescription Based on UPLC-LTQ-Orbitrap-MS and Network Pharmacology
Yan RONG ; Lulu JING ; Hongping HOU ; Huijun WANG ; Lihua CHEN ; Yunxin CHEN ; Liang LI ; Li LIN ; Xiaoqin LUO ; Haiyu ZHAO ; Xiaolu WEI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(10):152-161
ObjectiveThis paper aims to investigate the material basis of the anti-inflammatory efficacy and mechanism of action of Bushen Tongdu prescription (BSTDP). MethodsThe chemical components of BSTDP and its blood-absorbed components in vivo were systematically identified by using ultra-performance liquid chromatography-linear ion trap-electrostatic field orbitrap high-resolution mass spectrometry (UPLC-LIT-Orbitrap-MS). Network pharmacology was employed to screen blood-absorbed bioactive components and potential targets of this formula. A protein-protein interaction (PPI) network of core targets was constructed to conduct enrichment analysis. Molecular docking was further utilized to verify the binding affinity between key components and targets. The inflammatory model was established and verified in vivo by using a transgenic zebrafish Tg (mpx: GFP). At three days post-fertilization (3 dpf), larvae of zebrafish were randomly assigned to blank group, model group, positive drug dexamethasone acetate group (75 μmol·L-1), and BSTDP groups with low, medium, and high doses (500, 1 000, and 2 000 mg·L-1). The distribution and quantity of neutrophils in the yolk sac region were observed under a fluorescence microscope. The mRNA expression levels of key genes in the toll-like receptor 4 (TLR4)/myeloid differentiation factor 88 (MyD88)/nuclear factor kappa-B (NF-κB) signaling pathway and inflammatory factors including interleukin (IL)-1β, IL-6, and tumor necrosis factor-α (TNF-α) were detected by Real-time quantitative polymerase chain reaction (Real-time PCR). ResultsA total of 120 chemical components were identified in BSTDP, among which 26 original components were confirmed by using serum pharmacochemical methods. A total of 227 common targets linking rheumatoid arthritis (RA) and the blood-absorbed components were screened by network pharmacology. It is suggested that pseudobrucine, vomicine, sinapine, rehmannioside, cinnamyl alcohol glycoside, and methylephedrine exert anti-inflammatory effects by acting on core targets including protein kinase B1 (Akt1), signal transducer and activator of transcription 3 (STAT3), tumor necrosis factor (TNF), TLR4, mitogen-activated protein kinase 14 (MAPK14), and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit α (PIK3CA), thereby modulating multiple signaling pathways such as TLR4 and NF-κB. In vivo verification in zebrafish demonstrates that the maximum tolerable concentration of Bushen Tongdu Formula is 2 000 mg·L-1. Compared to those in the blank group, zebrafish in the model group showed a significantly higher number of neutrophils in the yolk sac region (P<0.01) and rising mRNA levels of TLR4, MyD88, NF-κB, TNF-α, IL-6, and IL-1β (P<0.01). Compared to that in the model group, the number of neutrophils was significantly reduced in BSTDP groups with medium and high doses, as well as the dexamethasone acetate group (P<0.05, P<0.01). There was no statistically significant difference in the low dose group. The mRNA expression levels of TLR4, MyD88, NF-κB, TNF-α, IL-6, and IL-1β were significantly down-regulated (P<0.05, P<0.01). ConclusionThis paper identifies the material basis of the efficacy of BSTDP, demonstrating that the formula can exert an anti-inflammatory effect through the TLR4/MyD88/NF-κB signaling pathway. The results provide scientific experimental evidence for its further clinical application.
4.Early internal fixation combined with free anterolateral thigh perforator flap transplantation to treat open ankle fracture-dislocation.
Xingfeng HU ; Xiang WANG ; Liang JI ; Wei LIANG ; Qixin LUO ; Yang PENG ; Qingsong LI
Chinese Journal of Reparative and Reconstructive Surgery 2025;39(9):1175-1179
OBJECTIVE:
To evaluate the effectiveness of early internal fixation combined with free anterolateral thigh perforator flap (ALTPF) transplantation in the treatment of open ankle fracture-dislocation.
METHODS:
A retrospective analysis was performed on the clinical data of 13 patients with open ankle fracture-dislocation who were admitted and met the inclusion criteria between January 2021 and May 2024. Among them, there were 9 males and 4 females, with the ages ranging from 23 to 61 years (mean, 45.3 years). Fracture types included 5 cases of simple medial or lateral malleolar fracture-dislocation, 7 cases of bimalleolar (medial and lateral) fracture-dislocation, and 1 case of trimalleolar fracture-dislocation. Additionally, 3 cases were complicated with bone defects (1 medial malleolus defect and 2 lateral malleolus defects). All injuries were classified as type ⅢB according to the Gustilo-Anderson classification for open fractures. The size of wound defects ranged from 7 cm×5 cm to 18 cm×12 cm. The time from injury to surgery was 2-20 hours (mean, 4 hours). All patients underwent emergency thorough debridement upon admission. The fracture-dislocation was temporarily stabilized with an external fixator, and the wound was covered with antibiotic-impregnated bone cement sheets or vacuum sealing drainage. Definitive internal fixation of the fracture and free ALTPF transplantation were performed 5-7 days after the initial emergency procedure. Postoperatively, wound healing, flap survival, and fracture union were monitored. At last follow-up, clinical outcomes were assessed using the American Orthopaedic Foot and Ankle Society (AOFAS) ankle-hindfoot score.
RESULTS:
All 13 patients were followed up 6-24 months (mean, 8.2 months). All flaps survived completely, and all fractures achieved union, with an union time of 3-11 months (mean, 5.5 months). One patient developed a superficial infection at the wound margin, which healed after regular dressing changes and drainage. No internal fixation-related complication (e.g., deep infection, implant loosening, or secondary ankle instability) were observed. At last follow-up, the total AOFAS ankle-hindfoot score was 78.6±13.5, with 3 excellent, 7 good, 2 fair, and 1 poor cases, yielding an excellent and good rate of 76.9%.
CONCLUSION
Early internal fixation combined with ALTPF transplantation for open ankle fracture-dislocation can shorten the treatment course and maximize the recovery of ankle joint function.
Humans
;
Fracture Fixation, Internal/methods*
;
Male
;
Middle Aged
;
Female
;
Adult
;
Retrospective Studies
;
Perforator Flap/transplantation*
;
Ankle Fractures/surgery*
;
Thigh/surgery*
;
Fractures, Open/surgery*
;
Treatment Outcome
;
Young Adult
;
Plastic Surgery Procedures/methods*
;
Fracture Dislocation/surgery*
5.Analysis of risk factors, pathogenic bacteria characteristics, and drug resistance of postoperative surgical site infection in adults with limb fractures.
Yan-Jun WANG ; Zi-Hou ZHAO ; Shuai-Kun LU ; Guo-Liang WANG ; Shan-Jin MA ; Lin-Hu WANG ; Hao GAO ; Jun REN ; Zhong-Wei AN ; Cong-Xiao FU ; Yong ZHANG ; Wen LUO ; Yun-Fei ZHANG
Chinese Journal of Traumatology 2025;28(4):241-251
PURPOSE:
We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery.
METHODS:
A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics.
RESULTS:
Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%.
CONCLUSION
Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans
;
Surgical Wound Infection/epidemiology*
;
Male
;
Female
;
Risk Factors
;
Retrospective Studies
;
Middle Aged
;
Adult
;
Case-Control Studies
;
Fractures, Bone/surgery*
;
Aged
;
Drug Resistance, Bacterial
;
Logistic Models
;
Anti-Bacterial Agents/therapeutic use*
;
Incidence
;
Bacteria/drug effects*
6.Body fat distribution and semen quality in 4304 Chinese sperm donors.
Si-Han LIANG ; Qi-Ling WANG ; Dan LI ; Gui-Fang YE ; Ying-Xin LI ; Wei ZHOU ; Rui-Jun XU ; Xin-Yi DENG ; Lu LUO ; Si-Rong WANG ; Xin-Zong ZHANG ; Yue-Wei LIU
Asian Journal of Andrology 2025;27(4):524-530
Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans
;
Male
;
Adult
;
Semen Analysis
;
China
;
Body Fat Distribution
;
Longitudinal Studies
;
Sperm Count
;
Sperm Motility
;
Body Mass Index
;
Tissue Donors
;
Obesity/complications*
;
Spermatozoa
;
Young Adult
;
Middle Aged
;
East Asian People
7.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
8.Effect mechanism of LncRNA MALAT1 on doxorubicin resistance in osteosarcoma cells
Fudong LIANG ; Shufang DI ; Wei LUO ; Jianghua QI ; Libing LIU
China Pharmacy 2025;36(6):698-703
OBJECTIVE To investigate the relationship of long non-coding RNA (LncRNA) metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) and doxorubicin (DOX) resistance in osteosarcoma (OS) cells. METHODS MG-63 and MG-63/DOX cells were treated with different concentrations of DOX (0, 0.01, 0.05, 0.1, 1 μmol/L), and survival rates and half maximal inhibitory concentration were determined using CCK-8 assay. The expressions of LncRNA MALAT1 in MG-63 and MG-63/ DOX cells were detected by real-time quantitative fluorescence PCR. MG-63/DOX cells were divided into Control group, knocking down LncRNA MALAT1 negative control (sh-NC) group, sh-MALAT1 group, sh-MALAT1+anti-NC group, and sh-MALAT1+ anti-miR-154-5p group. The expressions of LncRNA MALAT1, miR-154-5p and cyclin D1 (CCND1) mRNA in MG-63/DOX cells of each group were detected. The effects of knocking down LncRNA MALAT1 on the proliferation, migration, invasion, and apoptosis of MG-63/DOX cells were detected by CCK-8 assay, scratch test, Transwell experiment and flow cytometry, respectively. The expression of proliferating cell nuclear protein (PCNA) and CCND1 protein in MG-63/DOX cells was detected by Western blot assay. Interactions between LncRNA MALAT1 and miR-154-5p, miR-154-5p and CCND1 were detected by dual luciferase reporter gene experiment. RESULTS Compared with 0 μmol/L DOX, 0.01, 0.05, 0.1 and 1 μmol/L DOX could reduce the survival rates of MG-63 and MG-63/DOX cells (except for 0.01 μmol/L DOX) (P<0.05), IC50 were 0.07 and 0.13 μmol/L, respectively. The survival rate, cell migration number and invasion number of MG-63/DOX cells, scratch closure rate, mRNA expressions of LncRNA MALAT1, mRNA and protein expressions of CCND1, and PCNA protein expression in sh-MALAT1 group were significantly lower than sh-NC group and Control group; the apoptosis rate and miR-154-5p expression were significantly higher than sh-NC group and Control group (P<0.05). sh-MALAT1+anti-miR-154-5p group was able to reverse the aforementioned biological effects in sh-MALAT1 group (P<0.05). In MG-63/DOX cells transfected with both MALAT1-wild type (WT) and CCND1-WT, the luciferase activity in the miR-154-5p mimic group was significantly lower than mimic negative control group (P< 0.05). CONCLUSIONS Knocking down LncRNA MALAT1 can inhibit the DOX resistance of OS cells, and its mechanism may be targeting the miR-154-5p/CCND1 axis.
9.Key Information and Modern Clinical Application of Classic Formula Xiaoji Yinzi
Baolin WANG ; Lyuyuan LIANG ; Jialei CAO ; Chen CHEN ; Jinyu CHEN ; Chengxin LUO ; Bingqi WEI ; Kaili CHEN ; Peicong XU ; Wei DENG ; Bingxiang MA
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(6):189-198
Xiaoji Yinzi is one of the classic prescriptions for treating urinary diseases, originated from the Yan's Prescriptions to Aid the Living (Yan Shi Ji Sheng Fang) written by YAN Yonghe in the Song dynasty. Xiaoji Yinzi is composed of Rehmanniae Radix, Cirsii Herba, Talcum, Akebiae Caulis, Typhae Pollen, Nelumbinis Rhizomatis Nodus, Lophatheri Herba, Angelicae Sinensis Radix, Gardeniae Fructus, and Glycyrrhizae Radix et Rhizoma and has the effects of cooling blood and stopping bleeding, draining water and relieving stranguria. The medical experts of later generations have inherited the original prescription recorded in the Yan's Prescriptions to Aid the Living, while dispute has emerged during the inheritance of this prescription. In this study, the method of bibliometrics was employed to review and analyze the ancient documents and modern clinical studies involving Xiaoji Yinzi. The results showed that Xiaoji Yinzi has two dosage forms: powder and decoction. According to the measurement system in the Song Dynasty, the modern doses of hers in Xiaoji Yinzi were transformed. In the prepration of Xiaoji Yinzi powder, 149.2 g of Rehmanniae Radix and 20.65 g each of Cirsii Herba, Talcum, Akebiae Caulis, stir-fried Typhae Pollen, Nelumbinis Rhizomatis Nodus, Lophatheri Herba, wine-processed Angelicae Sinensis Radix, stir-fried Gardeniae Fructus, and stir-fried Glycyrrhizae Radix et Rhizoma are grounded into fine powder with the particle size of 4-10 meshes and a decocted with 450 mL water to reach a volume of 240 mL. After removal of the residue, the decoction was taken warm before meals, 3 times a day (i.e., 7.77 g Rehmanniae Radix and 0.97 g each of the other herbs each time). In the preparation of Xiaoji Yinzi decoction, 20.65 g each of the above 10 herbs are used, with stir-fried Typhae Pollen, wine-processed Angelica Sinensis Radix, stir-fired Gardeniae Fructus, stir-fired Glycyrrhizae Radix et Rhizoma, and raw materials of other herbs. Xiaoji Yinzi is specialized in treating hematuresis and blood stranguria due to heat accumulation in lower energizer, which causes injury of the blood collaterals of gallbladder and dysfunction of Qi transformation. In modern clinical practice, Xiaoji Yinzi is specifically used for treating urinary diseases and can be expanded to treat diseases of the cardiovascular system and other systems according to pathogenesis. The comprehensive research on the key information could provide a scientific reference for the future development of Xiaoji Yinzi.
10.Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury (version 2025)
Aijun XU ; Shuixia LI ; Bo CHEN ; Mengyuan YE ; Lejiao LANG ; Ning NING ; Lin ZHANG ; Changqing LIU ; Zhonglan CHEN ; Weihu MA ; Weishi LI ; Xiaoning WANG ; Dongmei BIAN ; Jiancheng ZENG ; Xin WANG ; Yuan GAO ; Yaping CHEN ; Jiali CHEN ; Yun HAN ; Xiuting LI ; Yang ZHOU ; Xiaojing SU ; Qiong ZHANG ; Tianwen HUANG ; Ping ZHANG ; Hua LIN ; Xingling XIAO ; Ruifeng XU ; Fanghui DONG ; Bing HAN ; Luo FAN ; Yanling PEI ; Suyun LI ; Xiaoju TAN ; Rongchen GUO ; Yefang ZOU ; Xiaoyun HAN ; Junqin DING ; Yi WANG ; Shuhua DENG ; Jinli GUO ; Yinhua LIANG ; Yuan CEN ; Xiaoqin LIU ; Junru CHEN ; Haiyang YU ; Lunlan LI ; Ying REN ; Yunxia LI ; Jianli LU ; Ying YING ; Lan WEI ; Yin WANG ; Qinhong XU ; Yanqin ZHANG ; Yang LYU ; Shijun ZHANG ; Sui WENJIE ; Sanlian HU ; Shuhong YANG ; Guoqing LI ; Jingjing AN ; Baorong HE ; Leling FENG
Chinese Journal of Trauma 2025;41(6):530-541
Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.

Result Analysis
Print
Save
E-mail